The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016396	Mycobacterium avium strain RCAD0278, complete genome	4953610	289102	360151	4953610	transposase,integrase	Corynebacterium_phage(28.57%)	58	282557:282576	354515:354534
282557:282576	attL	CGCGGTCCAGGTGCACGGCG	NA	NA	NA	NA
WP_011724852.1|289102_290683_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_128971849.1|291096_292260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121035649.1|292602_293823_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	40.3	1.8e-62
WP_029248429.1|293744_294851_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.2	1.9e-10
WP_085988246.1|294901_297079_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009980034.1|297068_297500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724255.1|298502_299534_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_009975831.1|299633_300842_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011724254.1|300903_301275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009975830.1|301219_301522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009975829.1|301523_303014_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011724253.1|303027_303537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724252.1|303783_305751_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_065370722.1|305747_306989_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_023879828.1|306985_308134_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_009975823.1|308347_309307_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009975822.1|309600_310833_+	cytochrome P450	NA	NA	NA	NA	NA
WP_065370723.1|310829_311987_+	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.6	2.6e-34
WP_011724248.1|311994_313899_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_019732717.1|313902_314580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009975817.1|314603_315221_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023884191.1|315296_316121_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020371241.1|316178_317399_-	cytochrome P450	NA	NA	NA	NA	NA
WP_023884190.1|317580_319077_+	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
WP_050680726.1|319149_320223_-	TIGR03857 family LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003873147.1|320186_320567_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_009975810.1|320566_321688_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009975809.1|321702_323325_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009975808.1|323441_324455_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_009975807.1|324451_325081_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_009975806.1|325077_325710_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_065370724.1|325718_327371_+	acyl-CoA synthetase	NA	A0A2K9L3I8	Tupanvirus	20.5	2.8e-05
WP_009975803.1|328383_329586_+	cytochrome P450	NA	NA	NA	NA	NA
WP_011724241.1|329608_330823_+	CoA transferase	NA	NA	NA	NA	NA
WP_009975800.1|330877_332023_+	thiolase family protein	NA	NA	NA	NA	NA
WP_011724240.1|332139_333333_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003873159.1|333333_334380_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_065370725.1|334382_335213_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003873162.1|336868_338071_-	amidohydrolase	NA	NA	NA	NA	NA
WP_009975795.1|338090_338915_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003873164.1|339226_339469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023879827.1|339522_340539_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_009975793.1|340583_341381_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009975791.1|341561_342365_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009975789.1|342384_343275_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_009974923.1|343506_344712_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080555730.1|344730_345138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009975754.1|346213_346666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009975755.1|346843_347206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009975756.1|347559_350169_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.9	1.4e-32
WP_009975757.1|350165_351902_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	3.7e-24
WP_023884184.1|351980_353057_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003873183.1|353061_353490_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_062886559.1|354359_355553_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
354515:354534	attR	CGCCGTGCACCTGGACCGCG	NA	NA	NA	NA
WP_015632616.1|355720_356470_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.3	5.5e-09
WP_065370726.1|356466_357687_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_003873178.1|357688_358888_+	dehydratase	NA	NA	NA	NA	NA
WP_009974923.1|358945_360151_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016396	Mycobacterium avium strain RCAD0278, complete genome	4953610	862028	895195	4953610	transposase,terminase,capsid,portal,integrase	Mycobacterium_phage(42.86%)	30	858030:858045	899223:899238
858030:858045	attL	CCGGGTGGTGCCCGAG	NA	NA	NA	NA
WP_011723914.1|862028_863081_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023884559.1|863095_864010_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009975191.1|864027_865965_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_065370771.1|865961_868262_-	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	36.1	7.7e-38
WP_065370772.1|868540_870034_+	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	32.0	7.2e-53
WP_009975185.1|870030_870891_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_009975183.1|871018_872431_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009975181.1|872427_873336_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_009975180.1|873373_874282_+	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	50.4	6.9e-67
WP_009975179.1|874287_875196_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_009975178.1|875192_876179_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_010949005.1|876185_877295_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_023884562.1|877789_878581_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009975173.1|878605_879682_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003877474.1|879778_881005_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_009975171.1|881005_882085_+	replication protein	NA	NA	NA	NA	NA
WP_009975169.1|882092_882917_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009979999.1|883398_884193_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_011724852.1|884189_885770_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_065370773.1|885822_886125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023879603.1|886124_886985_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_023879602.1|887068_887410_-	hypothetical protein	NA	A0A173G9N0	Mycobacterium_phage	59.8	8.4e-34
