The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	198514	260839	5286558	tRNA,protease,transposase,plate	Emiliania_huxleyi_virus(12.5%)	50	NA	NA
WP_001295561.1|198514_199867_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|199896_202329_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202450_202936_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|202939_203965_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204069_204525_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204528_205317_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_065225506.1|205316_206465_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206461_207058_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_033817192.1|207094_210577_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	7.4e-210
WP_000055741.1|210589_211549_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_065225507.1|211647_213789_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213845_214235_+	VOC family protein	NA	NA	NA	NA	NA
WP_001676327.1|214299_215598_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|215646_215907_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|215893_216094_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|216259_216805_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216801_217224_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217237_217948_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|218197_219178_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|220258_221977_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222088_222796_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222792_223197_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|223314_224130_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224169_224823_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224815_225847_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226034_226610_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|232496_233300_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|233296_234211_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234451_235252_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211729.1|235329_236100_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236147_237506_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|237577_238333_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|238366_239089_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239085_239553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239617_240349_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240888_241674_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241810_242290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|242299_243214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243257_243740_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|243763_245116_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122985538.1|245126_248561_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|248669_250082_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|250086_250830_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|250826_253592_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000246437.1|254365_255697_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255699_256224_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|256220_257501_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|257525_258608_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|258571_260422_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260425_260839_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	301566	396263	5286558	integrase,tail,holin,portal,protease,transposase,head,capsid,terminase	Enterobacteria_phage(41.27%)	100	304105:304121	374901:374917
WP_000749881.1|301566_302622_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|302909_304013_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|304024_305278_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
304105:304121	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051890.1|305482_306646_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	4.5e-228
WP_000206811.1|306872_307178_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001242715.1|307177_307540_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_040091282.1|307530_308067_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-99
WP_000081301.1|308195_309020_-	YfdQ family protein	NA	A5LH63	Enterobacteria_phage	100.0	2.7e-150
WP_000135680.1|309085_309448_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|310048_310345_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000888566.1|310795_311080_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	46.8	4.0e-13
WP_000135661.1|311147_311495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023145979.1|311510_312215_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.0	2.2e-68
WP_000098317.1|312322_312586_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_001524090.1|312614_313166_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	9.9e-101
WP_065225511.1|313162_314326_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	81.1	2.1e-169
WP_000620689.1|314322_314547_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_065225512.1|314543_315368_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_052934070.1|315364_315853_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.2e-86
WP_000210170.1|315852_316179_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_065225513.1|316175_316496_+	RusA family crossover junction endodeoxyribonuclease	NA	S5MDR3	Escherichia_phage	93.9	7.4e-48
WP_001300563.1|316508_317621_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001072669.1|318071_318887_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_052934278.1|318902_319418_+	hypothetical protein	NA	V5URU3	Shigella_phage	30.0	3.5e-15
WP_052934279.1|319427_320417_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001204819.1|320434_320800_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038608.1|320885_321332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917725.1|321601_321805_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_052934280.1|321955_323014_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	86.0	4.2e-180
WP_000466935.1|323482_323908_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	2.5e-59
WP_000833650.1|323904_324057_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000839572.1|324168_324384_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193267.1|324388_324739_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.4e-37
WP_042965844.1|324802_325336_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.5e-101
WP_001208684.1|325552_325759_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_040091510.1|326802_327453_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.8e-16
WP_000624622.1|327452_327800_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_065225491.1|327819_329391_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000453587.1|329430_329976_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_065225514.1|329950_331876_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|331872_332079_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_065225515.1|332075_333677_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.6e-308
WP_065225516.1|333657_334977_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.1e-235
WP_065225517.1|334986_335319_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	8.4e-55
WP_065225518.1|335374_336400_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.0e-191
WP_042966659.1|336441_336837_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	7.7e-55
WP_065225519.1|336848_337202_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	2.9e-61
WP_001541219.1|337213_337792_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683105.1|337788_338184_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_042966661.1|338191_338932_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000479169.1|338947_339370_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|339351_339786_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_065225520.1|339778_342358_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.1	0.0e+00
WP_000847418.1|342354_342684_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_001152619.1|342683_343382_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_024210569.1|343387_344131_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.3e-143
WP_001351519.1|344067_344700_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_065225521.1|344760_348459_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.9	0.0e+00
WP_001228274.1|348526_349126_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_065225522.1|349190_351281_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.3	1.4e-91
WP_000701861.1|351295_351874_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	1.5e-51
WP_001265343.1|352154_352391_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	85.1	3.0e-14
WP_040091579.1|352574_354059_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201832.1|354245_355199_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361111.1|355697_356282_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001364131.1|356306_356744_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001111349.1|357267_357678_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121356.1|357656_358613_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001583225.1|358622_360821_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
WP_000643328.1|360817_361774_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070694.1|361770_362460_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|362877_363492_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|363739_364069_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001305432.1|364381_365092_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001330883.1|365060_366704_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131077.1|366693_369219_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716392.1|369244_369913_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|369970_370558_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001296902.1|370632_371175_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147277.1|371997_372225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|372259_372400_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|372399_372663_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|373025_373127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092556.1|374242_378496_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
374901:374917	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000621018.1|378616_379474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299025.1|379722_380592_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|380751_381345_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474074.1|381356_381593_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|381701_383027_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000339587.1|383252_384107_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102115.1|384636_385356_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023910.1|385366_386794_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370308.1|386786_387482_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209098.1|387727_388393_-	membrane protein	NA	NA	NA	NA	NA
WP_071593451.1|388576_389770_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001406334.1|390915_391677_-	protein HyxA	NA	NA	NA	NA	NA
WP_001406335.1|391693_391834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315275.1|391830_392625_-	LuxR family transcriptional regulator HyxR	NA	NA	NA	NA	NA
WP_001295805.1|392954_393518_-	tyrosine-type DNA invertase FimX	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_065225523.1|394592_396263_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 3
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	633072	733215	5286558	integrase,tail,portal,protease,transposase,lysis,head,tRNA,capsid,terminase	Enterobacteria_phage(56.67%)	101	643234:643280	690606:690652
