The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	198513	260838	5233459	transposase,protease,plate,tRNA	Emiliania_huxleyi_virus(12.5%)	50	NA	NA
WP_001295561.1|198513_199866_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|199895_202328_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202449_202935_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|202938_203964_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204068_204524_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204527_205316_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|205315_206464_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206460_207057_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_033817192.1|207093_210576_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	7.4e-210
WP_000055741.1|210588_211548_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_065225507.1|211646_213788_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213844_214234_+	VOC family protein	NA	NA	NA	NA	NA
WP_001676327.1|214298_215597_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|215645_215906_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|215892_216093_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|216258_216804_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216800_217223_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217236_217947_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|218196_219177_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|220257_221976_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222087_222795_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222791_223196_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|223313_224129_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224168_224822_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224814_225846_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226033_226609_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|232495_233299_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|233295_234210_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234450_235251_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211729.1|235328_236099_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236146_237505_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|237576_238332_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|238365_239088_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239084_239552_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239616_240348_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240887_241673_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241809_242289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|242298_243213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243256_243739_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|243762_245115_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122985538.1|245125_248560_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|248668_250081_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|250085_250829_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|250825_253591_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000246437.1|254364_255696_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255698_256223_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|256219_257500_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|257524_258607_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|258570_260421_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260424_260838_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	313065	412721	5233459	transposase,tail,head,portal,capsid,holin,protease,terminase,integrase	Enterobacteria_phage(40.0%)	103	315604:315620	387110:387126
WP_000749881.1|313065_314121_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|314408_315512_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|315523_316777_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
315604:315620	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051890.1|316981_318145_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	4.5e-228
WP_000206811.1|318371_318677_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001242715.1|318676_319039_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_040091282.1|319029_319566_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-99
WP_000081301.1|319694_320519_-	YfdQ family protein	NA	A5LH63	Enterobacteria_phage	100.0	2.7e-150
WP_000135680.1|320584_320947_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|321547_321844_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000888566.1|322294_322579_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	46.8	4.0e-13
WP_000135661.1|322646_322994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023145979.1|323009_323714_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.0	2.2e-68
WP_000098317.1|323821_324085_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_001524090.1|324113_324665_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	9.9e-101
WP_065275653.1|324661_325825_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	80.9	6.2e-169
WP_000620689.1|325821_326046_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_065225512.1|326042_326867_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_052934070.1|326863_327352_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.2e-86
WP_000210170.1|327351_327678_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_065225513.1|327674_327995_+	RusA family crossover junction endodeoxyribonuclease	NA	S5MDR3	Escherichia_phage	93.9	7.4e-48
WP_001300563.1|328007_329120_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001072669.1|329570_330386_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_052934278.1|330401_330917_+	hypothetical protein	NA	V5URU3	Shigella_phage	30.0	3.5e-15
WP_052934279.1|330926_331916_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001204819.1|331933_332299_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038608.1|332384_332831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917725.1|333100_333304_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_052934280.1|333454_334513_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	86.0	4.2e-180
WP_000466935.1|334981_335407_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	2.5e-59
WP_000833650.1|335403_335556_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000839572.1|335667_335883_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193267.1|335887_336238_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.4e-37
WP_042965844.1|336301_336835_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.5e-101
WP_001208684.1|337051_337258_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_040091510.1|338301_338952_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.8e-16
WP_000624622.1|338951_339299_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_065225491.1|339318_340890_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000095729.1|341039_341252_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000453587.1|341640_342186_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_065225514.1|342160_344086_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|344082_344289_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_065225515.1|344285_345887_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.6e-308
WP_065225516.1|345867_347187_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.1e-235
WP_065225517.1|347196_347529_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	8.4e-55
WP_065225518.1|347584_348610_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.0e-191
WP_042966659.1|348651_349047_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	7.7e-55
WP_065225519.1|349058_349412_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	2.9e-61
WP_001541219.1|349423_350002_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683105.1|349998_350394_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_042966661.1|350401_351142_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000479169.1|351157_351580_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|351561_351996_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_065275654.1|351988_354568_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.1	0.0e+00
WP_000847418.1|354564_354894_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_001152619.1|354893_355592_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_024210569.1|355597_356341_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.3e-143
WP_001351519.1|356277_356910_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_065225521.1|356970_360669_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.9	0.0e+00
WP_001228274.1|360736_361336_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_065275655.1|361400_363491_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.3	6.5e-92
WP_000701861.1|363505_364084_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	1.5e-51
WP_001265343.1|364364_364601_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	85.1	3.0e-14
WP_040091579.1|364784_366269_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201832.1|366455_367409_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361111.1|367907_368492_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001364131.1|368516_368954_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001111349.1|369477_369888_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_065275656.1|369866_370823_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001583225.1|370832_373031_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
WP_000643328.1|373027_373984_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070694.1|373980_374670_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|375087_375702_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|375949_376279_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001330883.1|377269_378913_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131077.1|378902_381428_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716392.1|381453_382122_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|382179_382767_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001296902.1|382841_383384_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147277.1|384206_384434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|384468_384609_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|384608_384872_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|385234_385336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092556.1|386451_390705_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
387110:387126	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000621018.1|390825_391683_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299025.1|391931_392801_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|392960_393554_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474074.1|393565_393802_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|393910_395236_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000339587.1|395461_396316_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102115.1|396845_397565_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023910.1|397575_399003_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370308.1|398995_399691_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209098.1|399936_400602_-	membrane protein	NA	NA	NA	NA	NA
WP_071593451.1|400785_401979_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001406334.1|403124_403886_-	protein HyxA	NA	NA	NA	NA	NA
WP_001406335.1|403902_404043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315275.1|404039_404834_-	LuxR family transcriptional regulator HyxR	NA	NA	NA	NA	NA
WP_001295805.1|405163_405727_-	tyrosine-type DNA invertase IpbA	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159102.1|406801_408472_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089077.1|408485_409958_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|409971_410559_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|410687_412721_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	647993	748136	5233459	transposase,tail,head,lysis,portal,capsid,protease,terminase,integrase,tRNA	Enterobacteria_phage(56.67%)	101	658155:658201	705527:705573
WP_000912345.1|647993_649379_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|649414_649936_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|650043_650256_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|650257_651124_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|651604_652147_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988375.1|652366_653059_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001306954.1|653089_655699_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|655711_656719_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|656729_657245_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|657247_657880_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
