The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	452065	491136	3332458	transposase	Catovirus(18.18%)	24	NA	NA
WP_065366598.1|452065_453331_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	97.6	7.8e-234
WP_065366599.1|454634_457286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146144398.1|457325_458192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366601.1|458229_459606_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_065366602.1|459824_460709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077311031.1|460836_461559_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060563812.1|463502_463925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111901.1|464312_468842_-	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	31.6	2.3e-33
WP_065366603.1|469172_470426_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.0	4.0e-20
WP_081299818.1|473745_475935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060563823.1|475977_476886_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065366605.1|477164_478352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366606.1|478386_478602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366607.1|478620_481614_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	30.0	3.4e-25
WP_081299819.1|481872_482157_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_034983522.1|482180_483491_-|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_060563542.1|483665_484976_-|transposase	ISL3-like element IS13869 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_089158485.1|485485_485824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107111903.1|485637_486420_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	5.9e-14
WP_107111904.1|486397_487599_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	2.7e-26
WP_075348078.1|487657_487837_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.1	2.4e-08
WP_065366609.1|487976_488456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348475.1|488656_490066_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.1e-45
WP_075348476.1|490257_491136_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	9.4e-45
>prophage 2
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	1472992	1529750	3332458	transposase,tRNA,integrase	Mycobacterium_phage(37.5%)	39	1492493:1492508	1519050:1519065
WP_034983522.1|1472992_1474303_-|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_003861455.1|1475151_1476174_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_081299840.1|1476198_1477230_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060564434.1|1479218_1479875_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_003861462.1|1479935_1480742_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_060564436.1|1480743_1481349_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_060564437.1|1481842_1482973_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_081299894.1|1483047_1484529_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003854060.1|1484600_1484816_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060564438.1|1484816_1485290_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_060564439.1|1485406_1485931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111913.1|1486552_1487023_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_034983522.1|1488510_1489821_-|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_146144406.1|1490482_1491703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564443.1|1492477_1493101_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.1	9.1e-18
1492493:1492508	attL	AAGAAGTCTGATCTTT	NA	NA	NA	NA
WP_065366843.1|1493156_1495190_+	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	38.1	1.8e-67
WP_081299841.1|1495186_1497832_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_146144407.1|1497934_1498333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065367237.1|1498337_1499795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564448.1|1500410_1502213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299842.1|1502209_1503628_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060564449.1|1505565_1506801_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065366844.1|1506797_1509884_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.3	1.8e-58
WP_081299843.1|1509867_1510614_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_060564451.1|1510655_1512287_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_065366845.1|1512283_1513381_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564454.1|1514275_1515241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111914.1|1516391_1517231_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.5	1.5e-07
WP_060564456.1|1517311_1518235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366846.1|1518368_1519781_+	hypothetical protein	NA	NA	NA	NA	NA
1519050:1519065	attR	AAGAAGTCTGATCTTT	NA	NA	NA	NA
WP_060564458.1|1519875_1521102_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_107111897.1|1521861_1523047_+|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
WP_081299844.1|1523066_1523318_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564459.1|1523425_1524580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1524576_1524903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366847.1|1524899_1526663_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1527001_1527292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065367239.1|1527831_1528161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983522.1|1528439_1529750_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
>prophage 3
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	1556747	1602169	3332458	protease,transposase,integrase	Shigella_phage(37.5%)	41	1556609:1556660	1570236:1570287
1556609:1556660	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_081299846.1|1556747_1557506_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	32.1	1.8e-15