WP_000912345.1|633072_634458_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|634493_635015_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|635122_635335_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|635336_636203_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|636683_637226_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988375.1|637445_638138_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001306954.1|638168_640778_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|640790_641798_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|641808_642324_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|642326_642959_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
643234:643280	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001361259.1|643293_644457_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|644655_644934_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|644981_645200_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_077758593.1|645298_645580_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000129285.1|645590_646148_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|646140_646302_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186778.1|646298_646979_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_047675702.1|646975_647761_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	4.1e-148
WP_000995439.1|647766_648063_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_023148105.1|648138_648429_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_065225529.1|648825_649206_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000858975.1|649435_650125_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067459.1|650229_650460_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_001182868.1|650529_651069_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_000147928.1|651065_652085_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	1.1e-110
WP_000788917.1|652081_652783_+	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	3.5e-127
WP_000145897.1|652779_652953_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	89.1	2.1e-20
WP_001224616.1|653099_653594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379696.1|654223_654424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141579.1|654532_654634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053012.1|654630_655086_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_000224907.1|655085_655256_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774486.1|655248_655539_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_063083419.1|655535_655898_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	3.6e-59
WP_032145910.1|655894_656035_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|656120_656504_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737283.1|656693_657791_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|658379_658595_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|658594_659092_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|659308_659491_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|659581_659875_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|660165_660576_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|660861_661068_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_085947771.1|661159_662321_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001421937.1|662493_662688_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000867568.1|663076_663625_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_065225530.1|663596_665525_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.7e-259
WP_000259002.1|665508_665715_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831760.1|665711_667304_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253910.1|667293_668799_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_065225531.1|668835_669183_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522651.1|669240_670269_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|670320_670695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|670687_671041_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_065225532.1|671052_671631_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_065225533.1|671627_672023_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.7e-70
WP_001345558.1|672030_672771_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_065225534.1|672786_673209_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	5.7e-72
WP_000459457.1|673190_673625_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032361402.1|673617_676179_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.7	0.0e+00
WP_000847401.1|676175_676505_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152620.1|676504_677203_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_065225535.1|677208_677952_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_071961355.1|677888_678521_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.9e-96
WP_065225537.1|678581_681980_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001230388.1|682046_682646_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_071961364.1|682710_686061_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_065225538.1|686060_686645_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	5.6e-102
WP_071961356.1|686699_687359_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|688229_688979_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|689228_690182_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|690695_691457_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
690606:690652	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|691639_692530_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662373.1|692530_695503_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001402085.1|695489_697727_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_004021921.1|697995_699132_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001299580.1|699235_699547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|699661_699871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892558.1|699909_701244_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	2.5e-20
WP_106376274.1|701807_701960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103752.1|702012_702546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687356.1|707225_707657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225540.1|707668_712510_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	30.8	3.5e-16
WP_001160804.1|712529_712991_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103243.1|713018_714920_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_000253830.1|715656_717105_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|717094_717778_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000074237.1|717934_719317_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709865.1|719340_719673_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717163.1|719688_720912_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|720923_724067_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786320.1|724168_725545_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153146.1|725612_726860_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351464.1|726967_727621_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|727714_728083_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|728147_728396_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130622.1|728461_729580_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956456.1|730021_730174_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|730250_731363_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956465.1|731873_732026_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|732102_733215_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1046260	1059437	5286558	integrase,protease,head,capsid,terminase	uncultured_Caudovirales_phage(28.57%)	15	1033005:1033019	1056872:1056886
1033005:1033019	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_042966296.1|1046260_1047499_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	51.0	3.5e-122
WP_001302637.1|1047915_1048125_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
WP_123017625.1|1048134_1049055_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113141.1|1049047_1049368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261502.1|1049374_1049674_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042966300.1|1049670_1051488_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.2	3.4e-129
WP_005153210.1|1051775_1052021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126634.1|1052017_1052440_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228102.1|1052657_1053698_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	7.5e-65
WP_000190777.1|1053707_1054049_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179421.1|1054060_1054444_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_042966308.1|1054645_1055188_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	46.3	1.3e-33
WP_052934388.1|1055439_1055724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|1056809_1057130_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
1056872:1056886	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000934041.1|1057160_1059437_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 5
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1166178	1226924	5286558	integrase,holin,protease,portal,lysis,head,capsid,terminase	Enterobacteria_phage(39.29%)	82	1185645:1185659	1198403:1198417
WP_000375136.1|1166178_1166838_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001295940.1|1167558_1168677_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1168673_1170467_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1170485_1171193_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1171189_1171777_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|1171773_1172172_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1172168_1173026_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_033817114.1|1173159_1174704_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|1174715_1175852_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1175864_1175957_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|1176036_1177335_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208650.1|1177449_1179630_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1179649_1180096_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1180083_1181223_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|1181268_1183365_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1183364_1184111_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1184107_1184752_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1184858_1185164_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1185605_1185818_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
1185645:1185659	attL	GCCATTTACGCGGCA	NA	NA	NA	NA
WP_000066490.1|1186103_1186316_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1186326_1186515_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1186489_1186720_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1186709_1186883_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818476.1|1186930_1188004_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071781693.1|1188075_1190820_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	3.5e-37
WP_065225550.1|1190914_1191988_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	97.8	1.1e-196
WP_001303849.1|1191965_1192184_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_032320906.1|1192224_1192392_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	94.5	1.4e-26
WP_065225551.1|1192492_1192987_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	61.0	3.7e-46
WP_065225552.1|1192989_1193181_-	hypothetical protein	NA	G9L660	Escherichia_phage	95.2	8.9e-25
WP_065225553.1|1193759_1193927_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	7.3e-23