658155:658201	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001361259.1|658214_659378_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|659576_659855_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|659902_660121_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_077758593.1|660219_660501_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000129285.1|660511_661069_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|661061_661223_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186778.1|661219_661900_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_047675702.1|661896_662682_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	4.1e-148
WP_000995439.1|662687_662984_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_023148105.1|663059_663350_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_065225529.1|663746_664127_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000858975.1|664356_665046_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067459.1|665150_665381_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_001182868.1|665450_665990_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_000147928.1|665986_667006_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	1.1e-110
WP_000788917.1|667002_667704_+	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	3.5e-127
WP_000145897.1|667700_667874_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	89.1	2.1e-20
WP_001224616.1|668020_668515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379696.1|669144_669345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141579.1|669453_669555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053012.1|669551_670007_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_000224907.1|670006_670177_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774486.1|670169_670460_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_063083419.1|670456_670819_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	3.6e-59
WP_032145910.1|670815_670956_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|671041_671425_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737283.1|671614_672712_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|673300_673516_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|673515_674013_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|674229_674412_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|674502_674796_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|675086_675497_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|675782_675989_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_085947771.1|676080_677242_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001421937.1|677414_677609_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000867568.1|677997_678546_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_065225530.1|678517_680446_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.7e-259
WP_000259002.1|680429_680636_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831760.1|680632_682225_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253910.1|682214_683720_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_065225531.1|683756_684104_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522651.1|684161_685190_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|685241_685616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|685608_685962_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_065225532.1|685973_686552_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_065275659.1|686548_686944_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	8.5e-70
WP_001345558.1|686951_687692_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_065225534.1|687707_688130_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	5.7e-72
WP_000459457.1|688111_688546_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032361402.1|688538_691100_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.7	0.0e+00
WP_000847401.1|691096_691426_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152620.1|691425_692124_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_065225535.1|692129_692873_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_071961355.1|692809_693442_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.9e-96
WP_065225537.1|693502_696901_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001230388.1|696967_697567_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_071961364.1|697631_700982_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_065225538.1|700981_701566_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	5.6e-102
WP_071961356.1|701620_702280_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|703150_703900_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|704149_705103_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|705616_706378_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
705527:705573	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|706560_707451_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662373.1|707451_710424_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001402085.1|710410_712648_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_004021921.1|712916_714053_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001299580.1|714156_714468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|714582_714792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892558.1|714830_716165_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	2.5e-20
WP_106376274.1|716728_716881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103752.1|716933_717467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687356.1|722146_722578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225540.1|722589_727431_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	30.8	3.5e-16
WP_001160804.1|727450_727912_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103243.1|727939_729841_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_000253830.1|730577_732026_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|732015_732699_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000074237.1|732855_734238_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709865.1|734261_734594_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717163.1|734609_735833_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|735844_738988_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786320.1|739089_740466_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153146.1|740533_741781_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351464.1|741888_742542_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|742635_743004_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|743068_743317_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130622.1|743382_744501_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956456.1|744942_745095_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|745171_746284_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956465.1|746794_746947_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|747023_748136_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	943787	981295	5233459	lysis,portal,coat,holin,protease,terminase,integrase	Enterobacteria_phage(45.28%)	57	934679:934693	967149:967163
934679:934693	attL	GCGACGTGATGGCGA	NA	NA	NA	NA
WP_065275660.1|943787_944858_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	2.5e-201
WP_001303849.1|944835_945054_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545733.1|945093_945261_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_065275661.1|945361_946255_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	58.3	5.4e-80
WP_065275662.1|946607_947342_-	hypothetical protein	NA	Q9MCT8	Escherichia_phage	95.3	6.7e-129
WP_065275663.1|947338_947503_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_065275664.1|947513_947810_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_021499332.1|947833_948214_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	1.1e-63
WP_000031370.1|948213_948819_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|949075_949228_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|949212_949344_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001351814.1|949368_950337_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	100.0	2.0e-56
WP_047089184.1|950479_950950_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.4e-87
WP_077780006.1|951280_951667_-	antitermination protein	NA	Q716D8	Shigella_phage	99.1	2.2e-54
WP_000618034.1|951916_952321_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_000028392.1|952317_952950_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|953053_953269_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251073.1|953388_953682_+	lambda phage CII family protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_065275665.1|953844_954642_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	96.2	4.9e-133
WP_065275666.1|954749_956630_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.8	0.0e+00
WP_000736913.1|956707_957148_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153270.1|957144_957672_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_016063117.1|957668_957851_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_065275667.1|957847_958018_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	9.3e-26
WP_001279421.1|958010_958280_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_065275668.1|958279_958891_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.5	6.0e-99
WP_000144614.1|958887_959094_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_065275669.1|959071_959737_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	97.3	1.4e-128
WP_061089137.1|959733_960357_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.2e-113
WP_149025501.1|960944_961124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000783734.1|961348_961672_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|961655_962132_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_065275670.1|962128_962566_+|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	97.2	1.2e-69
WP_001139680.1|962553_962706_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000342560.1|963006_963222_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_000807788.1|963369_963612_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_065275671.1|963613_963793_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	96.6	4.1e-24
WP_000729922.1|963815_964304_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_000417851.1|964281_965781_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_065275672.1|965781_967947_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
967149:967163	attR	GCGACGTGATGGCGA	NA	NA	NA	NA
WP_000373006.1|967960_968872_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001196948.1|968871_970167_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	2.7e-242
WP_065275673.1|970210_970798_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.3	1.3e-61
WP_065275674.1|970775_971276_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	97.6	5.1e-88
WP_065225562.1|971276_972695_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.6	8.4e-277
WP_027662149.1|972694_973396_+	hypothetical protein	NA	Q9AYZ3	Salmonella_phage	97.4	1.9e-117
WP_065275675.1|973395_973851_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
WP_065275676.1|973853_974549_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	1.1e-115
WP_000257030.1|974559_975975_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.9	1.7e-200
WP_000868972.1|975974_977978_+	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.6e-98
WP_000275950.1|977986_978307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024222613.1|978387_978888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024203682.1|978880_979228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113457.1|979227_979467_-	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	76.6	5.9e-26
WP_023568675.1|979560_979722_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	92.5	1.5e-20
WP_065275677.1|979790_980726_+	antirepressor	NA	A0A2H4FRZ6	Salmonella_phage	99.0	1.3e-177
WP_158003932.1|980836_981295_-	HNH endonuclease	NA	A5H1J6	Xanthomonas_virus	46.2	3.9e-26
>prophage 5
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	1034990	1138504	5233459	transposase,tail,plate,head,lysis,portal,capsid,terminase,integrase	Salmonella_phage(62.96%)	108	1029288:1029303	1138721:1138736
1029288:1029303	attL	GCAACAAAAAATGTCG	NA	NA	NA	NA
WP_000399648.1|1034990_1035971_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|1036231_1037497_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|1037648_1038464_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209304.1|1038609_1041042_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|1041047_1041947_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|1042077_1042740_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829258.1|1042815_1043565_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|1043564_1044800_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|1045003_1045969_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|1045955_1047827_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|1047846_1049385_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|1049402_1050323_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|1050325_1051237_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001471275.1|1051414_1053763_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086916.1|1053770_1055099_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|1055145_1056471_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|1056683_1057067_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555035.1|1057177_1058293_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|1058289_1058916_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|1059162_1060365_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|1060411_1061170_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|1061227_1061824_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|1062108_1063341_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|1063381_1063666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|1063751_1064567_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|1064566_1065775_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|1065858_1066395_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_000290937.1|1066499_1067552_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_065275679.1|1067625_1069395_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042096903.1|1069438_1070377_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.2	1.8e-33
