The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	196905	225989	4902106	terminase,integrase	Escherichia_phage(25.71%)	47	187770:187783	212797:212810
187770:187783	attL	GTGGGACAAGCTGA	NA	NA	NA	NA
WP_017456948.1|196905_197568_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	38.5	1.9e-05
WP_017456949.1|197579_197810_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
WP_065368198.1|197947_198322_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_017456951.1|198325_199195_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_065370595.1|199213_199552_+	YebY family protein	NA	NA	NA	NA	NA
WP_065368199.1|199889_200975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.1	2.1e-147
WP_006622866.1|200943_201216_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	58.9	6.7e-26
WP_065368200.1|201711_201933_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	50.0	1.8e-13
WP_065368201.1|201929_202535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065368202.1|202531_202756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065368203.1|202755_203421_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	80.9	4.1e-101
WP_065368204.1|203578_204010_-	regulator	NA	G8C7S8	Escherichia_phage	65.7	1.2e-45
WP_065368205.1|204006_204687_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	92.0	3.3e-122
WP_156773063.1|204688_204976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065368206.1|204972_205743_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	89.8	6.2e-133
WP_065368207.1|205761_206046_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	57.4	2.9e-27
WP_065368208.1|206053_206992_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	71.9	2.9e-36
WP_065368209.1|207065_207263_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_156773109.1|207262_207433_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_065368211.1|207551_208568_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	6.6e-42
WP_065368212.1|208724_209084_-	hypothetical protein	NA	A0A2I6PHW0	Pseudomonas_phage	42.1	5.8e-09
WP_032677016.1|209416_210121_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.1	2.1e-103
WP_006622888.1|210232_210460_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
WP_065368213.1|210500_210722_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_065368214.1|211058_211877_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	68.8	7.8e-94
WP_065368215.1|211936_212908_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	70.3	5.5e-54
212797:212810	attR	GTGGGACAAGCTGA	NA	NA	NA	NA
WP_065368216.1|212904_213591_+	phage replication protein	NA	G8C7U6	Escherichia_phage	62.9	2.4e-80
WP_065368217.1|213592_213886_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	63.4	5.0e-27
WP_065368218.1|213882_214341_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	58.3	2.5e-20
WP_083126857.1|214337_214628_+	hypothetical protein	NA	Q8LTB2	Lactobacillus_phage	53.2	5.9e-12
WP_065368220.1|214624_215107_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	2.2e-72
WP_065368221.1|215103_215544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368222.1|215546_215966_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	76.5	1.5e-56
WP_065368223.1|215962_216820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368224.1|216821_217106_+	DUF4752 family protein	NA	K7PHN1	Enterobacterial_phage	51.7	4.7e-22
WP_065368225.1|217368_217824_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	3.7e-61
WP_071908147.1|217823_217994_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	1.4e-16
WP_065368226.1|217986_218625_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	83.0	1.9e-95
WP_065368227.1|218740_219445_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	3.1e-54
WP_156773110.1|219879_220158_+	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	75.3	3.4e-25
WP_065368229.1|220159_220669_+	lysozyme	NA	A0A0M3ULD1	Salmonella_phage	64.7	4.9e-62
WP_083126859.1|220661_221084_+	hypothetical protein	NA	F1C5D3	Cronobacter_phage	34.1	1.1e-09
WP_065368230.1|221351_221600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368231.1|221660_222401_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.0	3.1e-17
WP_065368232.1|222403_223735_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.2	1.7e-154
WP_065368233.1|223746_225168_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.0	9.1e-90
WP_065368234.1|225164_225989_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.9	1.2e-52
>prophage 2
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	238279	245268	4902106	plate	Escherichia_phage(33.33%)	9	NA	NA
WP_065368247.1|238279_238996_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	29.6	5.4e-22
WP_065368248.1|238992_239325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368249.1|239321_240740_+|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	39.6	1.1e-42
WP_065368250.1|240741_241446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368252.1|241771_242926_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	67.2	7.3e-13
WP_065368253.1|242925_243537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065368254.1|243544_244585_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.4	3.1e-10
WP_065368255.1|244711_244951_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	64.1	5.0e-25
WP_065368256.1|244950_245268_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	4.3e-24
>prophage 3
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	3712274	3799825	4902106	head,transposase,tRNA,tail,lysis,plate,capsid,portal,holin,integrase,terminase	Erwinia_phage(24.14%)	91	3760765:3760813	3793676:3793724