WP_001111280.1|1193937_1194234_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_000168274.1|1194247_1194754_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365278.1|1194754_1195462_-	hypothetical protein	NA	K7PKU3	Enterobacteria_phage	99.6	1.3e-137
WP_001243355.1|1195716_1195869_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1195853_1195985_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001351814.1|1196009_1196978_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	100.0	2.0e-56
WP_065225555.1|1197165_1197615_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	3.7e-69
WP_065225556.1|1197911_1198364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225557.1|1198366_1198675_-	regulator	NA	A0A075B8K6	Enterobacteria_phage	66.7	3.3e-29
1198403:1198417	attR	TGCCGCGTAAATGGC	NA	NA	NA	NA
WP_000394871.1|1199113_1199410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846394.1|1199450_1200158_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	85.1	5.2e-110
WP_001054987.1|1200269_1200494_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000438533.1|1200600_1200897_+	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_001244621.1|1200919_1201192_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_065225558.1|1201254_1202142_+	replication protein	NA	A5VW95	Enterobacteria_phage	95.9	5.8e-143
WP_001248388.1|1202138_1203515_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000736912.1|1203789_1204230_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	100.0	1.2e-80
WP_001046389.1|1204226_1204817_+	hypothetical protein	NA	A0A193GYV6	Enterobacter_phage	76.0	3.3e-86
WP_000679700.1|1204813_1204987_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	91.2	3.9e-27
WP_000113771.1|1204953_1205136_+	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_000566871.1|1205132_1205303_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_001279421.1|1205295_1205565_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000002243.1|1205564_1205855_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008180.1|1205851_1206214_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	100.0	9.2e-63
WP_000994511.1|1206210_1206399_+	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	2.7e-26
WP_065225559.1|1206395_1207019_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.2e-113
WP_000783734.1|1207828_1208152_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1208135_1208612_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_065225560.1|1208608_1209046_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.2	2.5e-70
WP_001139681.1|1209033_1209186_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_047667593.1|1209425_1209806_+	phage family protein	NA	Q716B1	Shigella_phage	97.6	1.6e-65
WP_000807788.1|1209909_1210152_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|1210231_1210657_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000200764.1|1210653_1212066_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	100.0	1.5e-278
WP_032158032.1|1212068_1214195_+|portal	portal protein	portal	Q716H2	Shigella_phage	99.9	0.0e+00
WP_065225561.1|1214208_1215093_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.0	1.2e-143
WP_001133479.1|1215104_1216376_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.8	1.1e-240
WP_000375637.1|1216418_1216604_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246750.1|1216578_1217061_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_065225562.1|1217069_1218488_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.6	8.4e-277
WP_040090627.1|1218487_1219336_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.9	9.6e-103
WP_000614037.1|1219335_1219791_+	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	99.3	8.8e-87
WP_065225563.1|1219793_1220489_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	99.4	4.0e-91
WP_065225564.1|1220499_1221849_+	DNA transfer protein	NA	Q9AYZ0	Salmonella_phage	98.4	1.5e-243
WP_065225565.1|1221848_1224017_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	94.5	0.0e+00
WP_000821345.1|1224112_1224532_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	99.3	3.0e-73
WP_157924994.1|1224576_1224834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000820796.1|1225111_1225429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283828.1|1225425_1225677_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	3.9e-36
WP_021528598.1|1225781_1225928_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	95.8	8.0e-18
WP_065225566.1|1225994_1226924_+	antirepressor	NA	A5VW58	Enterobacteria_phage	90.0	1.6e-159
>prophage 6
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1241018	1304956	5286558	tail,bacteriocin,holin,portal,lysis,capsid,terminase	Escherichia_phage(91.78%)	74	NA	NA
WP_001401545.1|1241018_1242329_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208772.1|1242381_1242666_-	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_000497812.1|1242711_1242963_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000994795.1|1243326_1243716_-	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_001291843.1|1243751_1243964_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|1243923_1244550_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|1244546_1244978_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|1245033_1245663_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|1245912_1246197_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000206786.1|1246552_1247449_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|1247451_1247643_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1247644_1248052_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|1248048_1248774_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|1248924_1249320_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|1249396_1250218_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|1250281_1250629_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|1250703_1251291_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|1251290_1251980_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|1251976_1252927_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1252943_1253225_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|1253245_1253527_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|1253538_1253751_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_001369605.1|1253821_1254496_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|1254751_1255537_-	Rha family phage regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|1256153_1257107_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1257103_1258573_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1258667_1259381_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1259476_1259680_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|1259850_1260045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1260211_1260589_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|1260582_1262103_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|1262092_1263064_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|1263063_1263513_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1263520_1264084_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1264080_1264275_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1264267_1264702_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|1264950_1265103_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1265485_1266445_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1266456_1266726_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|1267211_1269149_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1269285_1269465_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1269505_1269751_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1269828_1270044_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087737.1|1270048_1270582_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001056879.1|1270855_1271425_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000455397.1|1271424_1271574_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_024017835.1|1271576_1272014_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_001109019.1|1272216_1272768_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|1273060_1273867_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1273847_1275554_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|1275553_1277698_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1277855_1278863_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1278886_1280101_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1280156_1280546_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1280595_1281057_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1281040_1281604_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207927.1|1281603_1282254_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000117967.1|1282250_1284443_+|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000513231.1|1284529_1285042_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_001391593.1|1285275_1286901_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1286897_1288166_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1288180_1288459_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1288464_1289082_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1289172_1289907_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1290139_1290280_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1290336_1290738_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|1290831_1291488_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1291490_1291937_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1291946_1292198_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_065225568.1|1292208_1293474_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	99.8	6.9e-206
WP_032347920.1|1293543_1301925_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|1302856_1303030_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240629.1|1303112_1304441_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001028095.1|1304461_1304956_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 7
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1700980	1721786	5286558	integrase	Salmonella_phage(25.0%)	38	1698943:1698957	1706052:1706066
1698943:1698957	attL	CTTCGTCATCCAGTT	NA	NA	NA	NA
WP_000945005.1|1700980_1701496_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
WP_077883690.1|1701714_1702950_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	45.4	1.4e-97
WP_053890945.1|1702907_1703126_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	44.3	9.2e-10
WP_077883691.1|1703125_1703776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169072551.1|1703777_1703954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053888203.1|1703956_1704385_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	53.5	2.7e-37
WP_053888204.1|1704371_1704599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225574.1|1704819_1705368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225575.1|1705446_1706868_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	56.5	9.6e-140
1706052:1706066	attR	CTTCGTCATCCAGTT	NA	NA	NA	NA
WP_032184049.1|1706886_1708005_-	hypothetical protein	NA	A0A1X7QGR9	Escherichia_phage	65.8	3.1e-149
WP_065225576.1|1708400_1709459_-	DUF4373 domain-containing protein	NA	A0A2I7QXJ9	Vibrio_phage	47.5	9.6e-44
WP_053886618.1|1709462_1709717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021523509.1|1710023_1710671_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	50.5	5.3e-53
WP_000117287.1|1711171_1711462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169072552.1|1711611_1712253_+	ERF family protein	NA	I6RSN3	Salmonella_phage	54.3	9.6e-55
WP_021519003.1|1712252_1712669_+	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	50.5	1.2e-21
WP_021519004.1|1712684_1712963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225578.1|1712977_1713202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225579.1|1713429_1713702_+	toxin-antitoxin system toxin subunit	NA	NA	NA	NA	NA
