The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	897	9094	5005730	tail,integrase	Escherichia_phage(44.44%)	13	NA	NA
WP_000741308.1|897_2025_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.2	5.0e-123
WP_000939946.1|2005_2251_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_065304424.1|2742_3138_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	92.1	2.2e-62
WP_001008243.1|3158_3602_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	94.6	4.6e-80
WP_047670916.1|3573_4176_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	7.0e-100
WP_065304047.1|4175_4694_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.6	1.8e-56
WP_000905000.1|4723_5278_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_000557907.1|5384_6218_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943926.1|6451_6616_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_065304048.1|6718_7042_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	66.4	2.7e-42
WP_032141808.1|7574_7685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|7737_8142_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|8362_9094_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 2
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	199533	261851	5005730	tail,tRNA,integrase,coat,lysis,transposase,terminase	Escherichia_phage(36.73%)	66	193917:193933	238724:238740
193917:193933	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|199533_200766_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|201020_202004_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|202278_202452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304059.1|202481_203855_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.2e-51
WP_001676520.1|203983_204919_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_071961376.1|204970_206206_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	4.6e-239
WP_000079604.1|206207_206423_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|206501_206711_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|206703_206898_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|206954_207764_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105142.1|207756_210348_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.0	1.3e-243
WP_000632297.1|210449_210725_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|210799_210970_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|210969_211191_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_065304427.1|211632_212121_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|212117_212273_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000362155.1|212672_213092_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|213192_213474_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|213457_213883_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|213954_215025_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|215065_215488_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|215828_217826_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625667.1|217889_219167_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|219297_220179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063122196.1|220175_220868_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|220879_222079_-	MFS transporter	NA	NA	NA	NA	NA
WP_000149055.1|222802_223141_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940319.1|223954_224554_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|224553_224844_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|224840_225383_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|226427_226856_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|227027_227402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|227653_227869_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_085949152.1|228152_229426_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001228688.1|229918_230104_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|230300_231758_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|231895_232687_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|232679_233612_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|233589_233799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|233802_234897_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|234877_236179_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|236181_237588_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|237571_238684_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|238788_239553_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
238724:238740	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_065304060.1|239651_240791_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	6.3e-158
WP_000634214.1|241013_241409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001722864.1|241408_241792_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	38.6	6.4e-14
WP_001029815.1|241792_242173_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|242169_242562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|242588_243551_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|243701_244061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027663451.1|244534_247768_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	6.7e-112
WP_000024051.1|247760_248099_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|248098_248797_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001396591.1|248802_249546_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_000090944.1|249482_250091_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	7.6e-102
WP_065304061.1|250151_253565_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_065304062.1|253634_254234_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	1.1e-108
WP_071961404.1|254298_257370_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	79.2	2.2e-64
WP_001351719.1|257369_257945_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|258042_258633_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|258949_259183_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|259251_259365_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_162788999.1|259704_259878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082294.1|260142_260577_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|260717_261851_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 3
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	455796	515672	5005730	tail,integrase,lysis,transposase,terminase	Enterobacteria_phage(30.61%)	71	482231:482244	517288:517301
WP_001339197.1|455796_457005_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001296721.1|457095_457407_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000722571.1|458870_459182_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|459380_460079_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|460123_461023_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001585723.1|461217_462405_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|462531_462627_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|462844_463735_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671744.1|463989_464382_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_063105031.1|464657_465176_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_065304083.1|465855_466527_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	4.9e-78
WP_065304084.1|466541_466949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304085.1|467017_468286_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	1.7e-228
WP_065304086.1|468288_468708_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_077625480.1|468880_469087_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	77.8	9.3e-20
