The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	970157	1029800	4731493	integrase,tRNA,transposase,tail,terminase,holin	Shigella_phage(44.0%)	59	1019018:1019073	1034897:1034952
WP_000635543.1|970157_970580_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239183.1|970593_971304_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001301405.1|971503_972328_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|972380_974099_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|974209_974917_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|974913_975318_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|975435_976251_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|976290_976944_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|976936_977968_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|978155_978728_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997050.1|984492_985296_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_000648577.1|985292_986207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|986447_987248_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|987922_989281_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052717.1|989352_990108_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|990141_990864_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|990860_991328_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|991392_992124_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_001053631.1|992662_993448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071940946.1|994412_994784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065273848.1|995214_996351_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_065273849.1|996391_997162_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|997315_997789_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_065273850.1|997831_1000276_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|1000515_1001094_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|1001299_1002067_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1002037_1002778_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615981.1|1002933_1003212_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|1003214_1003475_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001353765.1|1003660_1004434_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000006260.1|1004609_1005107_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001301256.1|1005322_1007062_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207564.1|1007006_1007792_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1007862_1008918_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1008969_1009263_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263493.1|1009265_1009664_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059847.1|1009673_1010126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|1011151_1012609_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1012869_1013328_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|1013419_1014664_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|1014721_1015123_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1015161_1016217_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1016504_1017608_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893272.1|1017619_1018873_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
1019018:1019073	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
WP_000051887.1|1019077_1020241_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206058.1|1020467_1020812_-	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_001371726.1|1020808_1021687_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	1.1e-165
WP_001371719.1|1021677_1022214_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_000081287.1|1022341_1023166_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_065273978.1|1023327_1023678_+	antitermination protein	NA	S5FKQ9	Shigella_phage	96.8	1.9e-44
WP_024190639.1|1023681_1024266_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	100.0	4.9e-98
WP_004030019.1|1024273_1025296_-	hypothetical protein	NA	S5FNT5	Shigella_phage	100.0	8.6e-191
WP_001120493.1|1025581_1025908_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	100.0	2.3e-57
WP_001148536.1|1025911_1026388_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	100.0	4.4e-89
WP_001356120.1|1026371_1026764_+	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	100.0	1.5e-63
WP_000634417.1|1026987_1027899_+	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	100.0	2.4e-115
WP_001135226.1|1027974_1028325_+	HNH endonuclease	NA	S5FKR6	Shigella_phage	100.0	2.5e-65
WP_065273851.1|1028450_1028945_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	7.3e-87
WP_023351511.1|1029350_1029800_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.8	2.9e-50
1034897:1034952	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
>prophage 2
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	1197459	1324606	4731493	integrase,tRNA,transposase,tail,protease,portal	Enterobacteria_phage(30.3%)	111	1297737:1297752	1329383:1329398
WP_000130305.1|1197459_1198734_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1198921_1201276_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1201484_1201757_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_000969378.1|1201948_1203820_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000680290.1|1203970_1204342_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001194534.1|1204447_1204846_+	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
WP_000817236.1|1204897_1205593_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
WP_001238194.1|1205657_1207358_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113027.1|1207457_1208276_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_000884589.1|1208428_1208887_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_065273855.1|1208916_1210689_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	9.8e-49
WP_001256174.1|1210681_1212463_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_000780338.1|1212643_1212982_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000685032.1|1213011_1214298_+	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_000075876.1|1214346_1215207_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000779826.1|1215424_1215997_+	lipoprotein	NA	NA	NA	NA	NA
WP_000409911.1|1216027_1216339_-	MGMT family protein	NA	NA	NA	NA	NA
WP_000878140.1|1216717_1217071_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_001319841.1|1217112_1218663_-	cyclic-guanylate-specific phosphodiesterase PdeB	NA	NA	NA	NA	NA
WP_000136192.1|1218826_1219297_-	YlaC family protein	NA	NA	NA	NA	NA
WP_000102564.1|1219412_1219964_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_001291435.1|1220135_1220354_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000344800.1|1220379_1220754_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_065273856.1|1221299_1224449_-	efflux RND transporter permease AcrB	NA	S5VTK5	Leptospira_phage	23.9	1.1e-53
WP_065273857.1|1224471_1225665_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_000101737.1|1225806_1226454_+	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_000177732.1|1226581_1229944_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_000051153.1|1230155_1230317_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000844874.1|1230330_1230858_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_001188905.1|1230927_1231305_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127356.1|1231457_1232009_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|1232137_1234069_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1234121_1234451_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1234450_1235056_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1235165_1237040_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1237220_1237865_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|1238100_1239063_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801849.1|1239059_1240019_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.2e-15