WP_050427686.1|887406_887814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009978425.1|887873_889247_-|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	32.2	3.5e-46
WP_029248570.1|889271_890741_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_128971797.1|890825_891224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009978428.1|891594_891876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080555761.1|891991_892456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128971796.1|893695_893956_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009978430.1|894100_895195_-|integrase	site-specific integrase	integrase	A0A088F8U2	Mycobacterium_phage	53.7	1.2e-105
899223:899238	attR	CTCGGGCACCACCCGG	NA	NA	NA	NA
>prophage 3
NZ_CP016396	Mycobacterium avium strain RCAD0278, complete genome	4953610	2198427	2243478	4953610	transposase,holin,integrase,protease	uncultured_Mediterranean_phage(25.0%)	38	2194154:2194170	2216566:2216582
2194154:2194170	attL	GTCGCGCAGCCGCTGCC	NA	NA	NA	NA
WP_009974923.1|2198427_2199633_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065370929.1|2199795_2201433_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_009974187.1|2201939_2202377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009974189.1|2202397_2202760_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_009974190.1|2202799_2203297_-	DinB family protein	NA	NA	NA	NA	NA
WP_023886092.1|2203484_2205386_+	TNT domain-containing protein	NA	NA	NA	NA	NA
WP_016705393.1|2205607_2205862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724852.1|2206261_2207842_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009979999.1|2207838_2208633_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_009980034.1|2209341_2209773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085988246.1|2209762_2211940_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_029248429.1|2211990_2213097_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.2	1.9e-10
WP_065370931.1|2214282_2215488_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_010948854.1|2215586_2217248_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.8	8.4e-18
2216566:2216582	attR	GGCAGCGGCTGCGCGAC	NA	NA	NA	NA
WP_009974717.1|2217244_2220043_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	30.7	8.6e-100
WP_011723615.1|2220247_2220838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003419650.1|2221026_2221230_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	56.2	2.0e-14
WP_009974715.1|2221478_2223809_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_003873275.1|2223891_2224929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516381.1|2224925_2225294_-	helicase	NA	NA	NA	NA	NA
WP_033722333.1|2225250_2225517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009974713.1|2225576_2225777_-	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_065371194.1|2225795_2226383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065370932.1|2226405_2227209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023884919.1|2227205_2228381_-	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_011723573.1|2228377_2229430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003877071.1|2229942_2230800_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_003877070.1|2231265_2232024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031348150.1|2232013_2233660_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.0	8.0e-13
WP_009974705.1|2233656_2234532_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009974704.1|2234524_2235451_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023861983.1|2235452_2237078_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009974702.1|2237163_2237706_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_009974701.1|2237820_2239773_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	5.8e-87
WP_003877062.1|2239894_2240566_-	peptidase	NA	NA	NA	NA	NA
WP_009974700.1|2240786_2241326_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003873293.1|2241326_2242292_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003877060.1|2242284_2243478_-|protease	acid resistance serine protease MarP	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	25.0	2.6e-05
>prophage 4
NZ_CP016396	Mycobacterium avium strain RCAD0278, complete genome	4953610	3103628	3110200	4953610		Bacillus_phage(33.33%)	7	NA	NA
WP_009978328.1|3103628_3104561_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.9	4.6e-05
WP_065371011.1|3104495_3105539_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	27.9	4.7e-19
WP_009978325.1|3105538_3106153_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003874932.1|3106246_3106801_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	5.4e-06
WP_003874933.1|3107330_3107570_+	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.5	2.0e-21
WP_065371012.1|3107612_3108065_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	36.9	4.9e-13
WP_024636978.1|3108034_3110200_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	7.4e-208
>prophage 5
NZ_CP016396	Mycobacterium avium strain RCAD0278, complete genome	4953610	3454542	3473084	4953610	transposase,integrase	Enterobacteria_phage(40.0%)	14	3449735:3449749	3476334:3476348
3449735:3449749	attL	CGACGGCACCCTCGA	NA	NA	NA	NA
WP_011724852.1|3454542_3456123_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009979999.1|3456119_3456914_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_081304380.1|3457073_3457319_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_155763156.1|3457708_3458287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155763157.1|3458283_3459642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029248429.1|3460963_3462070_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.2	1.9e-10
WP_085988246.1|3462120_3464298_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009980034.1|3464287_3464719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724852.1|3465161_3466742_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009979999.1|3466738_3467533_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_128971805.1|3468034_3468526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023879706.1|3469674_3470844_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D8EV90	Mycobacterium_phage	39.2	1.7e-62
WP_023879707.1|3471120_3471381_+	excisionase family DNA-binding protein	NA	A0A2P1CHK7	Mycobacterium_phage	66.7	1.8e-15
WP_080555769.1|3471671_3473084_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3476334:3476348	attR	CGACGGCACCCTCGA	NA	NA	NA	NA