WP_011014294.1|1557491_1557902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1557898_1558645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1558837_1559272_+	metallopeptidase	NA	NA	NA	NA	NA
WP_089158527.1|1559950_1561152_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_065366854.1|1561257_1561872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858801.1|1561874_1562096_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1562744_1563179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1563194_1563410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1563848_1564220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011014297.1|1564240_1564558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858792.1|1564936_1565140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861526.1|1566111_1566489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861528.1|1566747_1567698_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_003858787.1|1567802_1568111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858785.1|1568120_1568687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564480.1|1569037_1569262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564481.1|1569309_1569603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065366855.1|1570504_1573147_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	7.5e-45
1570236:1570287	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_060564483.1|1573143_1574544_-	MFS transporter	NA	NA	NA	NA	NA
WP_060564484.1|1574580_1575558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060564485.1|1575560_1576436_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.9	2.8e-57
WP_075348197.1|1576810_1577590_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065366856.1|1577841_1579308_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_065366857.1|1579966_1581991_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_060564489.1|1582038_1582641_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_107111897.1|1583490_1584677_-|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
WP_003858758.1|1584946_1585306_+	DUF4259 domain-containing protein	NA	NA	NA	NA	NA
WP_040967371.1|1585373_1585856_+	FABP family protein	NA	NA	NA	NA	NA
WP_065366859.1|1585852_1586791_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_065366860.1|1586822_1588274_-	MFS transporter	NA	NA	NA	NA	NA
WP_065366861.1|1588287_1589211_-	ribokinase	NA	NA	NA	NA	NA
WP_060564494.1|1589203_1590244_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_107111916.1|1593302_1594495_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.3	3.0e-25
WP_146144408.1|1594538_1595306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564497.1|1595326_1596001_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.4e-26
WP_146144409.1|1595975_1597382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081299847.1|1597602_1599765_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_060564499.1|1599895_1600339_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861566.1|1600425_1600809_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107111897.1|1600982_1602169_-|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
>prophage 4
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	1803733	1809144	3332458	integrase	Corynephage(33.33%)	7	1797939:1797952	1808602:1808615
1797939:1797952	attL	TCGCCGCCACCAAC	NA	NA	NA	NA
WP_081299849.1|1803733_1804045_+	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	42.7	4.4e-05
WP_065366910.1|1804083_1804674_+	hypothetical protein	NA	A0A1P8D5Q9	Corynebacterium_phage	53.3	2.6e-22
WP_060564602.1|1805406_1806165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564603.1|1806269_1806602_+	hypothetical protein	NA	Q9ZWV7	Corynephage	45.0	2.8e-18
WP_060564604.1|1806632_1807175_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZWV7	Corynephage	31.0	2.7e-10
WP_060564605.1|1807278_1807509_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L6BZH2	Pasteurella_phage	43.1	1.3e-06
WP_065366912.1|1807512_1809144_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	6.0e-37
1808602:1808615	attR	GTTGGTGGCGGCGA	NA	NA	NA	NA
>prophage 5
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	2604018	2648264	3332458	protease,transposase	Mycobacterium_phage(50.0%)	36	NA	NA
WP_060564962.1|2604018_2605329_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.5	4.5e-83
WP_155268194.1|2605849_2605993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065367069.1|2607475_2607940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857996.1|2608020_2608377_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_003860315.1|2608451_2609072_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	26.9	2.3e-05
WP_060564964.1|2609098_2609836_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_040967553.1|2610021_2611056_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081299906.1|2611109_2611403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564966.1|2613691_2614402_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.0	1.5e-77
WP_081299862.1|2614394_2615252_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_065367255.1|2615248_2616070_-	M23 family metallopeptidase	NA	W8ED04	Mycobacterium_phage	48.0	6.8e-21
WP_060564970.1|2616812_2617091_-	amino acid acetyltransferase	NA	NA	NA	NA	NA
WP_060564974.1|2619776_2620817_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_034983522.1|2621570_2622881_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_011896442.1|2624307_2624673_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060564975.1|2624849_2625434_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_065367071.1|2625693_2627850_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_018297431.1|2628196_2628988_+	M23 family metallopeptidase	NA	O03937	Lactobacillus_phage	44.8	3.3e-20