WP_021519007.1|1713692_1713884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053886625.1|1713873_1714206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225580.1|1714219_1714840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225581.1|1714938_1715157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117389.1|1715255_1715450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225582.1|1715439_1715643_+	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	80.6	6.3e-29
WP_065225583.1|1715644_1715881_+	cell division protein FtsK	NA	H6WCM0	Enterobacteria_phage	56.4	2.4e-19
WP_021524103.1|1715885_1716119_+	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	94.8	3.1e-35
WP_065225584.1|1716128_1716665_+	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	93.8	7.4e-101
WP_063116846.1|1717154_1717658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225585.1|1717654_1718419_+	hypothetical protein	NA	S4TQH6	Salmonella_virus	60.7	5.1e-79
WP_015675187.1|1718769_1719375_+	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	4.2e-44
WP_042960858.1|1719371_1719779_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	57.9	4.4e-37
WP_000787554.1|1719775_1719958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225586.1|1719957_1720686_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	35.0	2.5e-35
WP_065225587.1|1720685_1720889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225588.1|1720875_1721223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225589.1|1721212_1721485_+	hypothetical protein	NA	A0A2H4PRP0	Proteus_phage	46.4	3.8e-05
WP_023156567.1|1721474_1721786_+	hypothetical protein	NA	I6S5Y4	Salmonella_phage	64.0	8.5e-25
>prophage 8
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1726445	1745786	5286558	tail,lysis	Salmonella_phage(75.0%)	29	NA	NA
WP_000460269.1|1726445_1726646_+	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	47.1	4.3e-06
WP_169072553.1|1726650_1727139_+	glycoside hydrolase family protein	NA	A0A1V0E5Q7	Salmonella_phage	61.6	1.6e-54
WP_065225604.1|1727126_1727597_+|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	24.5	6.7e-05
WP_065225605.1|1727875_1728418_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	43.3	3.4e-21
WP_000124594.1|1729403_1729889_+	DNA-binding protein	NA	Q716H4	Shigella_phage	41.1	8.1e-22
WP_065225606.1|1729891_1731370_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	70.0	2.7e-201
WP_065225607.1|1731448_1732822_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	58.0	3.3e-145
WP_023156527.1|1732811_1733708_+	phage protein F	NA	H6WRT1	Salmonella_phage	49.8	2.4e-72
WP_065225608.1|1733688_1734984_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	54.4	1.2e-115
WP_077883692.1|1734994_1735396_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	48.9	3.4e-26
WP_065225610.1|1735415_1736468_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	62.7	1.2e-126
WP_065225611.1|1736533_1736920_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	60.9	8.9e-40
WP_032184096.1|1736922_1737108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225612.1|1737100_1737469_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	50.8	1.0e-29
WP_042960887.1|1737471_1737912_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	53.8	8.9e-36
WP_000830404.1|1737908_1738295_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	61.7	2.1e-41
WP_065225613.1|1738307_1738784_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	63.4	3.9e-53
WP_106426420.1|1738837_1739515_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	42.0	3.7e-41
WP_065225615.1|1739530_1739944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225616.1|1740253_1742602_+	tape measure protein	NA	A0A1V0E5N4	Salmonella_phage	31.6	1.5e-49
WP_154673386.1|1742634_1742811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523534.1|1742928_1743183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329613.1|1743200_1743356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225617.1|1743524_1743878_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	67.5	1.5e-38
WP_065225725.1|1743877_1744075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523536.1|1744175_1744424_-	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_065225618.1|1744433_1744784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225619.1|1744796_1744952_-	transporter	NA	NA	NA	NA	NA
WP_065225620.1|1745081_1745786_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	71.7	2.6e-98
>prophage 9
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	1972166	2029643	5286558	tail,integrase,protease,portal,transposase,lysis,terminase	Enterobacteria_phage(47.92%)	70	2002579:2002595	2034339:2034355
WP_000527797.1|1972166_1973627_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_120795384.1|1975600_1975714_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1975782_1976016_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|1976332_1976923_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885614.1|1977020_1977596_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_065225633.1|1977595_1980994_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233167.1|1981058_1981658_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	1.7e-109
WP_065225634.1|1981725_1985121_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.6	0.0e+00
WP_073972164.1|1985181_1985829_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	3.3e-111
WP_000140707.1|1985726_1986470_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152368.1|1986474_1987173_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447251.1|1987182_1987512_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_065225635.1|1987511_1990577_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1990548_1990878_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001384509.1|1990886_1991273_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	2.2e-62
WP_000211131.1|1991333_1992077_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_001079398.1|1992087_1992489_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_061892320.1|1992485_1993064_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	97.9	6.8e-100
WP_024207680.1|1993075_1993351_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	4.2e-44
WP_001097041.1|1993343_1993667_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|1993753_1995781_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_021542121.1|1995725_1997234_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_021545871.1|1997233_1997446_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	2.4e-31
WP_000507029.1|1997442_1999542_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_000421825.1|1999550_2000090_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|2000640_2000847_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2001142_2001316_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2001488_2001644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|2001791_2001980_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2001990_2002203_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|2002566_2003064_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2002579:2002595	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092966.1|2003060_2003594_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|2003590_2003902_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|2003906_2004122_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2004373_2004748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2004919_2005348_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_047626566.1|2005714_2005846_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	3.1e-05
WP_000762885.1|2006741_2007563_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000904111.1|2007577_2007934_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_053292618.1|2007946_2008996_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.7e-107
WP_012304870.1|2008997_2009276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2009342_2009594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2009810_2009966_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2010037_2010325_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2010324_2010564_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071527819.1|2010588_2010894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2011096_2011429_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|2011865_2013206_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|2013239_2013659_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054504.1|2013699_2014665_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|2014645_2015167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2015150_2015378_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2015455_2015863_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2016055_2016211_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_122986852.1|2016212_2016464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986851.1|2016450_2016771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2017275_2017464_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2017460_2017652_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_033815598.1|2017745_2020217_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2020289_2020541_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876979.1|2020575_2021856_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_021531328.1|2021875_2021986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|2022043_2023063_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2023074_2024289_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2024494_2024821_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|2024955_2025297_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2025331_2025892_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2025894_2026605_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2026712_2027018_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|2027216_2029643_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
2034339:2034355	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 10
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	2303845	2385207	5286558	tail,integrase,holin,protease,portal,transposase,head,tRNA,capsid,terminase	Enterobacteria_phage(34.38%)	95	2296134:2296149	2388385:2388400
2296134:2296149	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_085947771.1|2303845_2305007_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_065225637.1|2305035_2305821_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001307253.1|2305843_2306683_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000582553.1|2306775_2307573_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000633901.1|2307594_2309394_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_000357164.1|2309410_2310244_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_077251362.1|2310246_2311515_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000777726.1|2311538_2312771_-	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000242979.1|2313043_2314081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490375.1|2314099_2315056_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_001307257.1|2315146_2315635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741721.1|2315717_2316845_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
WP_000581608.1|2317251_2318061_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000575897.1|2318149_2320018_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_000281533.1|2320054_2323129_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_000448381.1|2323217_2324189_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2324308_2325631_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2325646_2326579_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_065225638.1|2326657_2327413_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	27.8	1.4e-17