WP_065275680.1|1070464_1070686_+	regulator	NA	NA	NA	NA	NA
WP_000460893.1|1070718_1071228_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956184.1|1071235_1071436_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000963473.1|1071399_1071741_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001703803.1|1071808_1072042_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752619.1|1072041_1072269_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_053903769.1|1072265_1073123_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.9e-159
WP_065275681.1|1073119_1075534_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_001154431.1|1075686_1075875_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1075885_1076119_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|1076311_1076647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065275682.1|1077168_1078233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065275683.1|1078234_1079359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065275684.1|1079336_1080038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040063996.1|1080081_1081113_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	1.8e-172
WP_065275685.1|1081112_1082879_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_065275686.1|1083021_1083855_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.6	3.1e-122
WP_000742503.1|1083871_1084930_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_001471288.1|1084933_1085584_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673523.1|1085679_1086144_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868192.1|1086143_1086347_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|1086350_1086566_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001442491.1|1086584_1087058_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_065275687.1|1087059_1087437_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001337513.1|1087433_1087862_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001039945.1|1087957_1088389_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829146.1|1088381_1088828_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993775.1|1088896_1089475_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|1089471_1089831_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|1089817_1090726_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086836.1|1090718_1091324_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000356382.1|1092857_1093460_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	6.0e-99
WP_001008226.1|1093431_1093875_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	3.2e-81
WP_001487491.1|1093895_1094306_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905032.1|1094336_1094903_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_065275688.1|1095045_1096218_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	3.2e-205
WP_001207656.1|1096227_1096743_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281009.1|1096797_1097100_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1097114_1097234_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_065275689.1|1097226_1100304_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980413.1|1100300_1100786_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011797.1|1100782_1101883_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972391.1|1101973_1102192_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1102427_1104113_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1104382_1104760_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|1104789_1105047_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|1105206_1105494_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1105477_1106200_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1106260_1107163_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1107250_1107727_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|1108077_1109190_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996024.1|1109284_1110418_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105438.1|1110427_1111381_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|1111377_1112223_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1112282_1112771_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|1112811_1113939_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|1114113_1114845_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|1115136_1115805_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1115804_1116521_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1116527_1117259_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027195.1|1117276_1118005_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
WP_001270735.1|1118222_1118738_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1118863_1119187_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|1119183_1120014_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001307082.1|1120010_1121024_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1121122_1122553_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1122563_1123565_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|1123601_1125320_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|1125452_1126421_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1126432_1128085_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1128228_1129128_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1129622_1130318_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1130743_1132402_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1132398_1133355_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|1133505_1134621_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188193.1|1134617_1136564_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|1136636_1136861_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_042966296.1|1137265_1138504_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	51.0	3.5e-122
1138721:1138736	attR	CGACATTTTTTGTTGC	NA	NA	NA	NA
>prophage 6
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	1143662	1210500	5233459	transposase,head,capsid,protease,terminase,tRNA	Bacillus_phage(22.22%)	52	NA	NA
WP_000228102.1|1143662_1144703_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	7.5e-65
WP_000190777.1|1144712_1145054_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179421.1|1145065_1145449_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_042966308.1|1145650_1146193_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	46.3	1.3e-33
WP_052934388.1|1146444_1146729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|1147814_1148135_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1148165_1150442_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1151126_1151345_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1151629_1152334_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|1152375_1154097_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043587.1|1154097_1155864_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|1155986_1156952_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1157496_1157991_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_065225549.1|1158125_1162193_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1162351_1162963_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067751.1|1162973_1164317_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_000886683.1|1164407_1165700_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850313.1|1165938_1168383_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000213098.1|1168393_1169011_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534648.1|1169012_1169876_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|1169911_1170538_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|1170852_1172001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|1172210_1173641_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242675.1|1173641_1174550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190362.1|1174649_1175240_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000111043.1|1175321_1176062_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292812.1|1176253_1178536_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|1178590_1179448_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001297197.1|1179853_1181614_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1181743_1182436_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|1182634_1183723_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|1183793_1185077_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1185245_1186010_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|1186182_1186866_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1186976_1188650_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1188809_1189094_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|1189300_1191565_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1191601_1193350_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570542.1|1193346_1194333_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|1194369_1195602_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350058.1|1195653_1195836_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|1195832_1196579_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1196732_1197626_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|1197602_1198382_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|1198517_1199303_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1199299_1200622_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|1200602_1201307_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001471316.1|1201306_1205767_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925997.1|1206027_1207875_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1208055_1208604_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1208630_1209278_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000399648.1|1209519_1210500_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	1293273	1345675	5233459	tail,bacteriocin,lysis,portal,capsid,holin,terminase	Escherichia_phage(97.06%)	69	NA	NA
WP_001401545.1|1293273_1294584_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208772.1|1294636_1294921_-	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_000497812.1|1294966_1295218_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000994793.1|1295581_1295962_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|1295997_1296210_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|1296169_1296796_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|1296792_1297224_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|1297279_1297909_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|1298158_1298443_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000206786.1|1298798_1299695_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|1299697_1299889_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1299890_1300298_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|1300294_1301020_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|1301170_1301566_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|1301642_1302464_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|1302527_1302875_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|1302949_1303537_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|1303536_1304226_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|1304222_1305173_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1305189_1305471_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|1305491_1305773_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_001369605.1|1306067_1306742_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|1306997_1307783_-	Rha family phage regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|1308399_1309353_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1309349_1310819_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1310913_1311627_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1311722_1311926_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|1312096_1312291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1312457_1312835_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|1312828_1314349_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|1314338_1315310_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|1315309_1315759_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1315766_1316330_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1316326_1316521_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1316513_1316948_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|1317196_1317349_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1317731_1318691_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1318702_1318972_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|1319457_1321395_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1321531_1321711_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1321751_1321997_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1322074_1322290_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087737.1|1322294_1322828_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001056879.1|1323101_1323671_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000455397.1|1323670_1323820_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_024017835.1|1323822_1324260_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_001109019.1|1324462_1325014_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|1325306_1326113_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1326093_1327800_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|1327799_1329944_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1330101_1331109_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1331132_1332347_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1332402_1332792_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1332841_1333303_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1333286_1333850_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207927.1|1333849_1334500_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_032347921.1|1334496_1336644_+|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	96.0	1.9e-86
