The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	2135582	2172939	6430493	coat,tRNA,integrase,transposase	Pseudomonas_phage(50.0%)	39	2162550:2162609	2175752:2175833
WP_003099340.1|2135582_2136131_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003146046.1|2136161_2136695_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099337.1|2136694_2137237_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099335.1|2137255_2138044_+	molecular chaperone	NA	NA	NA	NA	NA
WP_065285037.1|2138060_2140433_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|2140429_2141377_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|2141378_2142752_-	MFS transporter	NA	NA	NA	NA	NA
WP_003099324.1|2143031_2144054_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003099322.1|2144050_2144968_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003099318.1|2145381_2146365_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099314.1|2146517_2147474_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094990.1|2147483_2148383_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003099311.1|2148379_2149825_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	6.3e-46
WP_003099307.1|2149950_2150472_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|2150605_2151403_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|2151392_2152151_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099293.1|2152144_2152975_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|2152976_2154059_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|2154076_2155345_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004352693.1|2155488_2157261_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|2157265_2157883_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|2157884_2158733_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|2158899_2159841_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|2159957_2160572_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|2160613_2161198_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|2161238_2162339_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
2162550:2162609	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_070341487.1|2162734_2163145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352688.1|2163125_2164127_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_004352686.1|2164123_2165416_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_031632030.1|2165674_2166937_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.7	7.8e-117
WP_003159569.1|2166938_2167289_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_034060742.1|2167298_2167907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003163345.1|2168562_2168781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|2168794_2169046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285038.1|2169166_2169601_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	94.4	8.2e-58
WP_031631432.1|2170139_2170430_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	2.1e-54
WP_034017420.1|2170433_2170616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004352675.1|2170605_2170878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032728035.1|2171922_2172939_+|transposase	IS30-like element IS1394 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
2175752:2175833	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	2323420	2330924	6430493	coat,integrase	Pseudomonas_phage(100.0%)	9	2320004:2320030	2330952:2330978
2320004:2320030	attL	TGGCGGAAGGCAGTGGGAGTCGAACCC	NA	NA	NA	NA
WP_172832411.1|2323420_2323708_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.7	1.5e-52
WP_033984119.1|2324223_2324658_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.2	3.9e-60
WP_003115979.1|2324779_2325031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125072.1|2325043_2325292_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_074412813.1|2325439_2326714_+	attachment protein	NA	Q56VP1	Pseudomonas_phage	54.6	1.1e-46
WP_065285043.1|2326718_2327075_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	99.2	2.0e-57
WP_065285044.1|2327078_2328353_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	86.3	3.5e-197
WP_065285045.1|2328591_2329884_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	3.7e-247
WP_031687313.1|2329883_2330924_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	56.1	5.3e-103
2330952:2330978	attR	TGGCGGAAGGCAGTGGGAGTCGAACCC	NA	NA	NA	NA
>prophage 3
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	3857091	3909726	6430493	plate,tRNA,tail	Pseudomonas_phage(24.0%)	55	NA	NA
WP_009875776.1|3857091_3858117_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|3858195_3858765_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|3858848_3859202_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|3859192_3859735_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003113214.1|3859707_3860940_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	3.5e-77
WP_023088786.1|3860983_3861490_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|3861583_3863137_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|3863133_3864405_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|3864505_3866428_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|3866706_3867039_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003099572.1|3867082_3867934_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|3867933_3868314_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|3868350_3869157_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|3869272_3870259_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|3870255_3871548_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003099560.1|3871528_3874300_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|3874426_3875443_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|3875439_3876114_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|3876115_3876874_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|3876874_3877936_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003099544.1|3878087_3880481_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|3880526_3881159_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|3881287_3882322_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|3882555_3883665_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|3883720_3884767_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|3884881_3886129_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|3886234_3887065_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|3887188_3887863_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|3887862_3888681_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_016852412.1|3888753_3890232_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|3890418_3890733_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|3890832_3891603_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|3892060_3892261_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003459419.1|3892308_3892668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|3893030_3893480_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|3893501_3894017_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|3894013_3894571_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|3894723_3895050_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|3895046_3895934_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|3895926_3896460_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003101626.1|3896461_3898570_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	2.5e-224