WP_000571465.1|2327409_2328195_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2328341_2329352_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2329360_2329972_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2330110_2330176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|2330246_2330849_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2330850_2331372_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2331406_2332147_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|2332175_2332628_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2332745_2334518_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2334827_2335394_+	hydrolase	NA	NA	NA	NA	NA
WP_065225639.1|2335744_2336317_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	54.1	2.7e-48
WP_065225640.1|2336331_2338422_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.0	7.9e-90
WP_001228274.1|2338486_2339086_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_065225641.1|2339153_2342852_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	78.6	0.0e+00
WP_072131720.1|2342912_2343560_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	5.6e-111
WP_065225642.1|2343457_2344201_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_021562581.1|2344206_2344905_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	2.0e-130
WP_040079256.1|2344904_2345261_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_000224015.1|2345238_2348466_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_024212233.1|2348511_2348790_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	1.8e-42
WP_000164661.1|2348813_2349185_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097533.1|2349199_2349904_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|2349963_2350308_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2350304_2350751_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_065225643.1|2350750_2351089_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	2.7e-56
WP_000983037.1|2351097_2351403_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2351414_2351603_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_065225644.1|2351654_2352860_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	2.5e-221
WP_001193631.1|2352874_2353525_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466248.1|2353502_2354744_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000478567.1|2354743_2354926_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|2354937_2356695_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_001317918.1|2356694_2357177_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_000361882.1|2357419_2357935_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	1.3e-33
WP_001140100.1|2358070_2358421_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	93.0	1.1e-60
WP_001109099.1|2358430_2358631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|2358948_2359134_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_047085180.1|2359350_2359884_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	1.3e-100
WP_000282141.1|2360012_2360327_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065225645.1|2360336_2360978_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.3	2.1e-62
WP_113771422.1|2360981_2361197_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	95.8	6.5e-32
WP_047085559.1|2361295_2361631_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	82.9	1.7e-47
WP_038813346.1|2361892_2362228_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2362489_2362654_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2362650_2363076_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_001405091.1|2363261_2364005_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000640038.1|2364245_2364782_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.0e-66
WP_065225646.1|2364790_2365150_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.2	6.6e-37
WP_065225491.1|2365408_2366980_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000624622.1|2366999_2367347_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_040091510.1|2367346_2367997_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.8e-16
WP_000211316.1|2368116_2369508_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.6	1.6e-251
WP_000988194.1|2369504_2370383_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	98.0	4.4e-143
WP_000092425.1|2370393_2371386_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	98.2	4.9e-58
WP_000621182.1|2371382_2371607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966265.1|2371603_2372467_-	Rha family phage regulatory protein	NA	S5MQL6	Escherichia_phage	76.3	1.4e-112
WP_038813125.1|2372459_2372852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065275704.1|2372915_2373089_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	87.7	6.2e-25
WP_001090257.1|2373108_2373816_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	91.5	6.1e-119
WP_000076059.1|2373853_2374600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838349.1|2374940_2375597_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	99.5	3.7e-126
WP_000608400.1|2375700_2376135_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	94.9	4.6e-69
WP_000141090.1|2376272_2376479_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_000660644.1|2376675_2376864_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.3e-28
WP_024212033.1|2376860_2377442_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.7	9.2e-105
WP_000720009.1|2377803_2378631_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	8.1e-131
WP_024212031.1|2378671_2379043_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	96.7	3.6e-62
WP_042966262.1|2379074_2379317_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	96.2	6.4e-36
WP_001030139.1|2379320_2379467_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000528719.1|2379475_2379712_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	2.9e-41
WP_042966263.1|2379767_2381081_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.2	4.0e-249
WP_065225647.1|2381062_2381833_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252979.1|2381885_2382281_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019584.1|2382321_2383065_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|2383061_2384033_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|2384226_2385207_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2388385:2388400	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 11
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	2440457	2523535	5286558	tail,integrase,holin,portal,protease,transposase,head,capsid,terminase	Escherichia_phage(35.59%)	102	2445572:2445586	2528132:2528146
WP_065225648.1|2440457_2441666_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.7e-207
WP_000879833.1|2443077_2443875_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001593414.1|2443884_2444436_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2444604_2444937_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2445270_2445585_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
2445572:2445586	attL	TGTATCGCTGACATT	NA	NA	NA	NA
WP_000994452.1|2445799_2447458_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2447450_2448446_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282699.1|2448438_2449125_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2449124_2450498_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807580.1|2450516_2450960_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620099.1|2450956_2452084_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2452188_2452653_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2452657_2453662_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2453658_2454072_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001299290.1|2454074_2454440_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2454439_2455177_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2455186_2455456_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|2455464_2456250_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2456539_2457163_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2457206_2457395_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2457557_2457785_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491501.1|2458082_2458898_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001349973.1|2458894_2460589_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2460759_2460942_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2461020_2461938_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212238.1|2462110_2463031_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2463019_2463490_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157239.1|2463470_2464889_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365545.1|2464955_2465651_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_001313057.1|2465690_2466056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824355.1|2466622_2467738_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_000218208.1|2468329_2469181_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826770.1|2469288_2470647_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|2470646_2471318_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920128.1|2471450_2471864_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740100.1|2471972_2472977_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|2472977_2473613_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007749.1|2473869_2474520_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2474862_2475393_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_065225649.1|2476451_2477030_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	4.4e-51
WP_065225650.1|2477044_2479135_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.1	1.4e-91
WP_000017388.1|2479225_2480017_-	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	3.1e-119
WP_047089024.1|2480013_2480385_-	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_042966578.1|2483886_2484531_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	77.4	6.8e-93
WP_047085481.1|2484428_2485172_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.1	2.4e-142
WP_024212310.1|2485182_2485881_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	5.8e-130
WP_000847269.1|2485880_2486210_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	6.8e-57
WP_065225651.1|2486206_2488786_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_047085479.1|2488766_2489180_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_000479079.1|2489206_2489638_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_000235024.1|2489651_2490404_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000683087.1|2490411_2490807_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000975024.1|2490803_2491337_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_021499114.1|2491351_2491705_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_001355131.1|2491697_2492081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522660.1|2492132_2493161_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_000256809.1|2493218_2493566_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001360691.1|2495097_2496690_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2496686_2496893_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360690.1|2496876_2498805_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000235436.1|2498776_2499286_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000095729.1|2499679_2499892_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000735650.1|2500927_2501152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|2501237_2501423_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_052834940.1|2501783_2501966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966549.1|2502121_2502655_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	5.1e-102
WP_000282141.1|2502783_2503098_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001015166.1|2503107_2503749_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284517.1|2503752_2503968_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_038813346.1|2504140_2504476_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2504737_2504902_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2504898_2505324_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_038813804.1|2505534_2506077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|2507388_2507586_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000265262.1|2507875_2508694_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000942766.1|2508848_2509220_-	Probable antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	4.7e-54