WP_000513231.1|1336730_1337243_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_001391593.1|1337476_1339102_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1339098_1340367_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1340381_1340660_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1340665_1341283_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1341373_1342108_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1342340_1342481_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1342537_1342939_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|1343032_1343689_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1343691_1344138_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1344147_1344399_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|1344409_1345675_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
>prophage 8
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	1473115	1531679	5233459	transposase,tail,head,portal,capsid,holin,protease,terminase,integrase,tRNA	Escherichia_phage(36.36%)	74	1468209:1468223	1474690:1474704
1468209:1468223	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074979.1|1473115_1474234_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	3.5e-84
WP_000003742.1|1474202_1474472_-	excisionase	NA	NA	NA	NA	NA
WP_065275690.1|1474533_1476960_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.6	7.2e-111
1474690:1474704	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|1477053_1477245_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1477241_1477430_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000559912.1|1477968_1478424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171906.1|1478559_1478778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1478937_1479093_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362153.1|1479358_1479778_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1479878_1480160_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_047662379.1|1480143_1480569_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_065275691.1|1480640_1481660_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	88.8	1.6e-99
WP_182044416.1|1481571_1482114_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	1.7e-84
WP_065275692.1|1482148_1482910_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.4	5.6e-86
WP_077630125.1|1482966_1483221_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.1	6.5e-23
WP_000699804.1|1483217_1483463_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_000004204.1|1483437_1483911_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.2	1.7e-64
WP_001224671.1|1484055_1484238_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_000753062.1|1484230_1484407_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.5e-26
WP_038813042.1|1484430_1484826_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_047670558.1|1485059_1485272_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	94.3	3.6e-27
WP_001277678.1|1485489_1485669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818167.1|1485687_1486173_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_024212283.1|1486288_1486561_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	5.5e-12
WP_024212284.1|1486562_1487612_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_065275693.1|1487624_1487996_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000942766.1|1487985_1488357_+	Probable antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	4.7e-54
WP_000265262.1|1488511_1489330_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|1489619_1489817_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_065275694.1|1491128_1491671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966258.1|1491881_1492307_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_040091348.1|1492303_1492468_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_038813346.1|1492729_1493065_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_000284517.1|1493237_1493453_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001015166.1|1493456_1494098_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_001005227.1|1494107_1494380_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	70.0	7.7e-30
WP_085948397.1|1494421_1495116_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_001092885.1|1495324_1495858_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.8e-99
WP_052834940.1|1496013_1496196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|1496556_1496742_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_000735650.1|1496827_1497052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095729.1|1498087_1498300_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|1498693_1499203_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|1499174_1501103_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|1501086_1501293_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360691.1|1501289_1502882_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_040090915.1|1502871_1504377_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_000256809.1|1504413_1504761_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522660.1|1504818_1505847_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|1505898_1506282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|1506274_1506628_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000975024.1|1506642_1507176_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683087.1|1507172_1507568_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|1507575_1508328_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_052934348.1|1508341_1508773_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.0	3.4e-40
WP_047085479.1|1508799_1509213_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_065275696.1|1509193_1511773_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000847418.1|1511769_1512099_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_001152619.1|1512098_1512797_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_024210569.1|1512802_1513546_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.3e-143
WP_001351519.1|1513482_1514115_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_065275697.1|1514175_1517874_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.9	0.0e+00
WP_047085483.1|1517941_1518541_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	3.1e-100
WP_052934087.1|1518605_1520696_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	61.8	2.2e-92
WP_000701863.1|1520710_1521283_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	55.4	2.4e-49
WP_000799405.1|1521517_1522381_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1522364_1523501_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359457.1|1523750_1524977_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1525025_1526147_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735406.1|1526222_1527683_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1527682_1528354_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1528521_1529892_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1529895_1530537_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001378857.1|1530572_1531679_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	1937004	1994481	5233459	tail,transposase,lysis,portal,protease,terminase,integrase	Enterobacteria_phage(47.92%)	70	1967417:1967433	1999177:1999193
WP_065275702.1|1937004_1938465_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.5e-42
WP_120795384.1|1940438_1940552_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1940620_1940854_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|1941170_1941761_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885614.1|1941858_1942434_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_065225633.1|1942433_1945832_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233167.1|1945896_1946496_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	1.7e-109
WP_065225634.1|1946563_1949959_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.6	0.0e+00
WP_073972164.1|1950019_1950667_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	3.3e-111
WP_000140707.1|1950564_1951308_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152368.1|1951312_1952011_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447251.1|1952020_1952350_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_065225635.1|1952349_1955415_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1955386_1955716_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001384509.1|1955724_1956111_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	2.2e-62
WP_000211131.1|1956171_1956915_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_001079398.1|1956925_1957327_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_061892320.1|1957323_1957902_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	97.9	6.8e-100
WP_024207680.1|1957913_1958189_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	4.2e-44
WP_001097041.1|1958181_1958505_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|1958591_1960619_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_021542121.1|1960563_1962072_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_021545871.1|1962071_1962284_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	2.4e-31
WP_065275703.1|1962280_1964380_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_000421825.1|1964388_1964928_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|1965478_1965685_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1965980_1966154_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1966326_1966482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|1966629_1966818_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1966828_1967041_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|1967404_1967902_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
1967417:1967433	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092966.1|1967898_1968432_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|1968428_1968740_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|1968744_1968960_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|1969211_1969586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|1969757_1970186_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_047626566.1|1970552_1970684_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	3.1e-05
WP_000762885.1|1971579_1972401_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000904111.1|1972415_1972772_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_053292618.1|1972784_1973834_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.7e-107