WP_003085172.1|3898578_3899019_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003109051.1|3899061_3900222_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|3900234_3900738_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|3900752_3901097_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003101633.1|3901266_3903504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|3903513_3904386_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|3904360_3904567_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003101637.1|3904624_3905614_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003085188.1|3905646_3906276_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003101639.1|3906272_3906635_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|3906631_3906889_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|3907236_3907842_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|3907843_3908893_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|3908889_3909726_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 4
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	4410125	4456812	6430493	head,portal,holin,tRNA,protease,capsid,terminase,integrase	Pseudomonas_phage(75.0%)	53	4413845:4413861	4460688:4460704
WP_003092872.1|4410125_4412978_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.0e-148
WP_003100590.1|4413098_4413467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100593.1|4413478_4413907_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
4413845:4413861	attL	GGCGACCTGCAGGCGCG	NA	NA	NA	NA
WP_003092867.1|4413903_4415391_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
WP_003100594.1|4415727_4416540_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003100597.1|4416623_4417547_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003092864.1|4417738_4418857_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003100598.1|4418849_4419920_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003100603.1|4420051_4420549_-	RDD family protein	NA	NA	NA	NA	NA
WP_020750472.1|4420678_4422259_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_065285118.1|4422757_4423756_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	97.2	1.8e-153
WP_065285058.1|4423869_4424775_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.4	8.0e-39
WP_154049455.1|4424752_4425400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285060.1|4425473_4425773_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	92.0	5.8e-47
WP_074412815.1|4426656_4426905_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	90.2	6.5e-36
WP_065285119.1|4426987_4427506_-	DUF550 domain-containing protein	NA	A0A1B0YZX5	Pseudomonas_phage	95.1	2.4e-88
WP_065285062.1|4427897_4428434_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	94.4	1.1e-93
WP_065285063.1|4428430_4429417_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	60.9	2.5e-118
WP_041025219.1|4429885_4430173_-	hypothetical protein	NA	A0A1B0YZY4	Pseudomonas_phage	89.9	2.5e-31
WP_065285064.1|4430172_4430847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285065.1|4431060_4431309_-	hypothetical protein	NA	A0A1B0YZY1	Pseudomonas_phage	91.5	1.5e-35
WP_065285066.1|4431319_4431706_-	helix-turn-helix transcriptional regulator	NA	A0A0U4IIG4	Pseudomonas_phage	93.8	3.0e-59
WP_065285067.1|4432040_4432907_-	ParB N-terminal domain-containing protein	NA	A0A0U4JP11	Pseudomonas_phage	94.1	5.9e-148
WP_153575846.1|4432983_4433625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074412816.1|4433770_4434541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285068.1|4435366_4435618_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	73.0	4.0e-25
WP_031631479.1|4435723_4436095_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065285069.1|4436101_4436647_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065285070.1|4436992_4437748_-	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	74.2	2.0e-75
WP_003159463.1|4438258_4438972_+	phage antirepressor KilAC domain-containing protein	NA	A0A1B0YZY9	Pseudomonas_phage	67.2	1.5e-77
WP_074412817.1|4439036_4439798_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	96.4	2.9e-90
WP_033994905.1|4439794_4440478_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	98.7	4.6e-124
WP_065285071.1|4440474_4440681_+	ninG protein	NA	A0A1B0YZY8	Pseudomonas_phage	91.2	2.6e-30
WP_021205616.1|4440677_4441259_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	95.3	6.6e-103
WP_023114600.1|4441255_4441552_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	83.7	1.2e-41
WP_023980124.1|4441553_4441928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285072.1|4442038_4442299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003119044.1|4442471_4442807_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_065285073.1|4442803_4443421_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	92.2	6.7e-106
WP_172832408.1|4443438_4443870_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.6e-53
WP_065285075.1|4443966_4444704_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.2	1.3e-42
WP_031627904.1|4444915_4445461_+|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	63.7	1.8e-57
WP_065285076.1|4445432_4447361_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	63.8	5.1e-253
WP_015648941.1|4447376_4447601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033992538.1|4447600_4449076_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.3	1.2e-198
WP_065285077.1|4449072_4450269_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	59.6	1.9e-117
WP_015648940.1|4450268_4450628_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	2.6e-17