WP_065304087.1|469174_469783_+|tail	tail fiber domain-containing protein	tail	G9JXH9	Shigella_phage	50.4	2.2e-24
WP_065304088.1|469760_471026_-|tail	phage tail protein	tail	A0A220NRP2	Escherichia_phage	73.7	3.8e-164
WP_065304089.1|471152_471515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304090.1|471479_472121_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	93.4	6.3e-115
WP_100166550.1|472117_472414_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	100.0	9.5e-50
WP_065304091.1|472413_475854_-|tail	phage tail protein	tail	K7P840	Enterobacteria_phage	89.2	0.0e+00
WP_065304092.1|475904_476504_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	63.3	1.4e-60
WP_065304093.1|476545_477223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304094.1|477271_478009_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	88.9	1.7e-132
WP_065304095.1|478010_478766_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	80.0	7.7e-120
WP_065304096.1|478762_479110_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	61.7	6.4e-37
WP_065304097.1|479164_479968_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	47.0	1.1e-52
WP_065304098.1|480043_482956_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	33.2	2.1e-117
482231:482244	attL	ATCGCGCAGCTGGC	NA	NA	NA	NA
WP_077625481.1|482952_483267_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.7	6.6e-17
WP_065304100.1|483263_483575_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.9	8.2e-36
WP_065304101.1|483640_484312_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.3	6.1e-52
WP_065304102.1|484378_484789_-	DUF4128 domain-containing protein	NA	I6PDJ8	Cronobacter_phage	54.3	9.8e-37
WP_065304103.1|484785_485370_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	6.1e-48
WP_065304104.1|485371_485722_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	50.9	9.9e-30
WP_065304105.1|485721_486204_-	hypothetical protein	NA	A0A088F7Y6	Salmonella_phage	35.5	2.7e-09
WP_162789005.1|486240_486540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304107.1|486521_487475_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.3	3.1e-134
WP_065304108.1|487487_488258_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	8.2e-69
WP_065304109.1|488338_489436_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.8	4.2e-119
WP_065304110.1|489437_490826_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.5	4.7e-123
WP_065304111.1|490827_492402_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	90.2	1.5e-295
WP_065304112.1|492398_492962_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	64.2	1.8e-57
WP_065304113.1|492990_493212_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_071961405.1|493259_493496_+	ATP-dependent RNA helicase HrpA	NA	NA	NA	NA	NA
WP_065304114.1|493508_493712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304115.1|493845_494331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304116.1|494356_494818_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	59.2	2.5e-41
WP_065304117.1|494814_495309_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	90.9	1.2e-84
WP_014884012.1|495286_495511_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	97.2	5.2e-32
WP_065304118.1|496227_497061_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	79.1	1.7e-123
WP_065304428.1|497057_497420_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	8.1e-51
WP_063149571.1|497422_497629_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	77.3	3.0e-26
WP_065304119.1|497628_498231_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	83.0	1.8e-95
WP_065304120.1|498619_498844_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.5	2.0e-23
WP_162789000.1|499387_500632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304122.1|500955_501717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304123.1|502162_503626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304124.1|503960_504797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304125.1|504859_505546_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	1.7e-81
WP_077625523.1|505542_506400_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.3	1.9e-98
WP_065304127.1|506544_507096_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.9	9.8e-32
WP_029882071.1|507098_507326_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.9	1.4e-21
WP_057059573.1|507398_507812_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	74.2	3.1e-46
WP_057059571.1|507937_508411_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	59.2	1.1e-50
WP_065304128.1|508407_509340_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	50.8	1.1e-78
WP_162788998.1|509544_509871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304131.1|510114_512859_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	62.5	1.2e-295
WP_065304132.1|512868_513954_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.1	2.4e-122
WP_065304133.1|513992_514235_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	92.3	3.9e-33
WP_065304134.1|514294_514552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304135.1|514532_515672_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	47.9	3.0e-91
517288:517301	attR	GCCAGCTGCGCGAT	NA	NA	NA	NA
>prophage 4
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	1087620	1097062	5005730		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|1087620_1088757_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|1088753_1090754_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|1090878_1091340_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1091380_1091851_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1091897_1092617_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1092613_1094299_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1094520_1095252_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1095311_1095419_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1095399_1096131_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001748561.1|1096135_1097062_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 5
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	1300458	1346225	5005730	tail,tRNA,integrase,head,portal,plate,capsid,holin,terminase	Enterobacteria_phage(86.36%)	56	1296620:1296643	1342783:1342806
1296620:1296643	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_001283581.1|1300458_1301271_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|1301270_1302284_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071961388.1|1302349_1303507_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.0e-22
WP_000023402.1|1303666_1304671_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|1304767_1305088_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|1305201_1305489_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200501.1|1305495_1305702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|1305954_1306296_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158971.1|1306306_1306594_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|1306605_1306848_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|1306844_1306958_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_065304191.1|1307044_1307248_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.5e-25
WP_000153674.1|1307244_1307490_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274219.1|1307486_1307786_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_001326016.1|1307797_1308415_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_062865235.1|1308411_1308777_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	1.1e-60
WP_065304192.1|1308783_1311606_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.2	0.0e+00