WP_000671574.1|1240170_1241475_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_000546237.1|1241607_1243284_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_001251610.1|1243521_1244742_-	fosmidomycin MFS transporter	NA	NA	NA	NA	NA
WP_000771748.1|1244959_1246612_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000186631.1|1246648_1247128_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365173.1|1247331_1248126_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_000806442.1|1248263_1248605_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|1249021_1251526_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_170988445.1|1252531_1252861_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_065273858.1|1252839_1253973_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	71.5	2.2e-147
WP_065273859.1|1254136_1255318_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	84.8	1.9e-189
WP_065273860.1|1255318_1255834_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.1	4.1e-56
WP_065273861.1|1255880_1256297_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	50.0	1.2e-13
WP_065273862.1|1256302_1256461_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	61.7	3.3e-09
WP_065273863.1|1256447_1259498_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	34.4	4.6e-123
WP_032201606.1|1259511_1259970_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	77.6	1.6e-64
WP_032201605.1|1261293_1262343_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	77.5	1.4e-159
WP_001300563.1|1262969_1264082_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001068330.1|1264289_1264787_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_032201984.1|1264826_1265669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211280.1|1265752_1266067_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_032201983.1|1266071_1267031_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	2.1e-178
WP_032201981.1|1267882_1268182_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	61.6	3.2e-29
WP_032201980.1|1268251_1269268_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	46.1	7.7e-83
WP_000883034.1|1269545_1270478_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982170.1|1270480_1271773_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|1271897_1272305_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970309.1|1272305_1272764_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|1272760_1273678_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157551.1|1273823_1274501_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001295323.1|1274487_1275267_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001300573.1|1275329_1276184_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|1276244_1277054_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1277043_1277667_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1277637_1278324_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561803.1|1278320_1280735_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065273864.1|1281164_1285445_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1285484_1285853_+	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_187703276.1|1285852_1286005_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_001310616.1|1286029_1286563_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_001320180.1|1286543_1286804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|1286860_1287034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1288034_1289129_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1289197_1290124_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1290353_1290836_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1290913_1291729_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1291818_1293600_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000765842.1|1295265_1296144_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
1297737:1297752	attL	AAAAACAGGAGAGCAA	NA	NA	NA	NA
WP_000006899.1|1297826_1299188_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|1299244_1300546_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|1300567_1301713_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540946.1|1301940_1302726_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|1302736_1303972_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703906.1|1303993_1305043_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_065273866.1|1305359_1307027_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495379.1|1307036_1308296_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001301143.1|1308306_1309122_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|1309118_1310012_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815553.1|1310148_1311216_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1311212_1311722_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212242.1|1311839_1312562_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1312564_1313059_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1313232_1314618_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143561.1|1314653_1315175_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1315282_1315495_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1315496_1316363_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1316833_1317376_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1317595_1318288_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001318685.1|1318318_1320928_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1320906_1321947_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255228.1|1321957_1322473_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|1322475_1323108_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_065273867.1|1323442_1324606_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	85.8	1.1e-197
1329383:1329398	attR	AAAAACAGGAGAGCAA	NA	NA	NA	NA
>prophage 3
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	1330869	1371350	4731493	protease,transposase,lysis	Enterobacteria_phage(56.25%)	37	NA	NA
WP_001054340.1|1330869_1331325_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224907.1|1331324_1331495_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774479.1|1331487_1331778_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099655.1|1331774_1332137_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000971071.1|1332133_1332274_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001204780.1|1332359_1332743_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_065273868.1|1332932_1334015_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	4.6e-166