WP_017459077.1|3712274_3713033_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_017459076.1|3713053_3713557_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065369964.1|3713754_3714957_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_065369965.1|3715051_3717907_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	4.2e-142
WP_017459073.1|3717906_3718350_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017459072.1|3718516_3720028_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	1.0e-46
WP_065369966.1|3720295_3721396_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017459070.1|3721395_3722478_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_065369967.1|3722535_3723018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065369968.1|3723103_3724741_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_017459067.1|3724934_3725954_-	NAD(P)-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	30.1	1.3e-42
WP_065369969.1|3726191_3726644_+	lysozyme	NA	A0A1B1P9G1	Acinetobacter_phage	57.5	2.8e-37
WP_017459065.1|3726779_3727415_+	DUF2589 domain-containing protein	NA	NA	NA	NA	NA
WP_065369970.1|3727472_3728156_+	DUF2589 domain-containing protein	NA	NA	NA	NA	NA
WP_020456325.1|3728148_3728604_+	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	52.1	1.9e-33
WP_065369971.1|3728620_3729094_+	ribonuclease	NA	NA	NA	NA	NA
WP_045513587.1|3729149_3729560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017459060.1|3729556_3729973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065369972.1|3730132_3730660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017459058.1|3730755_3731355_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065369974.1|3732170_3733424_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.4e-73
WP_065369975.1|3733545_3734340_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	29.7	3.4e-09
WP_065369976.1|3734366_3735434_-	protein beta	NA	NA	NA	NA	NA
WP_065369977.1|3735436_3735838_-	protein gop	NA	NA	NA	NA	NA
WP_065369978.1|3736315_3736519_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	65.4	2.9e-13
WP_065369979.1|3736522_3737320_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_065369980.1|3737892_3738159_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	1.5e-30
WP_071908211.1|3738155_3738704_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.0e-28
WP_065369982.1|3738700_3738928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065369983.1|3738924_3739245_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_065369984.1|3739254_3741588_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.9	0.0e+00
WP_020454816.1|3741991_3742327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065369985.1|3742323_3742905_-	hypothetical protein	NA	A0A2R4ANA2	Mycobacterium_phage	38.4	1.0e-18
WP_065369986.1|3743039_3743426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065370672.1|3743792_3744488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065369987.1|3744877_3746143_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	2.4e-81
WP_065369988.1|3746340_3749703_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_083126971.1|3749702_3753125_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	27.0	5.9e-26
WP_065369989.1|3753175_3756121_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	51.3	1.6e-274
WP_065369990.1|3756107_3756353_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073554262.1|3756565_3756691_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083126973.1|3756846_3757701_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.6	9.7e-79
WP_105532227.1|3759033_3760201_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	1.8e-176
3760765:3760813	attL	ATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_065369993.1|3760930_3761884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065369994.1|3761864_3762902_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.2	3.3e-190
WP_065369995.1|3762901_3763474_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	67.7	3.8e-71
WP_065369996.1|3763609_3763873_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	90.8	1.8e-39
WP_065369997.1|3763903_3764413_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	86.4	1.2e-79
WP_071908212.1|3764417_3764609_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	60.6	6.8e-17
WP_007370020.1|3764572_3764911_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	82.1	1.2e-45
WP_020455346.1|3764978_3765206_+	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	73.3	1.1e-21
WP_065369998.1|3765205_3765430_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	81.1	2.9e-27
WP_065369999.1|3765426_3765702_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	4.6e-14
WP_065370000.1|3765698_3767921_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	83.9	0.0e+00
WP_071908213.1|3768041_3768233_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	68.9	8.9e-09
WP_065370001.1|3768478_3769966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065370002.1|3770051_3770912_+	DNA adenine methylase	NA	B0ZSH4	Halomonas_phage	21.9	1.9e-05
WP_065370003.1|3771243_3772281_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.3	9.4e-161
WP_065370004.1|3772280_3774050_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	83.5	2.0e-296
WP_065370005.1|3774227_3775085_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	74.4	9.7e-103
WP_065370006.1|3775121_3776285_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	3.7e-129
WP_065370007.1|3776288_3777047_+|terminase	terminase endonuclease subunit	terminase	Q94MI7	Enterobacteria_phage	68.1	9.8e-83