WP_047085386.1|2509209_2509581_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.4e-34
WP_047085387.1|2509593_2510643_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.3e-109
WP_047085388.1|2510644_2510923_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047085389.1|2510989_2511250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085390.1|2511502_2511715_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.8e-27
WP_038813042.1|2511948_2512344_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000753062.1|2512367_2512544_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.5e-26
WP_001224671.1|2512536_2512719_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_047085392.1|2512863_2513337_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	1.2e-65
WP_000699804.1|2513311_2513557_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_077790485.1|2513553_2513808_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	68.3	3.8e-23
WP_097759619.1|2513864_2514482_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	3.2e-63
WP_047085396.1|2514445_2514625_-	DNA-binding protein	NA	A0A0U2SAW4	Escherichia_phage	89.4	1.3e-14
WP_157922753.1|2514659_2515202_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.5e-85
WP_047087522.1|2515113_2516154_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	85.6	2.5e-89
WP_000705388.1|2516125_2516677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085261.1|2516660_2516888_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381213.1|2516968_2517376_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_052073903.1|2517544_2517700_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_047085262.1|2517859_2518075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085263.1|2518164_2518611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085602.1|2519306_2519495_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098306.1|2519491_2519683_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_047087128.1|2519776_2522248_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_000096344.1|2522306_2522510_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047085409.1|2522509_2523535_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
2528132:2528146	attR	AATGTCAGCGATACA	NA	NA	NA	NA
>prophage 12
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	2648553	2713183	5286558	tail,integrase,holin,portal,plate,lysis,head,tRNA,capsid,terminase	Escherichia_phage(37.78%)	73	2653611:2653638	2685909:2685936
WP_000675150.1|2648553_2649957_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2649953_2650676_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2650866_2651199_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2651407_2651704_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2651705_2652002_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2652104_2653466_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2653611:2653638	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2653739_2653958_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_065225654.1|2654039_2655203_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	2.0e-204
WP_000978905.1|2655202_2655682_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	3.3e-84
WP_065225655.1|2655696_2658144_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.2	0.0e+00
WP_000785970.1|2658136_2658256_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2658288_2658564_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2658620_2659139_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_065225656.1|2659151_2660342_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	3.4e-223
WP_032170940.1|2660617_2662231_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001541423.1|2662493_2663021_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	1.5e-90
WP_065225657.1|2663024_2665343_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	66.9	4.1e-212
WP_001285308.1|2665353_2665884_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_001121485.1|2665876_2666785_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	1.2e-162
WP_001393127.1|2666789_2667137_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	98.3	2.2e-58
WP_053879338.1|2667133_2667775_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	89.8	1.2e-97
WP_001001774.1|2667841_2668294_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_065225658.1|2668286_2668754_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	3.7e-80
WP_001300730.1|2668716_2668890_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_065225659.1|2668861_2669287_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.4e-65
WP_053264584.1|2669274_2669700_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	9.5e-59
WP_001144101.1|2669714_2670212_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2670211_2670493_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2670496_2670700_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2670699_2671209_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001583658.1|2671308_2672052_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	3.5e-125
WP_001248553.1|2672055_2673129_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_001541360.1|2673187_2674042_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	100.0	3.9e-136
WP_000156875.1|2674215_2675988_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_065225660.1|2675987_2677022_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	5.5e-201
WP_001583661.1|2677525_2679742_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023278426.1|2679965_2682257_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.4	0.0e+00
WP_000027668.1|2682246_2682522_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_001113264.1|2682518_2682743_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_015979591.1|2682742_2683045_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	97.0	3.2e-45
WP_000557701.1|2683044_2683269_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217662.1|2683332_2683833_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_001005162.1|2683829_2684000_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2684010_2684286_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2684400_2684700_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985260.1|2684815_2685829_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000716757.1|2686093_2686411_-	hypothetical protein	NA	NA	NA	NA	NA
2685909:2685936	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2686825_2687725_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178556.1|2687806_2688586_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844264.1|2688685_2689726_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490693.1|2689773_2691129_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823287.1|2691132_2691417_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182903.1|2691447_2691900_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|2691909_2693172_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2693200_2694055_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2694362_2695415_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2695671_2696949_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2696945_2697950_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2697946_2698912_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2698885_2699632_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2699683_2700502_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_065225661.1|2700566_2701367_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2701363_2702152_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2702374_2702647_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2702767_2703592_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2703810_2704149_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|2704230_2705265_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|2705278_2707759_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|2707774_2708449_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2708529_2709072_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001351454.1|2709364_2709646_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005440.1|2709908_2711018_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001439138.1|2711149_2713183_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
>prophage 13
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	2725694	2735136	5286558		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|2725694_2726831_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_065225662.1|2726827_2728828_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2728952_2729414_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2729454_2729925_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2729971_2730691_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_065225663.1|2730687_2732373_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	5.6e-304
WP_001240401.1|2732594_2733326_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2733385_2733493_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2733473_2734205_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|2734209_2735136_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 14
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	2934689	3028861	5286558	tail,bacteriocin,integrase,holin,portal,transposase,tRNA,capsid,terminase	Escherichia_phage(59.15%)	100	3015643:3015658	3040272:3040287
WP_001283590.1|2934689_2935502_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2935501_2936515_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033817099.1|2936580_2937717_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|2937815_2938811_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2938807_2939986_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2940278_2941499_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_021565342.1|2941657_2943664_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399648.1|2943834_2944815_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000559764.1|2945063_2945342_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2945375_2945924_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2945923_2946733_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043820.1|2946732_2947557_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2947560_2948646_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2948680_2949613_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2949778_2950330_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2950451_2951324_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2951310_2951835_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2951831_2952302_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2952298_2952847_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2952821_2953574_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296855.1|2953593_2956236_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2956317_2956881_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2957555_2958041_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_033817205.1|2958243_2960388_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531991.1|2960387_2961698_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2961877_2962162_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2962533_2963874_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937840.1|2964241_2965300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2965481_2966237_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2966530_2967463_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_065225668.1|2967684_2976084_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	94.0	0.0e+00
WP_025404420.1|2976152_2977418_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.5	3.9e-185