WP_001459827.1|1311682_1312642_+	plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000211250.1|1312646_1312958_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	8.5e-49
WP_001459828.1|1313021_1313456_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_000087812.1|1314036_1315083_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_065304193.1|1315082_1316834_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262673.1|1316988_1317825_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|1317847_1318900_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_065304194.1|1318945_1319746_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	9.9e-126
WP_000063103.1|1319847_1320342_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1320341_1320542_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1320544_1320868_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1320864_1321257_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780489.1|1321253_1321661_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.5e-64
WP_000920594.1|1321798_1322266_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_065304195.1|1322258_1322894_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.2e-113
WP_065304196.1|1322890_1323472_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.9e-102
WP_000213447.1|1323468_1323819_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111935.1|1323822_1324719_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071706.1|1324711_1325242_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
WP_065304197.1|1325244_1327404_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	6.0e-109
WP_000631344.1|1327400_1328303_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_001414827.1|1328311_1328890_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
WP_000954203.1|1328933_1329506_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979946.1|1329662_1330151_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_065304198.1|1330163_1332971_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.2	0.0e+00
WP_001391627.1|1332957_1333086_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_000665307.1|1333121_1333487_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290450.1|1333541_1334054_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_065304199.1|1334053_1335238_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	5.3e-224
WP_065304200.1|1335395_1336505_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	5.3e-194
WP_001383550.1|1336547_1336808_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1336998_1337139_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_032192010.1|1337554_1338382_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_001173924.1|1338897_1339230_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_071961389.1|1339234_1340128_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615813.1|1340385_1341381_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127757.1|1341377_1342556_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817183.1|1342839_1344060_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1342783:1342806	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683808.1|1344218_1346225_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	1740496	1747636	5005730		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1740496_1743058_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|1743163_1743820_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272549.1|1743870_1744668_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|1744833_1745742_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1745738_1747001_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1746997_1747636_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	3561732	3634488	5005730	tail,tRNA,integrase,portal,lysis,protease,terminase	Enterobacteria_phage(39.62%)	77	3554275:3554290	3578382:3578397
3554275:3554290	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_001218281.1|3561732_3562956_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
WP_001317460.1|3563216_3563549_-	protein flxA	NA	NA	NA	NA	NA
WP_071591280.1|3563751_3564027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023138545.1|3564261_3564798_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	4.1e-99
WP_000081297.1|3564925_3565750_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|3565815_3566178_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|3566880_3567573_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191669.1|3567670_3567931_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_023138546.1|3567923_3568475_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	1.3e-100
WP_058100827.1|3568471_3569620_+	peptidase	NA	K7PLX4	Enterobacteria_phage	87.7	5.9e-180
WP_000620697.1|3569616_3569841_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
WP_000061517.1|3569837_3570656_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_077625504.1|3570652_3571147_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	8.9e-85
WP_000066917.1|3571146_3571800_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210154.1|3571796_3572123_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767103.1|3572119_3572509_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061444.1|3572528_3573338_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_065304313.1|3573345_3574335_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.1e-194
WP_065304314.1|3574348_3575101_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.0e-136
WP_000217632.1|3575381_3575807_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000917724.1|3576030_3576234_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|3576384_3577437_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|3577504_3577720_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|3577719_3578217_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|3578213_3578681_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
3578382:3578397	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139675.1|3578668_3578821_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000349509.1|3579496_3579988_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_052978308.1|3579987_3582090_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_001072973.1|3582086_3582299_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_023147435.1|3582298_3583807_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.0e-289
WP_077625507.1|3583751_3585779_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.2	0.0e+00
WP_001097050.1|3585865_3586189_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|3586181_3586457_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|3586468_3587047_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|3587043_3587445_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211088.1|3587456_3588200_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001300035.1|3588260_3588647_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|3588655_3588985_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_065304316.1|3588956_3592031_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.4	0.0e+00
WP_000447247.1|3592030_3592360_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_071961398.1|3593072_3593816_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	1.9e-147
WP_032158484.1|3593713_3594361_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_065304317.1|3594421_3597919_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.4	0.0e+00
WP_001233071.1|3597989_3598589_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_065304318.1|3598653_3601728_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_023138561.1|3601727_3602309_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.5e-104