WP_065370008.1|3777143_3777650_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	86.9	1.1e-64
WP_065370009.1|3777649_3777853_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	80.6	2.5e-25
WP_020455331.1|3777843_3778080_+|holin	holin	holin	A0A218M4L5	Erwinia_phage	45.2	6.9e-11
WP_065370010.1|3778063_3778576_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	78.2	4.8e-73
WP_083126976.1|3778572_3779001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083127060.1|3779000_3779408_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	73.1	3.3e-45
WP_065370012.1|3779515_3779983_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	77.3	2.2e-64
WP_065370013.1|3779975_3780437_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	3.1e-47
WP_065370014.1|3780444_3781200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065370015.1|3781267_3781903_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	86.3	2.6e-100
WP_065370016.1|3781899_3782247_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	78.3	4.1e-44
WP_065370017.1|3782251_3783160_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	78.5	1.1e-128
WP_065370018.1|3783152_3783764_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	84.1	2.6e-94
WP_083126980.1|3783760_3785227_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	65.4	7.0e-93
WP_065370019.1|3785223_3785433_+	hypothetical protein	NA	Q9B026	Phage_GMSE-1	48.1	7.8e-06
WP_065370020.1|3785535_3786726_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	89.6	7.9e-204
WP_065370021.1|3786739_3787258_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	92.4	2.8e-89
WP_065370022.1|3787319_3787595_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	85.7	9.5e-36
WP_020455315.1|3787627_3787747_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	3.3e-14
WP_065370023.1|3787739_3790211_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	68.4	3.6e-267
WP_065370024.1|3790223_3790700_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	75.2	4.9e-64
WP_065370025.1|3790699_3791857_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	76.1	2.1e-156
WP_065370026.1|3792133_3793207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071908215.1|3793315_3793534_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	83.3	8.6e-32
WP_065370027.1|3793880_3794387_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3793676:3793724	attR	ATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_017457431.1|3794445_3796287_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_017457432.1|3796443_3798189_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.2	5.4e-76
WP_001144069.1|3798357_3798573_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017457433.1|3798811_3799825_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	2.4e-108
>prophage 4
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	4290706	4358925	4902106	tail,tRNA,lysis,plate,capsid,integrase	Erwinia_phage(32.43%)	69	4282804:4282826	4295458:4295480
4282804:4282826	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_065370284.1|4290706_4291504_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_061493526.1|4291507_4291711_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	65.4	2.9e-13
WP_023337669.1|4292173_4292398_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_065370285.1|4292445_4293042_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_065370286.1|4293034_4294210_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_065370287.1|4294210_4295407_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.6	1.0e-105
WP_017459912.1|4296362_4296845_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.4e-29
4295458:4295480	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_017459913.1|4296964_4297441_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_065370288.1|4297430_4297724_+	RnfH family protein	NA	NA	NA	NA	NA
WP_017459915.1|4297860_4298202_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_139164788.1|4301100_4301697_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_065370290.1|4301805_4303092_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017459920.1|4303109_4303898_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_017459922.1|4304064_4305426_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_017459923.1|4305675_4305924_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017459924.1|4305942_4306491_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017459925.1|4306521_4307289_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004104634.1|4307334_4307682_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017459926.1|4308112_4308307_-	levansucrase regulator	NA	Q37973	Salmonella_virus	68.9	3.9e-20
WP_065370291.1|4308385_4309522_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	48.6	1.2e-95
WP_065370292.1|4309521_4309980_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	64.9	6.0e-51
WP_065370293.1|4309994_4311875_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	47.2	1.5e-39
WP_017459930.1|4311867_4311987_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	1.3e-13
WP_020454794.1|4312019_4312301_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	1.0e-29
WP_020454793.1|4312361_4312880_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	88.4	8.5e-86
WP_065370294.1|4312892_4314074_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	87.8	4.8e-201
WP_065370295.1|4314220_4315171_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	74.4	1.6e-74
WP_065370296.1|4315301_4315898_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	61.9	3.3e-65