WP_000839596.1|1334603_1334819_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|1334818_1335316_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|1335532_1335715_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1335805_1336099_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|1336460_1336655_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000355602.1|1337286_1337580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|1338255_1339005_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|1339253_1340207_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_065273870.1|1340720_1341482_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224575.1|1341664_1342555_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_065273871.1|1342555_1345528_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000420970.1|1348022_1349159_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001300892.1|1350123_1350285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889443.1|1350410_1350671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898501.1|1350703_1351123_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.1	4.8e-15
WP_000253838.1|1353447_1354896_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|1354885_1355569_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000074253.1|1355725_1357099_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709865.1|1357256_1357589_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|1357604_1358828_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573928.1|1358839_1361983_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
WP_000786310.1|1362084_1363461_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153155.1|1363528_1364776_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351477.1|1364883_1365537_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1365630_1365999_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682514.1|1366063_1366312_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130654.1|1366377_1367496_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_105929221.1|1369782_1369911_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	3.3e-15
WP_000956455.1|1370008_1370161_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1370237_1371350_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	1565669	1576993	4731493	integrase,terminase,tail	Escherichia_phage(45.45%)	13	1563418:1563432	1569451:1569465
1563418:1563432	attL	CATTAAAGACTGGCC	NA	NA	NA	NA
WP_000533643.1|1565669_1566740_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|1566717_1566936_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545729.1|1566975_1567143_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
WP_000002107.1|1567215_1567500_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000376718.1|1567492_1567777_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
WP_000113283.1|1568286_1568472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472362.1|1568604_1569219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218995.1|1569172_1569724_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
1569451:1569465	attR	CATTAAAGACTGGCC	NA	NA	NA	NA
WP_001130801.1|1569726_1571349_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_001104982.1|1572617_1573013_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
WP_000204789.1|1573054_1574080_-	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
WP_000394418.1|1574472_1575810_+	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
WP_000603805.1|1575847_1576993_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
>prophage 5
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2160028	2184795	4731493	integrase,tRNA,lysis,tail	Escherichia_phage(38.46%)	32	2154413:2154428	2177024:2177039
2154413:2154428	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001301114.1|2160028_2161261_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
WP_000387388.1|2161515_2162499_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2162976_2164350_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2164478_2165414_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040858.1|2165465_2166701_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|2166702_2166918_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2166996_2167206_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2167198_2167393_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2167449_2168259_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105139.1|2168251_2170852_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000632297.1|2170953_2171229_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2171303_2171474_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_032201602.1|2171473_2171695_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	1.3e-35
WP_001312793.1|2172136_2172625_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2172621_2172777_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_012775985.1|2172920_2173133_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	96.9	3.0e-29
WP_000193293.1|2173137_2173482_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370546.1|2173447_2173720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|2173825_2174359_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001228696.1|2174575_2174761_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097897.1|2174957_2176415_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291101.1|2176552_2176984_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
WP_000770037.1|2177088_2177853_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
2177024:2177039	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_024182056.1|2178152_2180177_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
WP_000654171.1|2180173_2180452_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
WP_000355360.1|2180464_2180758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065273887.1|2180985_2181576_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.1e-24
WP_000836768.1|2181892_2182126_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2182194_2182308_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|2182647_2182821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|2183086_2183521_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837924.1|2183661_2184795_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 6
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2353522	2377015	4731493	transposase,tail,lysis	Escherichia_phage(25.0%)	29	NA	NA
WP_000527826.1|2353522_2354983_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
WP_120795384.1|2356958_2357072_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2357140_2357374_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2357690_2358281_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355603.1|2358508_2358802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235975.1|2358812_2359517_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_001205170.1|2359526_2359808_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
WP_000741760.1|2359807_2362186_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
WP_001230558.1|2362250_2362850_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
WP_085947771.1|2364285_2365447_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000780584.1|2365817_2366342_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|2366497_2366875_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265279.1|2366892_2367543_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