WP_012304870.1|1973835_1974114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1974180_1974432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1974648_1974804_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1974875_1975163_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1975162_1975402_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071527819.1|1975426_1975732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1975934_1976267_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|1976703_1978044_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|1978077_1978497_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054504.1|1978537_1979503_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|1979483_1980005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1979988_1980216_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1980293_1980701_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|1980893_1981049_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_122986852.1|1981050_1981302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986851.1|1981288_1981609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1982113_1982302_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|1982298_1982490_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_033815598.1|1982583_1985055_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1985127_1985379_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876979.1|1985413_1986694_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_021531328.1|1986713_1986824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1986881_1987901_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1987912_1989127_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1989332_1989659_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1989793_1990135_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1990169_1990730_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1990732_1991443_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1991550_1991856_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|1992054_1994481_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
1999177:1999193	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 10
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	2268682	2350044	5233459	tail,transposase,head,portal,capsid,protease,holin,terminase,integrase,tRNA	Enterobacteria_phage(34.38%)	95	2260971:2260986	2353222:2353237
2260971:2260986	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_085947771.1|2268682_2269844_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_065225637.1|2269872_2270658_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001307253.1|2270680_2271520_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000582553.1|2271612_2272410_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000633901.1|2272431_2274231_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_000357164.1|2274247_2275081_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_077251362.1|2275083_2276352_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000777726.1|2276375_2277608_-	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000242979.1|2277880_2278918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490375.1|2278936_2279893_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_001307257.1|2279983_2280472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741721.1|2280554_2281682_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
WP_000581608.1|2282088_2282898_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000575897.1|2282986_2284855_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_000281533.1|2284891_2287966_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_000448381.1|2288054_2289026_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2289145_2290468_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2290483_2291416_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_065225638.1|2291494_2292250_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	27.8	1.4e-17
WP_000571465.1|2292246_2293032_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2293178_2294189_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2294197_2294809_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2294947_2295013_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024917.1|2295083_2295686_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2295687_2296209_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2296243_2296984_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|2297012_2297465_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2297582_2299355_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2299664_2300231_+	hydrolase	NA	NA	NA	NA	NA
WP_065225639.1|2300581_2301154_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	54.1	2.7e-48
WP_065225640.1|2301168_2303259_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.0	7.9e-90
WP_001228274.1|2303323_2303923_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_065225641.1|2303990_2307689_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	78.6	0.0e+00
WP_072131720.1|2307749_2308397_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	5.6e-111
WP_065225642.1|2308294_2309038_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_021562581.1|2309043_2309742_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	2.0e-130
WP_040079256.1|2309741_2310098_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_000224015.1|2310075_2313303_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_024212233.1|2313348_2313627_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	1.8e-42
WP_000164661.1|2313650_2314022_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097533.1|2314036_2314741_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|2314800_2315145_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2315141_2315588_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_065225643.1|2315587_2315926_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	2.7e-56
WP_000983037.1|2315934_2316240_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2316251_2316440_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_065225644.1|2316491_2317697_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	2.5e-221
WP_001193631.1|2317711_2318362_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466248.1|2318339_2319581_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000478567.1|2319580_2319763_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|2319774_2321532_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_001317918.1|2321531_2322014_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_000361882.1|2322256_2322772_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	1.3e-33
WP_001140100.1|2322907_2323258_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	93.0	1.1e-60
WP_001109099.1|2323267_2323468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|2323785_2323971_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_047085180.1|2324187_2324721_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	1.3e-100
WP_000282141.1|2324849_2325164_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065225645.1|2325173_2325815_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.3	2.1e-62
WP_113771422.1|2325818_2326034_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	95.8	6.5e-32
WP_047085559.1|2326132_2326468_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	82.9	1.7e-47
WP_038813346.1|2326729_2327065_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2327326_2327491_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2327487_2327913_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_065225491.1|2328049_2329621_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000624622.1|2329640_2329988_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_040091510.1|2329987_2330638_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.8e-16
WP_001405091.1|2330810_2331554_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000640038.1|2331794_2332331_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.0e-66
WP_065225646.1|2332339_2332699_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.2	6.6e-37
WP_000211316.1|2332953_2334345_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.6	1.6e-251
WP_000988194.1|2334341_2335220_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	98.0	4.4e-143
WP_000092425.1|2335230_2336223_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	98.2	4.9e-58
WP_000621182.1|2336219_2336444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966265.1|2336440_2337304_-	Rha family phage regulatory protein	NA	S5MQL6	Escherichia_phage	76.3	1.4e-112
WP_038813125.1|2337296_2337689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065275704.1|2337752_2337926_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	87.7	6.2e-25
WP_001090257.1|2337945_2338653_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	91.5	6.1e-119
WP_136759491.1|2338690_2339419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838349.1|2339777_2340434_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	99.5	3.7e-126
WP_000608400.1|2340537_2340972_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	94.9	4.6e-69
WP_000141090.1|2341109_2341316_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_000660644.1|2341512_2341701_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.3e-28
WP_024212033.1|2341697_2342279_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.7	9.2e-105
WP_000720009.1|2342640_2343468_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	8.1e-131
WP_024212031.1|2343508_2343880_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	96.7	3.6e-62
WP_042966262.1|2343911_2344154_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	96.2	6.4e-36
WP_001030139.1|2344157_2344304_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000528719.1|2344312_2344549_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	2.9e-41
WP_042966263.1|2344604_2345918_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.2	4.0e-249
WP_065225647.1|2345899_2346670_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252979.1|2346722_2347118_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019584.1|2347158_2347902_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|2347898_2348870_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|2349063_2350044_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2353222:2353237	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 11
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	2405295	2488371	5233459	tail,transposase,head,capsid,holin,protease,terminase,integrase	Escherichia_phage(37.29%)	101	2410410:2410424	2492968:2492982
WP_065225648.1|2405295_2406504_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.7e-207
WP_000879833.1|2407915_2408713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001593414.1|2408722_2409274_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2409442_2409775_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2410108_2410423_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
2410410:2410424	attL	TGTATCGCTGACATT	NA	NA	NA	NA
WP_000994452.1|2410637_2412296_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2412288_2413284_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282699.1|2413276_2413963_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2413962_2415336_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807580.1|2415354_2415798_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620099.1|2415794_2416922_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2417026_2417491_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2417495_2418500_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2418496_2418910_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001299290.1|2418912_2419278_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2419277_2420015_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2420024_2420294_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|2420302_2421088_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2421377_2422001_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2422044_2422233_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2422395_2422623_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491501.1|2422920_2423736_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001349973.1|2423732_2425427_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2425597_2425780_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2425858_2426776_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000786004.1|2427856_2428327_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157239.1|2428307_2429726_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365545.1|2429792_2430488_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_001313057.1|2430527_2430893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824355.1|2431459_2432575_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_000218208.1|2433166_2434018_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826770.1|2434125_2435484_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|2435483_2436155_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920128.1|2436287_2436701_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740100.1|2436809_2437814_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|2437814_2438450_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007749.1|2438706_2439357_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2439699_2440230_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_065225649.1|2441288_2441867_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	4.4e-51
WP_065275705.1|2441881_2443972_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.0	1.4e-91
WP_000017388.1|2444062_2444854_-	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	3.1e-119
WP_047089024.1|2444850_2445222_-	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_042966578.1|2448723_2449368_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	77.4	6.8e-93