WP_000348577.1|3602451_3602649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217546.1|3603186_3603435_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000202564.1|3603654_3605241_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3605633_3606239_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3606365_3606527_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_000531527.1|3606648_3607722_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563068.1|3607718_3608501_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088400.1|3608613_3609477_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143257.1|3609448_3610999_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3611256_3612036_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477808.1|3612162_3613485_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_000816471.1|3613536_3614760_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3614839_3615559_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000105865.1|3616014_3617031_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3617058_3617703_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3617808_3618777_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3618825_3620208_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|3620228_3621461_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3621767_3623435_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409466.1|3623645_3625583_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|3625672_3625999_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001297279.1|3626083_3626605_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3626656_3627304_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|3627300_3628170_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3628380_3628854_+	protein CreA	NA	NA	NA	NA	NA
WP_001188656.1|3628866_3629556_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	5.2e-30
WP_001219604.1|3629555_3630980_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_000920306.1|3631037_3632390_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3632449_3633166_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3633261_3633402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223177.1|3633801_3634488_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	3832843	3895169	5005730	plate,transposase,tRNA,protease	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|3832843_3834196_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3834225_3836658_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3836779_3837265_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3837268_3838294_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3838398_3838854_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3838857_3839646_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000166359.1|3839645_3840794_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3840790_3841387_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|3841423_3844906_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3844918_3845878_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3845976_3848118_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3848174_3848564_+	VOC family protein	NA	NA	NA	NA	NA
WP_001676327.1|3848628_3849927_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3849975_3850236_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3850222_3850423_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3850588_3851134_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3851130_3851553_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|3851566_3852277_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|3852526_3853507_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|3854587_3856306_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|3856417_3857125_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3857121_3857526_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3857643_3858459_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3858498_3859152_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3859144_3860176_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3860363_3860939_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997049.1|3866825_3867629_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|3867625_3868540_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065304329.1|3868780_3869581_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_065304330.1|3869658_3870429_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3870476_3871835_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|3871906_3872662_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|3872695_3873418_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3873414_3873882_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|3873946_3874678_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|3875217_3876003_+	aminopeptidase	NA	NA	NA	NA	NA
WP_065304331.1|3876139_3876619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908058.1|3876628_3877543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|3877586_3878069_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087751.1|3878092_3879445_-	membrane protein	NA	NA	NA	NA	NA
WP_122985420.1|3879455_3882890_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|3882998_3884411_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|3884415_3885159_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|3885155_3887921_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343302.1|3887929_3888691_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|3888695_3890027_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3890029_3890554_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|3890550_3891831_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|3891855_3892938_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|3892901_3894752_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_065304332.1|3894755_3895169_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 9
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	4450096	4509310	5005730	tail,integrase,head,portal,lysis,capsid,transposase,terminase	Enterobacteria_phage(54.1%)	80	4469220:4469235	4483196:4483211
WP_000533645.1|4450096_4451167_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
WP_001303849.1|4451144_4451363_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|4451402_4451570_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120065.1|4451812_4452415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|4452625_4452847_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|4452945_4453227_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|4453237_4453429_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000149532.1|4453401_4453584_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000186784.1|4453580_4454261_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000100847.1|4454257_4455043_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995420.1|4455048_4455345_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_000233576.1|4455421_4455628_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_024225642.1|4456108_4456489_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_065304369.1|4456718_4457474_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067459.1|4457512_4457743_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_033873110.1|4457824_4458364_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	2.6e-61
WP_065304441.1|4458450_4459380_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	2.1e-111
WP_065304370.1|4459376_4460078_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	9.3e-128
WP_016243514.1|4460568_4461297_-	porin family protein	NA	NA	NA	NA	NA