WP_014602838.1|4450694_4451690_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
WP_023111702.1|4451689_4452001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015648938.1|4451997_4452435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726472.1|4452485_4452689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726471.1|4452716_4453469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285078.1|4453551_4456812_+	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	46.6	4.7e-49
4460688:4460704	attR	GGCGACCTGCAGGCGCG	NA	NA	NA	NA
>prophage 5
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	4692452	4701481	6430493		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|4692452_4693088_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|4693133_4694027_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|4694131_4695136_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|4695562_4695886_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|4695952_4698520_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|4698645_4699653_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|4699800_4700307_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|4700440_4701481_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 6
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	5776160	5836529	6430493	tail,holin,tRNA,terminase,integrase	Pseudomonas_phage(56.9%)	77	5783216:5783274	5836761:5836819
WP_003097631.1|5776160_5777441_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003162145.1|5777442_5778840_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|5778844_5779819_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|5779906_5780890_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|5780886_5781222_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|5781218_5781524_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|5781523_5781883_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|5781879_5782275_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|5782385_5783054_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
5783216:5783274	attL	CTTGAAAACCGTCGAAGGGGAGACTCTTCCGTGAGTTCGAATCTCACCGCCTCCGCCAT	NA	NA	NA	NA
WP_033945884.1|5783389_5784457_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.5	2.4e-135
WP_003116724.1|5784458_5784695_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_079851808.1|5786114_5786330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285092.1|5787088_5787295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285093.1|5787291_5787660_-	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	52.8	2.2e-32
WP_065285094.1|5787656_5788040_-	DUF1937 family protein	NA	A0A2K9VK38	Klebsiella_phage	40.8	1.4e-13
WP_065285095.1|5788890_5790801_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	87.9	2.6e-249
WP_065285096.1|5790817_5791543_-	hypothetical protein	NA	A0A2H5BFW5	Vibrio_phage	46.8	5.0e-52
WP_065285121.1|5791539_5791785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285097.1|5791823_5792285_-	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	57.5	1.4e-47
WP_065285098.1|5792281_5792509_-	hypothetical protein	NA	A0A2H4J1H1	uncultured_Caudovirales_phage	66.7	4.2e-05
WP_065285099.1|5792557_5794300_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	92.7	2.2e-287
WP_058161301.1|5794303_5795068_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.4	2.1e-104
WP_003116739.1|5795080_5795281_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_065285100.1|5795287_5796178_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	72.9	1.2e-103
WP_034071400.1|5796190_5797099_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	71.8	4.4e-122
WP_031629737.1|5797073_5797571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034075289.1|5797580_5797790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010793151.1|5797786_5798008_-	hypothetical protein	NA	A0A127KNM7	Pseudomonas_phage	95.7	2.8e-30
WP_010793150.1|5797991_5798144_-	hypothetical protein	NA	A0A127KNF7	Pseudomonas_phage	98.0	3.4e-11
WP_023088285.1|5798661_5799033_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	97.6	3.6e-62
WP_003159008.1|5799604_5799811_-	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	100.0	1.5e-33
WP_126545536.1|5801066_5801309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023105192.1|5801744_5802620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023105193.1|5802616_5803498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079280238.1|5803475_5804030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003103358.1|5804139_5804343_+	Cro/Cl family transcriptional regulator	NA	A0A0U1UNM4	Pseudomonas_phage	61.7	6.4e-13
WP_023105194.1|5804582_5805074_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	95.1	1.3e-83
WP_058149602.1|5805177_5805750_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	99.5	1.2e-101
WP_031754265.1|5805752_5806766_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	39.2	2.2e-13
WP_031754266.1|5806893_5807286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088291.1|5807278_5807728_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	99.3	1.9e-78
WP_023088292.1|5807756_5808626_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	96.9	2.2e-163
WP_023088293.1|5808796_5809177_+	hypothetical protein	NA	Q9MC43	Pseudomonas_phage	69.2	1.1e-37
WP_023088294.1|5809151_5809502_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	63.4	5.1e-26
WP_031754268.1|5809518_5809728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023088295.1|5809827_5810427_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	59.2	7.6e-46
WP_023088296.1|5810410_5811706_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.8	1.4e-145
WP_023088297.1|5811708_5813064_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	1.6e-96
WP_023088298.1|5813060_5814140_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.3	3.5e-198
WP_031754269.1|5814122_5814638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023088299.1|5814790_5815534_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.0	8.4e-87
WP_010793134.1|5815543_5816515_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	5.4e-110
WP_023088300.1|5816556_5817042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088301.1|5817025_5817490_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	5.2e-10
WP_023088302.1|5817489_5817879_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.1e-33
WP_023088303.1|5817882_5818557_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	2.3e-115
WP_012075336.1|5818553_5818964_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	1.9e-24