WP_047085481.1|2449265_2450009_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.1	2.4e-142
WP_024212310.1|2450019_2450718_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	5.8e-130
WP_000847269.1|2450717_2451047_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	6.8e-57
WP_065225651.1|2451043_2453623_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_047085479.1|2453603_2454017_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_000479079.1|2454043_2454475_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_000235024.1|2454488_2455241_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000683087.1|2455248_2455644_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000975024.1|2455640_2456174_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_021499114.1|2456188_2456542_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_001355131.1|2456534_2456918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522660.1|2456969_2457998_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_000256809.1|2458055_2458403_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_040090915.1|2458439_2459945_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_000259002.1|2461522_2461729_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360690.1|2461712_2463641_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000235436.1|2463612_2464122_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000095729.1|2464515_2464728_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000735650.1|2465763_2465988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|2466073_2466259_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_052834940.1|2466619_2466802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966549.1|2466957_2467491_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	5.1e-102
WP_000282141.1|2467619_2467934_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001015166.1|2467943_2468585_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284517.1|2468588_2468804_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_038813346.1|2468976_2469312_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2469573_2469738_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2469734_2470160_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_038813804.1|2470370_2470913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|2472224_2472422_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000265262.1|2472711_2473530_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000942766.1|2473684_2474056_-	Probable antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	4.7e-54
WP_047085386.1|2474045_2474417_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.4e-34
WP_047085387.1|2474429_2475479_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.3e-109
WP_047085388.1|2475480_2475759_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047085389.1|2475825_2476086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085390.1|2476338_2476551_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.8e-27
WP_038813042.1|2476784_2477180_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000753062.1|2477203_2477380_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.5e-26
WP_001224671.1|2477372_2477555_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_047085392.1|2477699_2478173_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	1.2e-65
WP_000699804.1|2478147_2478393_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_077790485.1|2478389_2478644_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	68.3	3.8e-23
WP_097759619.1|2478700_2479318_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	3.2e-63
WP_047085396.1|2479281_2479461_-	DNA-binding protein	NA	A0A0U2SAW4	Escherichia_phage	89.4	1.3e-14
WP_157922753.1|2479495_2480038_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.5e-85
WP_047087522.1|2479949_2480990_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	85.6	2.5e-89
WP_000705388.1|2480961_2481513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085261.1|2481496_2481724_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381213.1|2481804_2482212_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_052073903.1|2482380_2482536_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_047085262.1|2482695_2482911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085263.1|2483000_2483447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085602.1|2484142_2484331_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098306.1|2484327_2484519_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_047087128.1|2484612_2487084_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_000096344.1|2487142_2487346_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047085409.1|2487345_2488371_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
2492968:2492982	attR	AATGTCAGCGATACA	NA	NA	NA	NA
>prophage 12
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	2613389	2678885	5233459	tail,plate,head,lysis,portal,capsid,holin,terminase,integrase,tRNA	Escherichia_phage(34.78%)	74	2618447:2618474	2651611:2651638
WP_000675150.1|2613389_2614793_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2614789_2615512_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2615702_2616035_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2616243_2616540_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2616541_2616838_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2616940_2618302_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2618447:2618474	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2618574_2618793_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|2618874_2620038_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_023303999.1|2620037_2620517_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_065275706.1|2620531_2622979_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|2622971_2623091_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2623123_2623399_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2623455_2623974_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2623986_2625177_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_065275707.1|2625577_2626357_+	hypothetical protein	NA	Q858R7	Enterobacteria_phage	99.6	1.1e-116
WP_065275708.1|2626508_2627036_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	96.0	6.2e-92
WP_065275709.1|2627039_2629334_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	61.9	7.9e-184
WP_001285314.1|2629344_2629875_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_001121499.1|2629867_2630776_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127163.1|2630780_2631128_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_065275710.1|2631124_2631760_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	3.2e-111
WP_000648253.1|2631866_2633111_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_065275711.1|2633211_2633661_-	phage virion morphogenesis protein	NA	A0A218M4K4	Erwinia_phage	63.9	3.1e-44
WP_001406878.1|2633653_2634121_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001440152.1|2634083_2634257_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_065275712.1|2634228_2634654_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.7e-66
WP_065275713.1|2634641_2635067_-	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	4.2e-59
WP_001403144.1|2635081_2635579_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|2635578_2635860_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2635863_2636067_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988639.1|2636066_2636576_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_001620984.1|2636675_2637419_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.8	1.2e-120
WP_050868994.1|2637422_2638496_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	1.1e-201
WP_001297840.1|2638554_2639409_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.9	2.4e-133
WP_049144282.1|2639582_2641355_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038184.1|2641354_2642389_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_065275714.1|2642887_2645482_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_065275715.1|2645685_2647959_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_000027667.1|2647948_2648224_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113260.1|2648220_2648445_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_023304086.1|2648444_2648747_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	94.0	1.6e-44
WP_000557701.1|2648746_2648971_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217671.1|2649034_2649535_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001005162.1|2649531_2649702_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2649712_2649988_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2650102_2650402_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|2650517_2651531_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_000716757.1|2651795_2652113_-	hypothetical protein	NA	NA	NA	NA	NA
2651611:2651638	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2652527_2653427_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178556.1|2653508_2654288_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844264.1|2654387_2655428_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490693.1|2655475_2656831_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823287.1|2656834_2657119_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182903.1|2657149_2657602_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|2657611_2658874_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2658902_2659757_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2660064_2661117_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2661373_2662651_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2662647_2663652_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2663648_2664614_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2664587_2665334_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2665385_2666204_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822274.1|2666268_2667069_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2667065_2667854_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2668076_2668349_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2668469_2669294_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2669512_2669851_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|2669932_2670967_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|2670980_2673461_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|2673476_2674151_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2674231_2674774_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001351454.1|2675066_2675348_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005440.1|2675610_2676720_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001439138.1|2676851_2678885_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
>prophage 13
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	2691396	2700838	5233459		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|2691396_2692533_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_033817093.1|2692529_2694530_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2694654_2695116_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2695156_2695627_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2695673_2696393_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_065225663.1|2696389_2698075_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	5.6e-304
WP_001240401.1|2698296_2699028_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2699087_2699195_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2699175_2699907_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|2699911_2700838_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 14
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	2950658	2996146	5233459	head,tail,terminase	Cronobacter_phage(36.96%)	64	NA	NA
WP_033817208.1|2950658_2952656_-	hypothetical protein	NA	B1GS50	Salmonella_phage	69.8	2.4e-59
WP_033817209.1|2952712_2955190_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	88.2	0.0e+00
WP_050488448.1|2955176_2955593_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	83.8	1.6e-66
WP_032141923.1|2955555_2956026_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_016245414.1|2956025_2956523_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
WP_033817210.1|2956522_2958850_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	50.8	2.6e-150
WP_033817211.1|2958938_2959298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817212.1|2959403_2960129_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	1.8e-62
WP_033817213.1|2960179_2960935_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	52.6	3.2e-57
WP_033817214.1|2960993_2961377_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	1.4e-37
WP_033817215.1|2961373_2961742_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	71.3	1.8e-42
WP_033817216.1|2961744_2962095_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	4.4e-38
WP_033817217.1|2962094_2962268_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	47.4	3.9e-11
WP_033817218.1|2962267_2962648_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_033817219.1|2962650_2963016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817220.1|2963025_2964123_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	5.9e-161