WP_012775982.1|2367544_2367823_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000981003.1|2367889_2368141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|2368357_2368570_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_021568046.1|2369125_2369791_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001366387.1|2369844_2370078_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001151183.1|2370074_2370497_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_000054497.1|2370537_2371503_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705360.1|2371483_2372005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|2371988_2372216_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2372296_2372704_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|2372872_2373025_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241299.1|2373024_2373402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|2373370_2373571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854560.1|2374073_2374262_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083270.1|2374258_2374450_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048322.1|2374543_2377015_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
>prophage 7
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2739793	2815359	4731493	integrase,capsid,transposase,tail,protease,head,portal,terminase,holin	Escherichia_phage(56.6%)	94	2792508:2792523	2822283:2822298
WP_065273901.1|2739793_2740957_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.2	1.4e-197
WP_000879835.1|2742369_2743167_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2743176_2743728_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2743896_2744229_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274294.1|2744562_2744877_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994427.1|2745091_2746750_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067969.1|2746742_2747738_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2747730_2748417_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2748416_2749790_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2749808_2750252_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620109.1|2750248_2751376_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2751480_2751945_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2751949_2752954_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2752950_2753364_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295640.1|2753366_2753732_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2753731_2754469_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2754478_2754748_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|2754756_2755542_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000104004.1|2755831_2756455_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2756498_2756687_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2756849_2757077_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491497.1|2757374_2758190_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077260514.1|2758186_2759881_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	7.7e-19
WP_000009306.1|2760118_2760301_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2760379_2761297_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_065273902.1|2761470_2762391_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786015.1|2762379_2762850_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	9.9e-33
WP_001157219.1|2762830_2764249_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.5e-100
WP_000365562.1|2764315_2765011_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_077763240.1|2765050_2765416_-	permease	NA	NA	NA	NA	NA
WP_000826748.1|2767079_2768438_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2768437_2769109_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2769241_2769655_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740094.1|2769763_2770768_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240102.1|2770768_2771404_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007789.1|2771660_2772311_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2772653_2773184_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_065273903.1|2774163_2774451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089634424.1|2774461_2774692_-|tail	phage tail protein	tail	A0A1X7QGH6	Escherichia_phage	63.1	1.3e-17
WP_000654160.1|2775175_2775457_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	5.9e-17
WP_065273904.1|2775456_2777862_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	8.3e-160
WP_065273905.1|2777926_2778526_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	3.8e-106
WP_065273906.1|2778593_2782073_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_077883719.1|2782133_2782781_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032150599.1|2782678_2783422_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	2.1e-146
WP_021555261.1|2783427_2784126_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.2e-130
WP_025237232.1|2784125_2784467_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	2.1e-40
WP_065273908.1|2784459_2787672_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.8	0.0e+00
WP_071605788.1|2787721_2788063_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	41.1	4.4e-06
WP_001406803.1|2788121_2788400_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	87.6	4.8e-35
WP_065273909.1|2788423_2788795_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	98.4	2.7e-62
WP_065273910.1|2788809_2789514_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	98.7	7.2e-120
WP_001209399.1|2789574_2789919_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2789915_2790362_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001147820.1|2790361_2790700_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2790708_2791014_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_042631000.1|2791025_2791214_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	2.7e-26
WP_042631001.1|2791264_2792470_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	5.9e-223
WP_065273911.1|2792484_2793135_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	9.5e-119
2792508:2792523	attL	CATTCAGTGCAGAGCC	NA	NA	NA	NA
WP_000466258.1|2793112_2794354_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_000478568.1|2794353_2794536_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	100.0	1.3e-25
WP_001140882.1|2794547_2796305_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	100.0	0.0e+00
WP_024246396.1|2796304_2796787_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	4.3e-84
WP_001111090.1|2796934_2797285_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_001532432.1|2797423_2797963_+	YfbU family protein	NA	NA	NA	NA	NA
WP_001100260.1|2797968_2798235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|2798452_2798638_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000991413.1|2798854_2799388_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	5.3e-99
WP_000193280.1|2799451_2799802_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|2799806_2800022_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064896.1|2800834_2801524_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_000139992.1|2801520_2801886_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_065273912.1|2801886_2802942_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	3.4e-89
WP_065273913.1|2802943_2803222_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000687435.1|2803288_2803549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902693.1|2803769_2803982_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_065273914.1|2804467_2804983_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.4	2.5e-37
WP_187703275.1|2804979_2805156_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224672.1|2805148_2805331_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000403777.1|2805424_2805781_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_068862916.1|2805758_2806250_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	75.9	1.9e-50