WP_065370297.1|4315897_4316959_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	61.5	2.5e-116
WP_065370298.1|4317089_4317686_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	61.9	1.2e-64
WP_065370299.1|4317685_4318744_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	57.8	3.0e-106
WP_017459937.1|4318900_4319509_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	77.5	3.7e-88
WP_017459938.1|4319501_4320410_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	77.5	4.1e-128
WP_065370300.1|4320414_4320762_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	72.2	2.8e-40
WP_017459940.1|4320758_4321394_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	82.0	2.5e-95
WP_065370301.1|4321471_4321939_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	61.4	2.8e-48
WP_065370302.1|4322046_4322460_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	45.3	3.6e-23
WP_065370303.1|4322456_4322966_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.6	2.1e-65
WP_017459945.1|4322940_4323171_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	44.6	4.0e-11
WP_065370304.1|4323161_4323365_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	73.3	1.6e-19
WP_017459947.1|4323575_4323761_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	7.8e-18
WP_065370305.1|4323835_4325890_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	65.0	5.5e-253
WP_017459949.1|4325890_4326112_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	74.6	3.3e-23
WP_065370306.1|4326111_4326339_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_065370307.1|4326406_4326745_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	64.9	7.6e-35
WP_156773102.1|4326783_4327161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025263876.1|4327276_4328128_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	59.1	1.0e-88
WP_071908226.1|4328194_4328749_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_065370309.1|4328811_4330173_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_065370310.1|4330356_4331427_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	4.8e-91
WP_065370311.1|4331436_4332558_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_065370312.1|4332626_4333499_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_065370313.1|4333495_4334656_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_017459960.1|4334913_4335252_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017459961.1|4335518_4336256_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_065370314.1|4336387_4337368_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_065370315.1|4337364_4338096_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_065370316.1|4338225_4340799_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	1.2e-124
WP_065370318.1|4346742_4348041_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	6.9e-44
WP_017459054.1|4348044_4348365_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_065370319.1|4348410_4349766_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_065370320.1|4349885_4352540_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_065370321.1|4352572_4353271_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017459050.1|4353340_4353760_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	6.3e-15
WP_065370322.1|4353964_4355083_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_017459048.1|4355291_4355981_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.9	1.8e-54
WP_065370323.1|4356296_4356680_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	1.4e-32
WP_017459046.1|4356723_4358058_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	6.7e-42
WP_065370324.1|4358187_4358925_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	4783832	4792189	4902106	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_065370528.1|4783832_4784780_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	5.8e-08
WP_065370529.1|4784763_4785501_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017459817.1|4785475_4785589_-	protein YohO	NA	NA	NA	NA	NA
WP_017459818.1|4785649_4786381_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	76.4	9.2e-86
WP_017459819.1|4786600_4788289_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	7.2e-259
WP_017459820.1|4788282_4789002_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_065370530.1|4789055_4789541_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.7	2.5e-63
WP_065370531.1|4789613_4790069_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	42.3	1.6e-27
WP_065370691.1|4790155_4792189_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.2	4.7e-55
>prophage 6
NZ_CP016337	Kosakonia sacchari strain BO-1 chromosome, complete genome	4902106	4884718	4894153	4902106		Enterobacteria_phage(42.86%)	9	NA	NA
WP_065370576.1|4884718_4886134_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	4.9e-19
WP_065370577.1|4886311_4887205_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	1.8e-43
WP_065370578.1|4887612_4888701_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	5.7e-100
WP_065370579.1|4888715_4889585_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	3.2e-109
WP_065370580.1|4889609_4890500_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.0	5.3e-27
WP_065370581.1|4890517_4891066_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.4	1.0e-49
WP_156773108.1|4891062_4891995_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065370583.1|4892061_4892871_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065370584.1|4892860_4894153_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.4e-14