WP_033817221.1|2964132_2964567_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	6.7e-52
WP_033817222.1|2964570_2965965_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	67.0	2.0e-158
WP_169072554.1|2966507_2967485_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.6	3.8e-111
WP_033817225.1|2967438_2968899_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	72.4	1.2e-190
WP_033817226.1|2968910_2970383_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.7	8.7e-253
WP_033817227.1|2970382_2970985_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	1.7e-77
WP_033817228.1|2970988_2971207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817229.1|2971335_2971605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817230.1|2971821_2972199_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.6	4.8e-14
WP_033817256.1|2972195_2972711_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.0	1.7e-49
WP_033817231.1|2972703_2973024_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	78.0	1.4e-38
WP_033817232.1|2973465_2973705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817233.1|2973894_2974584_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.7e-55
WP_089604614.1|2974580_2974697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141952.1|2974693_2975077_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	44.6	2.7e-20
WP_033817234.1|2975073_2975685_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	71.4	6.5e-61
WP_033817235.1|2975677_2975848_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	85.5	7.7e-20
WP_033817236.1|2975847_2976303_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	71.5	2.0e-59
WP_033817237.1|2976476_2977127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817238.1|2977123_2977372_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	93.8	1.5e-35
WP_032141958.1|2977371_2977698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123282430.1|2978252_2978537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071961367.1|2978688_2978943_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	45.3	4.4e-11
WP_033817257.1|2978973_2979273_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	52.6	3.1e-16
WP_033817240.1|2979277_2980651_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.4	3.8e-165
WP_033817241.1|2980647_2981733_-	replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.6e-84
WP_023306333.1|2981725_2981872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817242.1|2981961_2982528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817243.1|2982557_2982785_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	3.1e-16
WP_033817244.1|2982820_2983576_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	59.1	9.5e-78
WP_033817245.1|2983587_2984175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033817246.1|2984525_2984867_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
WP_028013595.1|2985485_2985683_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_033817247.1|2985755_2986040_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	97.9	9.1e-50
WP_033817248.1|2986049_2986967_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	3.9e-158
WP_065225677.1|2986963_2987584_+	helix-turn-helix domain-containing protein	NA	A0A2I7QQK3	Vibrio_phage	40.3	1.6e-22
WP_033817249.1|2987576_2988263_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.3	5.3e-120
WP_033817250.1|2988259_2988688_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	6.8e-73
WP_033817251.1|2988684_2988837_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
WP_032141975.1|2989489_2989708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141976.1|2989704_2990046_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
WP_032141978.1|2990137_2990356_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.7	3.7e-19
WP_032141979.1|2990443_2990716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141980.1|2990804_2991104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141982.1|2991512_2991716_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	61.2	6.6e-18
WP_001197025.1|2992262_2993510_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2993581_2994496_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2994712_2996146_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 15
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	3207735	3290365	5233459	tail,plate,head,portal,capsid,holin,terminase,integrase,tRNA	Enterobacteria_phage(67.86%)	96	3259720:3259736	3287637:3287653
WP_001295367.1|3207735_3208272_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190658.1|3208296_3208932_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|3209140_3209989_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196283.1|3210044_3210305_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_000128776.1|3210498_3210579_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|3210998_3211379_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_033817343.1|3211378_3212110_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399393.1|3212121_3212850_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|3212861_3213767_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|3213763_3214444_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3214716_3215691_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3215706_3217506_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|3217703_3218183_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|3218179_3219136_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|3219135_3219786_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|3219818_3220394_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|3220390_3220546_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094499.1|3220801_3222424_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033817342.1|3222408_3223146_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3223277_3224612_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3224820_3225702_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3225804_3226392_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3226447_3226831_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3227135_3227825_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3227872_3228910_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3229116_3229536_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|3229604_3230303_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082949.1|3230334_3232995_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3233108_3234464_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3234509_3234833_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000230376.1|3234829_3236128_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3241983_3244557_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3244686_3245418_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3245414_3246395_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3246529_3247267_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_065225682.1|3247537_3247879_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215755.1|3248029_3248836_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	8.9e-66
WP_001353016.1|3248780_3248978_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032140709.1|3249227_3249368_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_000488108.1|3249558_3249819_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132829.1|3249861_3250971_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	1.6e-195
WP_000005391.1|3251128_3252313_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	6.9e-224
WP_000290450.1|3252312_3252825_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|3252879_3253245_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|3253253_3253409_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853424.1|3253395_3256203_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.6	0.0e+00
WP_000979945.1|3256215_3256704_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905085.1|3256741_3257332_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.3e-86
WP_065275728.1|3257362_3257881_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.7	1.0e-51
WP_042053418.1|3257880_3258483_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	7.3e-97
WP_001008218.1|3258454_3258898_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	2.4e-81
WP_077884022.1|3258918_3260424_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	62.5	8.6e-155
3259720:3259736	attL	CGCTGCCAGTGTTTCAG	NA	NA	NA	NA
WP_000071709.1|3260420_3261029_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	75.4	5.3e-87
WP_065275729.1|3261021_3261918_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_001067548.1|3261921_3262251_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077631957.1|3262268_3262835_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_000356343.1|3262846_3263482_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_065275730.1|3263474_3263942_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.7e-85
WP_000780595.1|3264079_3264487_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	6.1e-63
WP_000836746.1|3264483_3265029_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.6	2.4e-91
WP_000104344.1|3265083_3265407_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000864901.1|3265409_3265610_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|3265609_3266104_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632346.1|3266205_3267006_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.9	2.4e-140
WP_021293094.1|3267051_3268104_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.6	9.5e-193
WP_001262688.1|3268127_3268964_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_000613750.1|3269118_3270870_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087810.1|3270869_3271916_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	5.7e-206
WP_001080496.1|3272400_3272808_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	5.2e-22
WP_065275731.1|3272804_3273137_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	95.5	2.7e-53
WP_000211256.1|3273200_3273512_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_000686508.1|3273516_3274476_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_065275732.1|3274552_3277375_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.0	0.0e+00
WP_065275733.1|3277381_3277747_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	7.3e-60
WP_157896070.1|3277743_3278361_-	ash family protein	NA	S5MQL6	Escherichia_phage	39.3	3.4e-09
WP_000104290.1|3278372_3278672_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|3278668_3278935_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|3278931_3279135_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_065275734.1|3279158_3279569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|3279662_3279776_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|3279772_3280015_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159454.1|3280026_3280305_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	6.9e-34
WP_000813365.1|3280315_3280657_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|3280675_3281002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|3281097_3281400_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|3281466_3282456_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001386991.1|3282623_3282671_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200116.1|3282769_3283930_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3283972_3285094_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|3285104_3286175_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3286384_3286750_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3286899_3287418_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969030.1|3287407_3288634_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
3287637:3287653	attR	CTGAAACACTGGCAGCG	NA	NA	NA	NA
WP_000589828.1|3288649_3289132_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3289208_3289556_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3289597_3290365_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	3379354	3386494	5233459		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3379354_3381916_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3382021_3382678_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3382728_3383496_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3383691_3384600_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3384596_3385859_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3385855_3386494_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP013663	Escherichia coli strain GB089 chromosome, complete genome	5233459	5156906	5197034	5233459	tail,head,portal,capsid,holin,terminase,integrase	Enterobacteria_phage(36.96%)	51	5155992:5156007	5177451:5177466
5155992:5156007	attL	GGGTGGATTATCAAAA	NA	NA	NA	NA
WP_040091220.1|5156906_5158145_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.3	1.6e-231
WP_047085127.1|5158297_5159893_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_040091656.1|5159903_5160089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091321.1|5160624_5160972_-	hypothetical protein	NA	U5P0J0	Shigella_phage	70.4	2.1e-24
WP_040091320.1|5160968_5161847_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	3.1e-165