WP_065273915.1|2806265_2807036_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.8	8.4e-90
WP_157917639.1|2807068_2807611_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	4.4e-85
WP_065273916.1|2807522_2808563_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	5.1e-90
WP_000705377.1|2808534_2809086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|2809069_2809300_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379971.1|2809383_2809791_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_044502262.1|2810018_2810318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171939.1|2810389_2810608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2811175_2811364_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_063103131.1|2811360_2811552_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_065273918.1|2811645_2814072_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.9	4.1e-114
WP_000096344.1|2814130_2814334_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_065273919.1|2814333_2815359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	5.8e-102
2822283:2822298	attR	CATTCAGTGCAGAGCC	NA	NA	NA	NA
>prophage 8
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2871823	2880680	4731493		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000998544.1|2871823_2872936_-	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
WP_001060533.1|2872945_2874370_-	O7 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100801.1|2874373_2874919_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
WP_000857508.1|2874923_2875802_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001023616.1|2875860_2876760_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000699450.1|2876759_2877845_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_000183060.1|2878217_2879111_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|2879285_2880680_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 9
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2927548	2937023	4731493	portal,tRNA,plate,tail	Escherichia_phage(54.55%)	13	NA	NA
WP_000675150.1|2927548_2928952_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2928948_2929671_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2929861_2930194_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2930340_2931702_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|2931974_2932193_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_077883723.1|2932705_2932846_-|plate	baseplate J family domain protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	4.1e-11
WP_000127144.1|2932850_2933198_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
WP_001093750.1|2933194_2933830_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000490543.1|2933913_2934699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001787.1|2934770_2935223_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_000917158.1|2935215_2935683_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_001300730.1|2935645_2935819_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_149025621.1|2936051_2937023_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	5.5e-187
>prophage 10
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2941116	2948865	4731493	integrase	Salmonella_phage(36.36%)	12	2935010:2935023	2950488:2950501
2935010:2935023	attL	TTTTTCGCTTAACG	NA	NA	NA	NA
WP_065273924.1|2941116_2943399_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2943388_2943664_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113266.1|2943660_2943885_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_001277898.1|2943887_2944187_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557697.1|2944186_2944411_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
WP_000217677.1|2944474_2944975_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|2944971_2945142_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2945152_2945428_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2945549_2945849_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|2945964_2946978_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001318299.1|2947243_2947561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807361.1|2947965_2948865_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
2950488:2950501	attR	TTTTTCGCTTAACG	NA	NA	NA	NA
>prophage 11
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	2982549	2991991	4731493		Enterobacteria_phage(85.71%)	10	NA	NA
WP_032201414.1|2982549_2983686_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	7.2e-162
WP_001300967.1|2983682_2985683_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001296231.1|2985807_2986269_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2986309_2986780_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2986826_2987546_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2987542_2989228_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240403.1|2989449_2990181_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216966.1|2990240_2990348_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2990328_2991060_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569344.1|2991064_2991991_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 12
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	3237196	3244007	4731493	integrase,tail	Salmonella_phage(50.0%)	7	3227309:3227322	3244858:3244871
3227309:3227322	attL	TTTCCGAATGAAAG	NA	NA	NA	NA
WP_000368117.1|3237196_3238129_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
WP_065273932.1|3238440_3239598_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.7	9.1e-221
WP_064238119.1|3239689_3239977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065273933.1|3239977_3242563_-|tail	tail fiber domain-containing protein	tail	A0A0A0YWB2	Escherichia_phage	31.6	1.7e-78
WP_001085430.1|3243094_3243274_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757525.1|3243287_3243653_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
WP_065273934.1|3243683_3244007_+	hypothetical protein	NA	B9UDL2	Salmonella_phage	100.0	8.3e-15
3244858:3244871	attR	TTTCCGAATGAAAG	NA	NA	NA	NA
>prophage 13
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	3476680	3564390	4731493	integrase,capsid,tRNA,tail,protease,head,plate,portal,terminase,holin	Shigella_phage(40.32%)	99	3554395:3554409	3565075:3565089
WP_001295363.1|3476680_3477418_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|3477549_3478884_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|3479092_3479974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189210.1|3480076_3480664_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3480719_3481103_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262713.1|3481407_3482097_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000997403.1|3482144_3483182_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001301152.1|3483877_3484576_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000083015.1|3484607_3487268_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3487381_3488737_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012138968.1|3488782_3489106_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3489102_3490401_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3496169_3498743_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040127.1|3498872_3499604_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|3499600_3500581_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3500715_3501453_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3501723_3502065_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3502168_3502216_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200120.1