WP_085949152.1|4461780_4463053_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001070453.1|4463078_4463411_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032159030.1|4463475_4463598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243515.1|4463655_4465182_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_001339197.1|4465287_4466496_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_016243516.1|4466631_4466955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301145.1|4467129_4467912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|4468006_4468108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243517.1|4468104_4468560_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.1e-60
WP_000224907.1|4468559_4468730_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_032176362.1|4468722_4469013_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
WP_001099712.1|4469009_4469372_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
4469220:4469235	attL	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_001393963.1|4469368_4469509_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001204780.1|4469594_4469978_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737280.1|4470167_4471265_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|4471837_4472053_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021534987.1|4472052_4472550_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_021537017.1|4472546_4473014_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.3	3.1e-71
WP_001139682.1|4473001_4473154_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_065304371.1|4473356_4473881_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.1	1.1e-85
WP_001537735.1|4474183_4474594_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001663509.1|4474652_4474886_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453576.1|4475274_4475820_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027268.1|4475794_4477720_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|4477716_4477923_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021553629.1|4477919_4478801_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.6	9.5e-162
WP_000963723.1|4478949_4480191_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_001029461.1|4480192_4480450_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000179580.1|4481417_4481723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|4481913_4482111_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|4482103_4482289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|4482288_4482480_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|4482480_4482702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425299.1|4482719_4483019_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761841.1|4483015_4484770_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
4483196:4483211	attR	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_000161636.1|4485119_4485371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304372.1|4485367_4485790_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228106.1|4486007_4487048_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000190773.1|4487057_4487399_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|4487410_4487794_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835282.1|4487995_4488538_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_000140265.1|4488549_4488831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123305.1|4490400_4491720_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001299443.1|4491729_4492062_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063263.1|4492117_4493143_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.2e-187
WP_077625514.1|4493184_4493580_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	2.2e-57
WP_065304374.1|4493591_4493945_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	8.4e-61
WP_065304375.1|4493956_4494535_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.3e-79
WP_000683105.1|4494531_4494927_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001358372.1|4494934_4495675_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000479142.1|4495690_4496113_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459457.1|4496094_4496529_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_065304376.1|4496521_4499101_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.6	0.0e+00
WP_000847349.1|4499097_4499427_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_065304377.1|4499426_4500134_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.3e-132
WP_044723263.1|4500130_4500874_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.0e-150
WP_000090892.1|4500810_4501443_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_065304378.1|4501503_4504983_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_065304379.1|4505050_4505650_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	2.0e-107
WP_071961411.1|4505714_4508738_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_065304382.1|4508737_4509310_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.0	2.2e-90
>prophage 10
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	4560722	4625708	5005730	tail,integrase,head,portal,plate,lysis,capsid,transposase,terminase	Salmonella_phage(75.56%)	75	4578560:4578574	4600161:4600175
WP_000399648.1|4560722_4561703_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|4561963_4563229_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_047670145.1|4563380_4564196_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209304.1|4564341_4566774_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|4566779_4567679_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|4567809_4568472_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_065304386.1|4568547_4569297_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|4569296_4570532_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|4570735_4571701_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|4571687_4573559_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|4573578_4575117_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|4575134_4576055_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|4576057_4576969_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001471275.1|4577146_4579495_+	EAL domain-containing protein	NA	NA	NA	NA	NA
4578560:4578574	attL	TACCGCAATCTGCGC	NA	NA	NA	NA
WP_000086904.1|4579502_4580831_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|4580877_4582203_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|4582415_4582799_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|4582909_4584025_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|4584021_4584648_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|4584894_4586097_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450124.1|4586143_4586902_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001307079.1|4586959_4587556_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180096.1|4587840_4589073_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|4589113_4589398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|4589483_4590299_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|4590298_4591507_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|4591590_4592127_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_053286320.1|4592231_4593284_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	1.8e-106