WP_025404421.1|2977428_2977680_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455646.1|2977689_2978136_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000509480.1|2978138_2978792_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000035554.1|2978885_2979287_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000078907.1|2979343_2979484_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_001370514.1|2979715_2980396_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	79.4	5.2e-99
WP_024239488.1|2980523_2981141_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.0	1.1e-119
WP_001369201.1|2981146_2981428_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|2981442_2982711_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001146318.1|2982707_2984333_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	100.0	0.0e+00
WP_000276175.1|2984655_2984883_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	100.0	1.2e-39
WP_000537687.1|2984895_2985441_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	100.0	6.8e-94
WP_065225669.1|2985516_2987781_-|tail	tail fiber domain-containing protein	tail	A0A088CC33	Shigella_phage	89.3	1.4e-76
WP_032313366.1|2987777_2988428_-	hypothetical protein	NA	A0A088CBJ9	Shigella_phage	100.0	2.1e-121
WP_032313365.1|2988427_2988991_-	hypothetical protein	NA	A0A088CE76	Shigella_phage	100.0	9.8e-104
WP_032313364.1|2988974_2989436_-	hypothetical protein	NA	A0A088CBQ5	Shigella_phage	100.0	4.8e-64
WP_032313363.1|2989486_2989879_-	hypothetical protein	NA	A0A088CD63	Shigella_phage	100.0	1.2e-63
WP_032313362.1|2989933_2991148_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	100.0	5.2e-235
WP_032313361.1|2991170_2992175_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	94.3	9.7e-171
WP_065225670.1|2992332_2994477_-|portal	portal protein	portal	A0A2L1IV74	Escherichia_phage	96.5	0.0e+00
WP_065225671.1|2994476_2996183_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	98.6	0.0e+00
WP_001086067.1|2996163_2996958_-	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
WP_001108577.1|2997250_2997802_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|2998040_2998226_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_065225672.1|2998777_2999311_-	lysozyme	NA	V5USG4	Shigella_phage	96.0	1.4e-99
WP_000282141.1|2999439_2999754_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001015166.1|2999763_3000405_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284518.1|3000408_3000624_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000216624.1|3001184_3001349_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_001299895.1|3001345_3001777_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_001304085.1|3002240_3002393_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_071587234.1|3002655_3003759_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044809592.1|3003809_3005822_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.4e-81
WP_185767480.1|3005851_3006382_+	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_000813244.1|3006554_3006710_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.6e-16
WP_001204831.1|3006909_3007335_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	73.2	1.2e-53
WP_000144761.1|3007327_3007528_-	phage NinH family protein	NA	G9L694	Escherichia_phage	92.4	1.2e-27
WP_032274377.1|3007524_3008088_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	98.4	1.3e-103
WP_000402092.1|3008095_3008545_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_032274376.1|3008544_3009516_-	toprim domain-containing protein	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
WP_032274375.1|3009505_3011026_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
WP_000470023.1|3011019_3011406_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
WP_001240875.1|3011939_3012143_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001056250.1|3012238_3012952_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_032274372.1|3013046_3014516_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2L1IV91	Escherichia_phage	99.4	4.3e-284
WP_001064714.1|3014512_3015466_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
3015643:3015658	attL	CAAGCCAGAAACATCG	NA	NA	NA	NA
WP_106888904.1|3016187_3016973_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	86.6	3.7e-125
WP_000917252.1|3017043_3017256_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_032274367.1|3017267_3017549_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
WP_032274366.1|3017569_3017851_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
WP_032274365.1|3017868_3018819_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	99.7	5.4e-179
WP_032274364.1|3018815_3019505_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.1	5.0e-134
WP_033805714.1|3019504_3020092_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.0	5.8e-107
WP_001071603.1|3020166_3020514_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_032274361.1|3020577_3021399_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	99.3	7.2e-148
WP_001159715.1|3021475_3021871_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|3022021_3022747_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|3022743_3023151_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|3023152_3023344_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_065225673.1|3023346_3024258_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	95.4	4.5e-167
WP_042357761.1|3024190_3024406_+	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000994798.1|3024441_3024849_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
WP_021351637.1|3024992_3025226_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|3025213_3025465_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_024174014.1|3025525_3025708_+	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_032274263.1|3025691_3026861_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
WP_065225674.1|3027295_3028465_+|integrase	tyrosine-type recombinase/integrase	integrase	C6ZR22	Salmonella_phage	87.9	4.9e-206
WP_032141916.1|3028471_3028861_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	67.4	5.8e-47
3040272:3040287	attR	CAAGCCAGAAACATCG	NA	NA	NA	NA
>prophage 15
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	3032136	3077624	5286558	tail,head,terminase	Cronobacter_phage(36.96%)	64	NA	NA
WP_033817208.1|3032136_3034134_-	hypothetical protein	NA	B1GS50	Salmonella_phage	69.8	2.4e-59
WP_033817209.1|3034190_3036668_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	88.2	0.0e+00
WP_050488448.1|3036654_3037071_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	83.8	1.6e-66
WP_032141923.1|3037033_3037504_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_016245414.1|3037503_3038001_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
WP_033817210.1|3038000_3040328_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	50.8	2.6e-150
WP_033817211.1|3040416_3040776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817212.1|3040881_3041607_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	1.8e-62
WP_033817213.1|3041657_3042413_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	52.6	3.2e-57
WP_033817214.1|3042471_3042855_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	1.4e-37
WP_033817215.1|3042851_3043220_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	71.3	1.8e-42
WP_033817216.1|3043222_3043573_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	4.4e-38
WP_033817217.1|3043572_3043746_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	47.4	3.9e-11
WP_033817218.1|3043745_3044126_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_033817219.1|3044128_3044494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817220.1|3044503_3045601_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	5.9e-161
WP_033817221.1|3045610_3046045_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	6.7e-52
WP_033817222.1|3046048_3047443_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	67.0	2.0e-158
WP_169072554.1|3047985_3048963_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.6	3.8e-111
WP_033817225.1|3048916_3050377_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	72.4	1.2e-190
WP_033817226.1|3050388_3051861_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.7	8.7e-253
WP_033817227.1|3051860_3052463_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	1.7e-77
WP_033817228.1|3052466_3052685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817229.1|3052813_3053083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817230.1|3053299_3053677_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.6	4.8e-14
WP_033817256.1|3053673_3054189_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.0	1.7e-49
WP_033817231.1|3054181_3054502_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	78.0	1.4e-38
WP_033817232.1|3054943_3055183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817233.1|3055372_3056062_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.7e-55
WP_089604614.1|3056058_3056175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141952.1|3056171_3056555_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	44.6	2.7e-20
WP_033817234.1|3056551_3057163_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	71.4	6.5e-61
WP_033817235.1|3057155_3057326_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	85.5	7.7e-20
WP_033817236.1|3057325_3057781_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	71.5	2.0e-59
WP_033817237.1|3057954_3058605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817238.1|3058601_3058850_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	93.8	1.5e-35
WP_032141958.1|3058849_3059176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123282430.1|3059730_3060015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071961367.1|3060166_3060421_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	45.3	4.4e-11
WP_033817257.1|3060451_3060751_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	52.6	3.1e-16
WP_033817240.1|3060755_3062129_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.4	3.8e-165
WP_033817241.1|3062125_3063211_-	replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.6e-84
WP_023306333.1|3063203_3063350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817242.1|3063439_3064006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817243.1|3064035_3064263_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	3.1e-16
WP_033817244.1|3064298_3065054_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	59.1	9.5e-78
WP_033817245.1|3065065_3065653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033817246.1|3066003_3066345_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
WP_028013595.1|3066963_3067161_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_033817247.1|3067233_3067518_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	97.9	9.1e-50
WP_033817248.1|3067527_3068445_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	3.9e-158
WP_065225677.1|3068441_3069062_+	helix-turn-helix domain-containing protein	NA	A0A2I7QQK3	Vibrio_phage	40.3	1.6e-22
WP_033817249.1|3069054_3069741_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.3	5.3e-120
WP_033817250.1|3069737_3070166_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	6.8e-73
WP_033817251.1|3070162_3070315_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
WP_032141975.1|3070967_3071186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141976.1|3071182_3071524_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
WP_032141978.1|3071615_3071834_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.7	3.7e-19
WP_032141979.1|3071921_3072194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141980.1|3072282_3072582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141982.1|3072990_3073194_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	61.2	6.6e-18
WP_001197025.1|3073740_3074988_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|3075059_3075974_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|3076190_3077624_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 16