|3502313_3503474_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3503516_3504638_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3504648_3505719_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3505928_3506294_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3506443_3506962_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969010.1|3506951_3508178_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3508193_3508676_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3508751_3509099_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3509140_3509908_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3509938_3510487_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3510505_3510754_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3510890_3512252_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3512418_3513210_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077260525.1|3513230_3514517_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3514571_3515165_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3515287_3516166_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880909.1|3516251_3517913_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3518061_3518403_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3518464_3518755_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3518744_3519221_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3519352_3519835_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|3520640_3521855_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|3521889_3523293_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000355484.1|3523726_3524500_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904961.1|3524560_3525115_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	1.5e-88
WP_065273942.1|3525144_3525684_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.0	6.6e-57
WP_065273943.1|3525683_3526286_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.5	2.7e-99
WP_032349848.1|3526257_3526698_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.9e-44
WP_021549527.1|3526699_3527299_-	hypothetical protein	NA	U5P0I1	Shigella_phage	57.6	1.6e-51
WP_065273944.1|3527302_3527887_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.2e-113
WP_065273945.1|3527877_3528936_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.2	4.4e-198
WP_065273946.1|3528922_3529348_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	3.3e-80
WP_001259079.1|3529347_3529896_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000999518.1|3529895_3530975_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|3530971_3532300_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_065273947.1|3532360_3534196_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	3.8e-306
WP_000661054.1|3534337_3534607_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|3534606_3534963_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_001519512.1|3534962_3536459_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	3.8e-272
WP_000497751.1|3536442_3536613_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|3536621_3537182_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|3537178_3537685_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702389.1|3537659_3538070_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	6.1e-71
WP_000927711.1|3538066_3538390_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601365.1|3538392_3538593_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257506.1|3538642_3539848_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_028126002.1|3539862_3540513_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_065273948.1|3540490_3541732_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	5.0e-241
WP_000605606.1|3541731_3541914_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_123160962.1|3541925_3543422_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	3.7e-299
WP_065273950.1|3543655_3544150_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	8.6e-88
WP_021519684.1|3544275_3544626_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_021519683.1|3544683_3545190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032193237.1|3545527_3545920_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	82.9	1.3e-49
WP_016236818.1|3545903_3546380_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	94.3	1.5e-84
WP_001120496.1|3546383_3546710_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001037093.1|3547044_3547563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163087.1|3547568_3548453_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001205472.1|3548474_3548822_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	9.4e-57
WP_065273951.1|3548839_3549829_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	3.6e-194
WP_001061404.1|3549836_3550634_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767105.1|3550653_3551043_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210170.1|3551039_3551366_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001355692.1|3551362_3552016_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_072176118.1|3552015_3552510_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_000104954.1|3552506_3553448_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3553437_3553617_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3553792_3554344_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3554381_3554582_-	cell division protein	NA	NA	NA	NA	NA
3554395:3554409	attL	TTTTCATAAAGCTCA	NA	NA	NA	NA
WP_000450735.1|3554679_3555306_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3555491_3555788_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|3556388_3556751_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3556816_3557641_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_065273952.1|3557768_3558305_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	1.1e-99
WP_016244999.1|3558295_3558658_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	95.8	2.0e-65
WP_001331173.1|3558654_3558870_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|3558929_3559136_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_052908002.1|3559096_3560269_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	1.5e-146
WP_127490476.1|3560310_3561090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062342.1|3561321_3562551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_000135616.1|3562833_3564390_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
3565075:3565089	attR	TGAGCTTTATGAAAA	NA	NA	NA	NA
>prophage 14
NZ_CP013031	Escherichia coli strain H1827/12 chromosome, complete genome	4731493	3635857	3649040	4731493		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|3635857_3638419_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141307.1|3638524_3639181_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001295181.1|3639231_3639999_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847971.1|3640194_3641103_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590386.1|3641099_3642362_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.7	1.3e-135
WP_001278994.1|3642358_3642997_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|3643001_3643778_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_065273953.1|3643866_3645231_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3645324_3646317_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3646379_3647519_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3647658_3648285_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3648278_3649040_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