WP_000900883.1|4593472_4593664_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001346406.1|4593679_4594249_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_021563620.1|4594394_4594598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021563621.1|4594662_4595172_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|4595179_4595476_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|4595593_4595935_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|4596002_4596236_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_065304387.1|4596235_4596463_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	8.6e-35
WP_053286319.1|4596459_4597317_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.6e-158
WP_065304388.1|4597313_4599734_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|4599886_4600075_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4600085_4600319_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
4600161:4600175	attR	TACCGCAATCTGCGC	NA	NA	NA	NA
WP_024219117.1|4600408_4600966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024219116.1|4600968_4601550_-	ComF family protein	NA	NA	NA	NA	NA
WP_021823668.1|4601995_4602691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077625515.1|4602698_4603358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304389.1|4603354_4603879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304390.1|4603902_4604931_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.8	6.5e-170
WP_001098431.1|4604930_4606697_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_065304391.1|4606839_4607673_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.9	2.2e-123
WP_065304392.1|4607689_4608748_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_065304393.1|4608751_4609402_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_065304394.1|4609497_4609962_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.1e-76
WP_000868181.1|4609961_4610165_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	4.0e-31
WP_000171568.1|4610168_4610384_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_065304395.1|4610364_4610877_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000727866.1|4610878_4611256_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	3.9e-16
WP_001442125.1|4611252_4611681_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	3.8e-47
WP_001039946.1|4611776_4612208_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	3.8e-71
WP_065304396.1|4612200_4612647_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.3e-61
WP_000993775.1|4612715_4613294_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_065304397.1|4613290_4613650_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	7.2e-52
WP_000268301.1|4613636_4614545_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001086820.1|4614537_4615143_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_065304398.1|4615139_4616684_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.1	2.0e-199
WP_040062295.1|4616683_4617289_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.4	2.1e-96
WP_059221482.1|4617257_4617455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071961402.1|4617441_4617822_-	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	30.9	3.0e-08
WP_000905033.1|4617852_4618419_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046124.1|4618561_4619734_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|4619743_4620259_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281013.1|4620313_4620616_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4620630_4620750_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_065304399.1|4620742_4623820_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980397.1|4623816_4624302_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_001011786.1|4624298_4625399_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.1e-175
WP_000972391.1|4625489_4625708_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 11
NZ_CP015912	Escherichia coli strain 210205630 chromosome, complete genome	5005730	4831416	4881840	5005730	transposase,integrase	Acinetobacter_phage(11.11%)	36	4833822:4833840	4887656:4887674
WP_000878218.1|4831416_4832283_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4832279_4832579_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000627407.1|4832681_4833173_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611856.1|4833169_4834156_+	hypothetical protein	NA	NA	NA	NA	NA
4833822:4833840	attL	TTTTTCTGCGCTTCTCCAA	NA	NA	NA	NA
WP_000279862.1|4834703_4835912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	6.5e-44
WP_065304405.1|4836135_4837701_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001349431.1|4837716_4837965_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065304406.1|4838065_4839889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063082222.1|4841097_4841691_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000270989.1|4842062_4842446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013334.1|4842442_4842868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025853.1|4843640_4845698_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	2.9e-36
WP_065304407.1|4845690_4846977_+	McrC family protein	NA	NA	NA	NA	NA
WP_077625517.1|4847368_4848337_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.3e-180
WP_065304408.1|4848338_4849733_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	1.3e-19
WP_020219275.1|4850318_4852739_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_020219276.1|4852747_4854766_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_071961403.1|4854758_4856084_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_020219278.1|4856085_4856499_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_063108289.1|4856549_4857422_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	3.3e-90
WP_001313178.1|4857428_4858460_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.5e-166
WP_000053329.1|4858840_4859851_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_000433621.1|4859944_4862071_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001099190.1|4862125_4863403_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813683.1|4863399_4864830_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_000523728.1|4864893_4865409_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001313182.1|4865414_4865618_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313183.1|4865679_4865991_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000108760.1|4866020_4866947_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000716410.1|4867046_4868543_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000545263.1|4873545_4875099_-	L-lactate permease	NA	NA	NA	NA	NA
WP_000683099.1|4875529_4877227_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001102105.1|4877301_4878021_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_050019109.1|4878031_4879459_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_065304411.1|4879451_4880147_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_065304412.1|4880859_4881840_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
4887656:4887674	attR	TTTTTCTGCGCTTCTCCAA	NA	NA	NA	NA
>prophage 1
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	0	7639	129035	transposase	Escherichia_phage(25.0%)	5	NA	NA
WP_000084745.1|446_839_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067848.1|1173_1878_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_050576375.1|1868_4901_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.2	0.0e+00
WP_113706755.1|6048_7276_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.7e-175
WP_000222766.1|7351_7639_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
>prophage 2
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	12091	12835	129035		Xanthomonas_phage(100.0%)	1	NA	NA
WP_065304457.1|12091_12835_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.0	1.6e-08
>prophage 3
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	35496	35718	129035		Vibrio_virus(100.0%)	1	NA	NA