WP_003451664.1|5819031_5819685_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.3	1.3e-59
WP_003103406.1|5819694_5820075_+|tail	phage tail assembly chaperone	tail	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
WP_003451660.1|5820137_5820401_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	47.1	9.4e-17
WP_023088304.1|5820397_5823622_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.8	3.1e-117
WP_065285101.1|5823627_5823966_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	97.3	1.3e-58
WP_003158546.1|5823962_5824712_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	4.7e-146
WP_065285102.1|5824714_5825473_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	97.6	1.5e-147
WP_065285103.1|5825994_5826579_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	97.4	1.2e-101
WP_153549358.1|5826616_5826775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023910124.1|5827161_5827779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023088310.1|5827920_5831481_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	75.9	0.0e+00
WP_071557737.1|5831477_5831762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031754274.1|5832651_5833419_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	51.8	4.7e-56
WP_023088313.1|5833538_5834270_-	hypothetical protein	NA	Q9MC91	Pseudomonas_phage	99.5	2.2e-116
WP_016046696.1|5834300_5834783_+	glycoside hydrolase family 104 protein	NA	H2BD99	Pseudomonas_phage	100.0	5.5e-87
WP_023088314.1|5834779_5835148_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	74.6	1.3e-40
WP_023088315.1|5835144_5835408_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	93.1	1.7e-37
WP_021264640.1|5835443_5835710_+	hypothetical protein	NA	A0A0U1W088	Pseudomonas_phage	98.9	1.1e-44
WP_065285104.1|5835691_5835979_-	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	72.5	1.3e-08
WP_065285105.1|5836016_5836529_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	92.9	5.4e-93
5836761:5836819	attR	CTTGAAAACCGTCGAAGGGGAGACTCTTCCGTGAGTTCGAATCTCACCGCCTCCGCCAT	NA	NA	NA	NA
>prophage 7
NZ_CP016214	Pseudomonas aeruginosa strain PA121617 chromosome, complete genome	6430493	6079402	6180428	6430493	tail,protease,transposase	Tupanvirus(26.67%)	54	NA	NA
WP_003106751.1|6079402_6081403_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_034029566.1|6081414_6082440_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003159017.1|6082436_6083477_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_003102962.1|6083630_6084065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003102964.1|6084093_6086079_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	27.8	6.2e-36
WP_169057987.1|6086165_6086621_+	DUF4946 domain-containing protein	NA	NA	NA	NA	NA
WP_003102968.1|6086739_6087009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089677.1|6087123_6088038_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003102970.1|6088438_6090613_+	FUSC family protein	NA	NA	NA	NA	NA
WP_003102972.1|6090602_6090812_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_003102974.1|6090808_6091813_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003089668.1|6091849_6092095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089666.1|6092356_6093271_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_003102977.1|6093357_6093825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113068.1|6093841_6094405_-	RNA polymerase factor sigma-70	NA	NA	NA	NA	NA
WP_065285108.1|6095048_6095813_+	pyoverdine biosynthesis thioesterase PvdG	NA	NA	NA	NA	NA
WP_031756289.1|6095885_6108914_+	pyoverdine non-ribosomal peptide synthase/polyketide synthase PvdL	NA	A0A2K9KZV5	Tupanvirus	26.5	3.6e-140
WP_004355475.1|6109398_6109911_-	hypothetical protein	NA	G8I4Q8	Mycobacterium_phage	32.6	4.5e-07
WP_086937300.1|6111155_6112318_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
WP_004343806.1|6112777_6113341_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_003116909.1|6113344_6114373_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	40.5	2.5e-52
WP_003116910.1|6114383_6115367_-	type I-F CRISPR-associated protein Csy2	NA	A0A2I7RCX5	Vibrio_phage	26.7	1.7e-05
WP_033994843.1|6115353_6116655_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_033995192.1|6117065_6120296_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	2.8e-86
WP_023103134.1|6120292_6121267_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	37.8	2.2e-50
WP_003113065.1|6122844_6123159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349914.1|6123749_6124670_-	transporter	NA	NA	NA	NA	NA
WP_031756291.1|6124702_6126121_-	OprD family porin	NA	NA	NA	NA	NA
WP_003111283.1|6126202_6126883_-	hydrolase	NA	NA	NA	NA	NA
WP_003089646.1|6126980_6127841_-	pirin family protein	NA	NA	NA	NA	NA
WP_003105956.1|6127941_6128880_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003105954.1|6128883_6130527_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_003105952.1|6130885_6131311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003105949.1|6131303_6132623_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003089638.1|6132801_6134211_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.8	9.9e-20
WP_003089636.1|6134288_6134507_+	MbtH family protein	NA	NA	NA	NA	NA
WP_003105945.1|6134507_6135272_+	thioesterase	NA	NA	NA	NA	NA
WP_003159021.1|6135371_6136289_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106903.1|6136285_6137191_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003106905.1|6137187_6137943_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	7.7e-11
WP_003106907.1|6137939_6138893_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106909.1|6138925_6139486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089624.1|6139482_6139812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106910.1|6139808_6140348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106912.1|6140344_6141556_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_065285109.1|6141875_6157325_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	6.9e-98
WP_074412828.1|6157424_6163898_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.3	6.9e-84
WP_065285110.1|6163909_6171256_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	2.6e-156
WP_003139291.1|6171419_6173867_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003103601.1|6173969_6175619_-	pyoverdine export ABC transporter PvdE	NA	F2Y165	Organic_Lake_phycodnavirus	24.9	1.4e-09
WP_003103603.1|6175996_6176824_+	pyoverdine synthetase F	NA	NA	NA	NA	NA
WP_003103606.1|6176892_6177747_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	41.0	1.5e-39