WP_060564978.1|2629132_2629465_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035123040.1|2629566_2630274_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_035123041.1|2630283_2630934_+	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_075348333.1|2630980_2631304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564980.1|2633059_2633968_+	cation transporter	NA	NA	NA	NA	NA
WP_081299863.1|2633993_2634665_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_107111930.1|2634865_2635399_+	DinB family protein	NA	NA	NA	NA	NA
WP_060564983.1|2636944_2637340_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060564985.1|2637476_2638451_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_040968218.1|2639875_2641204_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_040967800.1|2642742_2643510_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060564990.1|2643612_2644467_-	glutamate racemase	NA	NA	NA	NA	NA
WP_040967802.1|2644517_2645144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011015181.1|2645153_2645648_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564992.1|2645677_2646427_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_065367072.1|2646423_2647338_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_060564997.1|2647337_2647877_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_074493708.1|2647889_2648264_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
>prophage 6
NZ_CP004062	Corynebacterium glutamicum ZL-6, complete genome	3332458	3183249	3236033	3332458	transposase,integrase	Streptococcus_phage(13.33%)	53	3181968:3181987	3236076:3236095
3181968:3181987	attL	GTCCACCAAACAGGGGTCAG	NA	NA	NA	NA
WP_040968032.1|3183249_3183540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040968033.1|3184083_3184290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065367186.1|3184565_3186128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860174.1|3186912_3187539_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	1.9e-23
WP_011013963.1|3187888_3188248_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065367187.1|3188247_3188844_+	cadmium transporter	NA	NA	NA	NA	NA
WP_003859023.1|3189102_3190524_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.0	1.2e-44
WP_003859021.1|3190622_3191012_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_065367188.1|3191502_3192213_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.4	1.4e-78
WP_003862073.1|3192316_3192628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968043.1|3192624_3192867_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_065367189.1|3193103_3194405_-	APC family permease	NA	NA	NA	NA	NA
WP_065367190.1|3194470_3195952_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_003862069.1|3195948_3196215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299874.1|3196884_3197433_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	53.6	2.2e-39
WP_075348430.1|3197393_3197678_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_081299875.1|3197763_3198504_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015535.1|3198659_3198896_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015536.1|3199101_3199419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565379.1|3200062_3201940_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	6.0e-105
WP_003861174.1|3203147_3203522_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.7	4.5e-12
WP_060565381.1|3203707_3203914_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015541.1|3204086_3205433_+	MFS transporter	NA	NA	NA	NA	NA
WP_003861180.1|3205392_3205575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299876.1|3205585_3206188_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065367192.1|3206394_3207927_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.0	9.2e-88
WP_003855068.1|3208534_3208987_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060565383.1|3209043_3209721_-	single-stranded DNA-binding protein	NA	A0A1P8D5R5	Corynebacterium_phage	52.7	2.9e-49
WP_003855074.1|3209757_3210045_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003861194.1|3210404_3210596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015546.1|3210592_3212053_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_060565384.1|3212098_3214261_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_065367193.1|3214352_3214745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003855083.1|3214936_3215410_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081299877.1|3215437_3216382_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861203.1|3216413_3216911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038586445.1|3216978_3217302_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060565387.1|3217322_3218261_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_065367195.1|3218308_3219574_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003855103.1|3219570_3220263_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	1.0e-38
WP_060565535.1|3220266_3222105_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003855107.1|3222471_3223563_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.4	8.6e-72
WP_075348539.1|3223638_3224193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565390.1|3224258_3225746_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_006285365.1|3226114_3226528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006285366.1|3226704_3227610_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.5	3.4e-13
WP_081299886.1|3227923_3229129_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.7	2.1e-31
WP_060565391.1|3229637_3230135_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_075348438.1|3230280_3231096_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_060565393.1|3231332_3232484_+	RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	63.2	1.4e-136
WP_003855120.1|3232490_3232967_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.7	5.0e-16
WP_075348439.1|3232981_3233995_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_107111897.1|3234846_3236033_-|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
3236076:3236095	attR	GTCCACCAAACAGGGGTCAG	NA	NA	NA	NA