WP_001278692.1|35496_35718_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
>prophage 4
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	43662	98770	129035	transposase,integrase	Escherichia_phage(36.0%)	52	55433:55449	88117:88133
WP_001234469.1|43662_44484_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_065304459.1|44605_44890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008826.1|44893_47860_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.3	7.3e-182
WP_077625527.1|48985_49252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|49605_49764_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299721.1|49843_50032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276232.1|50043_50763_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845901.1|50759_51194_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_065304460.1|51248_53207_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	6.2e-20
WP_065304461.1|53271_53505_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	7.3e-05
WP_065304462.1|53562_54102_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.8	3.1e-46
WP_032143370.1|54335_54524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315564.1|54953_55517_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
55433:55449	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_038999961.1|55564_56926_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|56977_57208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|58241_58433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647586.1|58429_58852_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|58898_59201_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274502.1|60557_60992_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104892.1|61005_61227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001599378.1|61227_61911_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	8.7e-30
WP_065304464.1|61987_62299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077625528.1|62295_63267_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|63615_63864_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|63860_64298_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457523.1|64297_65569_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000340829.1|65573_65966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|65970_66942_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|67163_67808_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|67801_68077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304466.1|68150_69005_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.3e-51
WP_065304471.1|69001_69433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304467.1|69498_70203_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.7e-137
WP_021512928.1|70351_71677_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_000639434.1|72584_72866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087548947.1|74789_76003_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
WP_000642771.1|76655_76940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|76959_78093_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001261287.1|81779_82010_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|82006_82423_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001339197.1|83663_84872_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000246636.1|86525_87521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|87524_88457_+	hypothetical protein	NA	NA	NA	NA	NA
88117:88133	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
WP_039002890.1|89504_92621_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_023142242.1|92742_94014_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001617892.1|94010_95567_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|95749_95971_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|95970_96351_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|96355_96535_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|96562_96922_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|97208_97526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253135.1|97753_98770_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.7e-186
>prophage 5
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	104643	120215	129035	transposase,integrase	Salmonella_phage(28.57%)	10	102676:102689	115925:115938
102676:102689	attL	AACTTTGCTGAATG	NA	NA	NA	NA
WP_000361612.1|104643_105621_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066942.1|105905_106646_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_039000283.1|106766_106892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304469.1|108406_112483_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	43.2	1.6e-264
WP_000904945.1|113808_114432_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	3.4e-41
WP_000008826.1|114412_117379_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.3	7.3e-182
115925:115938	attR	AACTTTGCTGAATG	NA	NA	NA	NA
WP_053273077.1|117430_118462_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000616063.1|118424_118979_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.7	3.5e-21
WP_033544604.1|118991_119474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065304470.1|119642_120215_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.8	1.6e-98
>prophage 6
NZ_CP015914	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence	129035	125523	128098	129035	transposase	Enterobacteria_phage(66.67%)	3	NA	NA
WP_001067848.1|125523_126228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|126497_127055_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|127237_128098_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 1
NZ_CP015915	Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy3, complete sequence	114472	787	114242	114472	integrase,terminase,transposase,capsid,tRNA,tail,portal	Salmonella_phage(92.86%)	114	45402:45421	55592:55611
WP_001291061.1|787_1066_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_065304473.1|1068_2628_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	9.2e-277
WP_024170896.1|2692_3391_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_000161986.1|3390_4059_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_065304474.1|4055_4721_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	1.8e-109
WP_000129633.1|4717_5608_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_000176292.1|5617_5884_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|6079_6712_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_065304475.1|6711_7968_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.7	4.8e-244
WP_001717193.1|7994_9569_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001055286.1|9590_10478_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
WP_065304476.1|10503_11379_+|capsid	phage capsid protein	capsid	J9Q710	Salmonella_phage	95.2	2.6e-156
WP_032217426.1|11452_12373_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.6	6.3e-132
WP_065304477.1|12417_12852_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	2.5e-59
WP_065304478.1|12851_13685_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	1.1e-140
WP_001027663.1|13764_14109_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|14099_14573_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_000469440.1|14574_14958_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_052895960.1|15032_15779_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	1.4e-105
WP_052895958.1|15840_16158_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	94.3	7.3e-48
WP_000952686.1|16283_16508_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_065304479.1|16515_21072_+	tape measure protein	NA	J9Q712	Salmonella_phage	79.9	0.0e+00