WP_003103608.1|6177775_6179059_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003103610.1|6179081_6180428_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
>prophage 1
NZ_CP016215	Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence	423017	50723	69635	423017	transposase,integrase	Salmonella_phage(28.57%)	16	46812:46825	65272:65285
46812:46825	attL	TACTGAAGAAAACT	NA	NA	NA	NA
WP_003090772.1|50723_53690_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.8	0.0e+00
WP_003090771.1|53693_54254_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
WP_000845048.1|54628_55642_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159191.1|55802_56357_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_063860608.1|56434_57172_+	subclass B1 metallo-beta-lactamase IMP-45	NA	NA	NA	NA	NA
WP_074412830.1|57324_57609_+	Pathogenicity locus	NA	NA	NA	NA	NA
WP_001334766.1|57689_58520_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|58657_59290_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|59446_59794_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|59787_60627_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|61031_62573_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032728035.1|62711_63728_-|transposase	IS30-like element IS1394 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
WP_032495607.1|63938_64595_+	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
WP_069455558.1|64765_65056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050481.1|65775_67317_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
65272:65285	attR	TACTGAAGAAAACT	NA	NA	NA	NA
WP_032728035.1|68618_69635_-|transposase	IS30-like element IS1394 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
>prophage 2
NZ_CP016215	Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence	423017	77097	132645	423017	transposase,integrase	Escherichia_phage(33.33%)	47	102100:102113	135303:135316
WP_001067858.1|77097_77802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|78055_78871_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|78983_79688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|79816_80581_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_065285140.1|81162_82089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065758073.1|82099_82354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125862910.1|82319_82739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285143.1|83649_84021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285144.1|84139_84652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285145.1|84767_85631_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	34.6	4.2e-21
WP_172832414.1|86483_86792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199473.1|87083_88466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019437242.1|88607_89084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090764.1|91709_92069_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090760.1|92068_92920_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090759.1|92934_94422_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_001389365.1|94978_95743_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|96249_96750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000946487.1|96877_97729_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_065285146.1|99727_101098_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_003152690.1|101224_101782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285147.1|101961_103125_+	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
102100:102113	attL	GAGCCCTTCACCGT	NA	NA	NA	NA
WP_034065037.1|103140_106275_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003152694.1|106279_107713_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_065285148.1|108142_109102_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	46.1	2.1e-69
WP_170831721.1|109406_109808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263678.1|109832_112769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034000467.1|113307_115896_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_021263294.1|115974_116820_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021018614.1|116845_117142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263295.1|117174_117678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070091420.1|117912_118416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052150492.1|118703_119759_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010794474.1|119857_120241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199484.1|120436_120862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034000470.1|120863_121160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111089.1|121166_122747_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_065285149.1|122887_124156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034000476.1|124715_125510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034000477.1|125567_126272_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_034000478.1|126416_127199_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.3	3.4e-22
WP_034000480.1|127281_127884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034000482.1|128183_129131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057382825.1|129286_130567_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_010794461.1|130692_131049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108184494.1|131282_131552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058199779.1|131520_132645_+|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	41.3	9.9e-47
135303:135316	attR	GAGCCCTTCACCGT	NA	NA	NA	NA
>prophage 3
NZ_CP016215	Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence	423017	173225	180679	423017	protease	Acinetobacter_phage(33.33%)	9	NA	NA
WP_010792502.1|173225_173804_-	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
WP_010792503.1|173832_174867_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
WP_010792504.1|174878_175328_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
WP_020191935.1|175375_176566_-	TerD family protein	NA	NA	NA	NA	NA
WP_010794508.1|176562_177156_-	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	1.8e-23
WP_020191934.1|177158_177887_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_020191933.1|177886_178834_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_020191932.1|178833_179928_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.4	2.8e-38
WP_020191931.1|179920_180679_-	Trehalose-6-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	26.8	2.5e-09