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	3426035	3433175	5286558		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3426035_3428597_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3428702_3429359_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3429409_3430177_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3430372_3431281_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3431277_3432540_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3432536_3433175_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP015228	Escherichia coli strain 09-00049 chromosome, complete genome	5286558	5207613	5257287	5286558	integrase,tail,holin,portal,head,capsid,terminase	Enterobacteria_phage(37.74%)	58	5206699:5206714	5228158:5228173
5206699:5206714	attL	GGGTGGATTATCAAAA	NA	NA	NA	NA
WP_040091220.1|5207613_5208852_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.3	1.6e-231
WP_047085127.1|5209004_5210600_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_040091656.1|5210610_5210796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091321.1|5211331_5211679_-	hypothetical protein	NA	U5P0J0	Shigella_phage	70.4	2.1e-24
WP_040091320.1|5211675_5212554_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	3.1e-165
WP_001401560.1|5212544_5213081_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_065225712.1|5213208_5214033_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000135680.1|5214098_5214461_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021559686.1|5215305_5215515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859465.1|5215710_5216385_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.6	3.5e-132
WP_000649477.1|5216475_5216676_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|5216719_5217271_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_065225713.1|5217267_5218416_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	82.7	5.2e-168
WP_000620701.1|5218412_5218637_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	9.7e-39
WP_000061516.1|5218633_5219452_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.4e-122
WP_001364121.1|5219448_5219943_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	4.0e-85
WP_000210186.1|5219942_5220269_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
WP_000767110.1|5220265_5220661_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|5220812_5221628_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001223333.1|5221643_5222159_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_001202270.1|5222168_5223158_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	2.3e-193
WP_001204819.1|5223175_5223541_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038608.1|5223626_5224073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917725.1|5224342_5224546_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_065225714.1|5224696_5225755_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	85.4	6.0e-179
WP_001299895.1|5226222_5226654_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000216624.1|5226650_5226815_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_000284517.1|5227375_5227591_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001015166.1|5227594_5228236_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
5228158:5228173	attR	TTTTGATAATCCACCC	NA	NA	NA	NA
WP_000282141.1|5228245_5228560_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065225715.1|5228688_5229222_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_123008212.1|5230436_5230643_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	9.3e-12
WP_000095729.1|5231712_5231925_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|5232318_5232828_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|5232799_5234728_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|5234711_5234918_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360691.1|5234914_5236507_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_040090915.1|5236496_5238002_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_000256809.1|5238038_5238386_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522660.1|5238443_5239472_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|5239523_5239907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|5239899_5240253_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000975024.1|5240267_5240801_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683087.1|5240797_5241193_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|5241200_5241953_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_065225716.1|5241966_5242398_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	64.3	5.8e-40
WP_047085479.1|5242424_5242838_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_065225717.1|5242818_5245398_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
WP_000847418.1|5245394_5245724_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_001152619.1|5245723_5246422_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_024210569.1|5246427_5247171_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.3e-143
WP_001351519.1|5247107_5247740_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_065225718.1|5247800_5251499_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.7	0.0e+00
WP_001228274.1|5251566_5252166_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_065225719.1|5252230_5254321_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.5	1.1e-91
WP_047662566.1|5254335_5254908_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	74.5	4.8e-74
WP_001217550.1|5255232_5255481_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000202564.1|5255700_5257287_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 1
NZ_CP012500	Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence	225292	2925	48551	225292	tRNA,transposase	Escherichia_phage(22.22%)	36	NA	NA
WP_024166190.1|2925_3945_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085948398.1|4464_5575_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.9e-42
WP_000269721.1|6627_7248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348341.1|7904_8414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148713600.1|9044_9446_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557618.1|9378_9636_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000704517.1|10295_11156_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	24.1	2.8e-09
WP_136752748.1|11409_11619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001364036.1|12672_14160_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_085948397.1|14397_15091_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_001179712.1|15971_16976_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001081196.1|19039_19321_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_024166187.1|19329_19611_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	44.1	1.3e-19
WP_000074142.1|21131_21287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065224993.1|21894_22926_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071961352.1|22974_23181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225488.1|23687_27506_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	34.3	2.6e-195
WP_000086537.1|28624_29215_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	4.3e-25
WP_065225489.1|29375_32360_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	2.3e-300
WP_136759862.1|32356_32647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090730.1|33699_34164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136759863.1|34442_35483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829162.1|36483_37341_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001364037.1|37333_37408_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083838.1|37651_37900_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|38183_38333_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000455478.1|38588_39053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766788.1|39207_39798_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001355319.1|39835_40045_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001364091.1|40372_40585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139355.1|40719_41280_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000429592.1|41334_42072_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.1	3.1e-09
WP_000447372.1|42093_42525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986971.1|42573_47844_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450526.1|47925_48153_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911316.1|48152_48551_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP012500	Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence	225292	79359	128996	225292	transposase	Stx2-converting_phage(14.29%)	45	NA	NA
WP_024166184.1|79359_80364_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.4	6.4e-21
WP_065225491.1|81287_82859_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_040091510.1|83224_83875_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_001312861.1|84195_84354_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001355331.1|84433_84622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116353.1|84633_85353_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845944.1|85349_85784_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117198.1|85852_87817_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.9	2.1e-20
WP_000005990.1|87880_88114_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290856.1|88171_88624_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	58.6	1.4e-44
WP_001364033.1|89515_90079_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	42.1	7.4e-19
WP_000170678.1|90124_91486_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001364049.1|91537_91768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027514.1|92748_92940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271767.1|92939_93359_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001364029.1|93405_93708_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001300563.1|94408_95521_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001006223.1|95597_96368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104895.1|96835_97057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085877.1|97057_97741_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	1.3e-28
WP_000959884.1|98258_99221_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_024166183.1|99223_99574_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000765123.1|99680_100040_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	50.0	1.1e-18
WP_001105063.1|100377_100659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421271.1|100764_101040_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001355337.1|101039_101324_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001261037.1|101716_101938_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001355339.1|102823_103414_+	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	34.7	1.0e-18
WP_000427681.1|106724_107270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278817.1|108663_109080_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000688515.1|109072_110053_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030204.1|110465_110774_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_001144034.1|110860_111505_-	ParA family protein	NA	NA	NA	NA	NA
WP_097759936.1|113212_114375_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.9	2.8e-52
WP_001213548.1|114602_116042_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072157085.1|116045_118166_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217753.1|118215_121209_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_001355427.1|121210_121726_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000982736.1|122322_122601_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001355426.1|122670_122868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225493.1|122902_123268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001355425.1|123945_124164_+	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_170979933.1|127118_127457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123008206.1|127611_127752_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000342165.1|127787_128996_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	9.6e-48