WP_000442113.1|21114_21450_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_000511446.1|21532_22231_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.1e-134
WP_001405045.1|22223_23021_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_031323046.1|23008_23602_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.9	8.2e-101
WP_065304480.1|23619_28344_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.7	0.0e+00
WP_162789008.1|28979_29273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304499.1|30519_32736_+	chaperone of endosialidase	NA	J9Q6E3	Salmonella_phage	49.5	1.9e-70
WP_000120169.1|32796_33051_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
WP_053886732.1|33050_33659_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	3.4e-78
WP_000064175.1|33981_34305_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_000856757.1|34318_35011_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_000901561.1|35012_35264_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_053886731.1|35636_36056_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	61.3	2.8e-39
WP_053886730.1|36040_36814_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.5	2.3e-31
WP_000161228.1|36963_37632_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160378290.1|37637_37991_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000342417.1|38043_38811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717320.1|39091_39832_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_001718049.1|39875_41216_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.3	9.8e-235
WP_065304500.1|41363_42479_+	DNA primase	NA	J9Q720	Salmonella_phage	93.5	2.9e-208
WP_021520122.1|42554_43337_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
WP_106361768.1|43392_43875_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	70.6	1.1e-50
WP_065304482.1|43871_45194_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	7.6e-240
WP_000636536.1|45190_45406_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
45402:45421	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_000067985.1|45551_45842_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_065304483.1|47355_48252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304484.1|48427_48673_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	42.3	1.7e-12
WP_061092972.1|48857_49412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000797845.1|49679_50783_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282577.1|50777_51164_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098352.1|51414_51627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304485.1|51725_53834_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.3	1.8e-227
WP_000213833.1|53929_55165_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
WP_065304486.1|55345_58864_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.3	0.0e+00
55592:55611	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_000627054.1|58989_59421_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_000047684.1|59538_60567_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_021512304.1|60627_61572_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	91.4	3.6e-167
WP_000920224.1|61571_61838_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_162700922.1|61885_62914_+	recombinase	NA	J9Q736	Salmonella_phage	95.0	4.0e-188
WP_001711109.1|63004_63205_+	membrane protein	NA	J9Q6J0	Salmonella_phage	54.5	1.8e-07
WP_065304487.1|63632_66062_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	7.9e-25
WP_065304488.1|66061_67384_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032328845.1|67393_68557_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_065304489.1|68571_71589_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_065304502.1|72482_73991_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	2.3e-43
WP_023135696.1|74739_75015_+	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_023135695.1|75054_75234_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_032252468.1|75230_75566_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.7	1.6e-48
WP_001229345.1|75565_75778_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001348683.1|76357_77572_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_000948429.1|77972_79172_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|79181_79370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304503.1|79461_80106_+	hypothetical protein	NA	J9Q739	Salmonella_phage	85.8	8.0e-102
WP_000174804.1|80360_81446_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_065304490.1|81675_83592_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.8	1.5e-252
WP_032328878.1|83581_84325_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	6.7e-52
WP_000037962.1|84334_84904_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_065304491.1|84977_87293_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.0	0.0e+00
WP_000122502.1|87398_88541_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011859.1|88618_89488_+	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_023908289.1|89659_90763_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	1.4e-191
WP_065304492.1|90764_91178_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	1.0e-62
WP_160384356.1|91180_91651_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.7	3.7e-80
WP_000386469.1|91650_92295_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_001718079.1|92356_92776_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_016607532.1|92785_93343_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_000099880.1|93501_94311_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_000559570.1|94494_95088_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_000121543.1|95273_95504_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_001404443.1|96086_96677_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_021512350.1|96825_97320_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001103988.1|97329_97518_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_000900261.1|97611_98037_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_000893470.1|98036_98195_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_022644972.1|98334_98901_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
WP_065304493.1|99042_100728_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.8	0.0e+00
WP_032252453.1|100789_101494_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
WP_032252452.1|101493_101874_+	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	8.5e-27
WP_000004356.1|102172_103273_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001755492.1|103430_105464_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_032252493.1|105623_105866_+	DUF1380 family protein	NA	J9Q7H8	Salmonella_phage	78.4	2.0e-29
WP_032252448.1|106160_106559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304494.1|108120_108450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|108603_108915_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_065304495.1|109042_109438_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_050575777.1|109519_109930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304496.1|110280_110763_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	1.4e-61
WP_065304497.1|111369_111600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255469.1|111620_111824_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_065304498.1|111872_112523_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.7e-99
WP_021547912.1|112820_113339_-	hypothetical protein	NA	J9Q6L0	Salmonella_phage	68.2	7.2e-53
WP_023145146.1|113441_114242_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.5	2.1e-06