WP_001401560.1|5161837_5162374_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_065225712.1|5162501_5163326_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000135680.1|5163391_5163754_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021559686.1|5164598_5164808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859465.1|5165003_5165678_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.6	3.5e-132
WP_000649477.1|5165768_5165969_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|5166012_5166564_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_065225713.1|5166560_5167709_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	82.7	5.2e-168
WP_000620701.1|5167705_5167930_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	9.7e-39
WP_000061516.1|5167926_5168745_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.4e-122
WP_001364121.1|5168741_5169236_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	4.0e-85
WP_000210186.1|5169235_5169562_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
WP_000767110.1|5169558_5169954_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|5170105_5170921_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001223333.1|5170936_5171452_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_001202270.1|5171461_5172451_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	2.3e-193
WP_001204819.1|5172468_5172834_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038608.1|5172919_5173366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917725.1|5173635_5173839_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_065225714.1|5173989_5175048_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	85.4	6.0e-179
WP_001299895.1|5175515_5175947_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000216624.1|5175943_5176108_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_000284517.1|5176668_5176884_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001015166.1|5176887_5177529_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
5177451:5177466	attR	TTTTGATAATCCACCC	NA	NA	NA	NA
WP_000282141.1|5177538_5177853_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065225715.1|5177981_5178515_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_123008212.1|5179729_5179936_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	9.3e-12
WP_000095729.1|5181005_5181218_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|5181611_5182121_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|5182092_5184021_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|5184004_5184211_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360691.1|5184207_5185800_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_040090915.1|5185789_5187295_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_000256809.1|5187331_5187679_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522660.1|5187736_5188765_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|5188816_5189200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|5189192_5189546_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000683087.1|5190091_5190487_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|5190494_5191247_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_052934348.1|5191260_5191692_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.0	3.4e-40
WP_047085479.1|5191718_5192132_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_065275696.1|5192112_5194692_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000847418.1|5194688_5195018_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_001152619.1|5195017_5195716_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_024210569.1|5195721_5196465_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.3e-143
WP_001351519.1|5196401_5197034_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
>prophage 1
NZ_CP012499	Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence	223952	2209	148275	223952	plate,tRNA,integrase,transposase	Escherichia_phage(15.0%)	104	18492:18517	101518:101543
WP_000342165.1|2209_3418_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	9.6e-48
WP_000170150.1|3518_4712_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_000781198.1|4726_5371_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000196048.1|5379_6081_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000132382.1|6096_7125_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000194204.1|7136_8495_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_001151754.1|8617_9544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000726553.1|11792_12713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766067.1|16342_16639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001355425.1|17443_17662_+	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
18492:18517	attL	TGTCAACGCCACGATGTTTGACCGTT	NA	NA	NA	NA
WP_136759869.1|21125_21410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000395613.1|21658_24709_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001251453.1|24721_25609_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000045939.1|25601_26255_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_065225494.1|27161_28334_-	nucleotide sugar dehydrogenase	NA	M1IAF7	Acanthocystis_turfacea_Chlorella_virus	49.6	1.8e-99
WP_052318704.1|28365_29511_-	alginate export family protein	NA	NA	NA	NA	NA
WP_001355418.1|29687_30701_-	phosphotransferase	NA	NA	NA	NA	NA
WP_000930903.1|30675_31962_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000834219.1|31951_33766_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.9e-55
WP_065225495.1|33755_34925_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042966208.1|34921_36157_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_050541220.1|36179_37340_-	glycosyl transferase family 28	NA	NA	NA	NA	NA
WP_047084852.1|38418_42258_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	34.5	1.2e-171
WP_065225504.1|42294_43167_-	fimbrial	NA	NA	NA	NA	NA
WP_097467459.1|44040_44676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966204.1|44742_45516_-	F4 (K88) fimbria accessory protein FaeJ	NA	NA	NA	NA	NA
WP_042966203.1|45532_46297_-	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_042966202.1|46327_47125_-	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_065225496.1|47322_48102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966200.1|48333_48825_-	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_042966198.1|48859_49636_-	F4 (K88) fimbrial chaperone FaeE	NA	NA	NA	NA	NA
WP_097759614.1|49628_52031_-	F4 (K88) fimbrial usher FaeD	NA	NA	NA	NA	NA
WP_047084850.1|52087_52624_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_042966194.1|52811_53636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042966193.1|54166_55015_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149025500.1|55349_55646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137792.1|57878_58208_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957246.1|58194_58575_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065225500.1|58617_60201_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.8	8.4e-76
WP_000877738.1|60214_60358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752648.1|61290_61653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312332.1|61652_62285_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.1e-29
WP_021517434.1|63826_64804_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	7.9e-101
WP_001066958.1|65088_65829_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000586177.1|67404_68571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870678.1|69979_70588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024212275.1|70659_71256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359998.1|71566_72652_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065224993.1|73031_74063_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000029852.1|75877_78409_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	1.9e-93
WP_001363971.1|78412_81817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032287317.1|81823_82426_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001154663.1|85782_87135_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000202244.1|87153_87705_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001031758.1|87712_88789_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032194046.1|88792_89092_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000132334.1|89107_89569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361984.1|89579_91562_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.9	2.8e-12
WP_001173972.1|91569_92505_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001037841.1|92495_94298_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000555551.1|94290_94713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166215.1|94722_95235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156834.1|95244_96723_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000072548.1|96725_97202_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032287374.1|97739_97961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220565.1|101851_102133_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
101518:101543	attR	TGTCAACGCCACGATGTTTGACCGTT	NA	NA	NA	NA
WP_000121742.1|102122_102374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166190.1|102648_103668_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085948398.1|104187_105298_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.9e-42
WP_000269721.1|106350_106971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348341.1|107627_108137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148713600.1|108768_109170_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557618.1|109102_109360_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000704517.1|110019_110880_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	24.1	2.8e-09
WP_136752748.1|111133_111343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001364036.1|112396_113884_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_085948397.1|114121_114815_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_001179712.1|115695_116700_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001081196.1|118763_119045_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_024166187.1|119053_119335_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	44.1	1.3e-19
WP_000074142.1|120855_121011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065224993.1|121618_122650_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071961352.1|122698_122905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052319587.1|122912_123314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065275641.1|123411_127230_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	34.3	5.7e-195
WP_000086537.1|128348_128939_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	4.3e-25
WP_065225489.1|129099_132084_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	2.3e-300
WP_136759862.1|132080_132371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090730.1|133423_133888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136759863.1|134166_135207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829162.1|136207_137065_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001364037.1|137057_137132_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083838.1|137375_137624_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|137907_138057_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000455478.1|138312_138777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766788.1|138931_139522_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001355319.1|139559_139769_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001364091.1|140096_140309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139355.1|140443_141004_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000429592.1|141058_141796_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.1	3.1e-09
WP_000447372.1|141817_142249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986971.1|142297_147568_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450526.1|147649_147877_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911316.1|147876_148275_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP012499	Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence	223952	181012	189800	223952	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
WP_065225491.1|181012_182584_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000624622.1|182603_182951_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_040091510.1|182950_183601_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_001312861.1|183921_184080_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001355331.1|184159_184348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116353.1|184359_185079_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845944.1|185075_185510_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117198.1|185578_187543_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.9	2.1e-20
WP_000005990.1|187606_187840_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290856.1|187897_188350_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	58.6	1.4e-44
WP_001364033.1|189236_189800_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	42.1	7.4e-19
