The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	247052	308172	3171081	protease,plate,integrase	Exiguobacterium_phage(33.33%)	43	295391:295427	312925:312961
WP_014166024.1|247052_248879_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_041253480.1|248910_249339_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014166026.1|249344_250037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041253252.1|250036_250558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166028.1|250575_251091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166029.1|251094_252252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166030.1|252440_253805_-	type VI secretion system contractile sheath protein TssC	NA	NA	NA	NA	NA
WP_014166031.1|253816_254266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065212917.1|254279_256748_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.6	1.1e-85
WP_065212918.1|256781_257852_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_173668577.1|257940_258579_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_065212921.1|260529_261576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014166038.1|261596_262079_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_065212922.1|262089_264426_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_065212923.1|264397_265489_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_075348563.1|265553_266603_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_102135394.1|266667_266889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014166042.1|266953_268075_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_065212925.1|268064_268556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166044.1|268545_268887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123906727.1|268861_269920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649137.1|270056_270599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166047.1|270817_271324_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_014166048.1|271310_271910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065212927.1|271906_277609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065212928.1|277702_282652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097609575.1|282651_283356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065212930.1|283420_295042_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_081278976.1|295045_295369_+	hypothetical protein	NA	NA	NA	NA	NA
295391:295427	attL	AAACACGCTTACGGGCGTGTTTTTTTGTGGGTTAAAG	NA	NA	NA	NA
WP_155761337.1|295678_295828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155761337.1|296193_296343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166056.1|296668_297001_-	helix-turn-helix transcriptional regulator	NA	A0A0U4KKM4	Exiguobacterium_phage	48.3	5.9e-08
WP_065212931.1|297139_298723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081278977.1|298783_299818_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	1.9e-12
WP_065212933.1|299810_300587_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065212934.1|301541_302588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065212935.1|302598_303117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065212936.1|303226_303583_-	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	30.3	3.0e-05
WP_155761337.1|303778_303928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166056.1|304253_304586_-	helix-turn-helix transcriptional regulator	NA	A0A0U4KKM4	Exiguobacterium_phage	48.3	5.9e-08
WP_065212931.1|304724_306308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081278977.1|306368_307403_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	1.9e-12
WP_065212933.1|307395_308172_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
312925:312961	attR	AAACACGCTTACGGGCGTGTTTTTTTGTGGGTTAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	1178073	1238127	3171081	transposase,tRNA,integrase	Wolbachia_phage(27.27%)	45	1179462:1179507	1237662:1237707
WP_081278967.1|1178073_1178919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014165862.1|1179025_1179409_-	hypothetical protein	NA	NA	NA	NA	NA
1179462:1179507	attL	ATTTTATGTATCTTTATATAGTTTTATTGCGAAAAATAATATTTAA	NA	NA	NA	NA
WP_041253389.1|1179526_1180600_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.3	2.3e-32
WP_065213184.1|1181357_1182254_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	28.8	2.1e-23
WP_065213185.1|1182694_1183579_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	32.0	5.4e-24
WP_065213186.1|1184150_1186568_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065213187.1|1186741_1191055_-	T9SS type B sorting domain-containing protein	NA	NA	NA	NA	NA
WP_014165227.1|1191258_1193037_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	28.7	1.4e-42
WP_014165228.1|1193177_1193711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213188.1|1193878_1195870_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_014165230.1|1195957_1196620_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_065213189.1|1196917_1197742_-	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_065213190.1|1197848_1200221_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014165233.1|1200762_1201362_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014165234.1|1201524_1202286_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065213191.1|1204383_1205439_-	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	43.9	2.3e-37
WP_065213192.1|1205448_1206285_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_065213193.1|1207871_1210094_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_065213195.1|1210662_1213932_-	restriction endonuclease	NA	A0A142KCD4	Gordonia_phage	28.4	1.2e-36
WP_065213196.1|1213928_1215344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213197.1|1215345_1216875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213198.1|1216874_1217594_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014166550.1|1218211_1218562_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_065213199.1|1219104_1220499_+	hypothetical protein	NA	A0A096VKG4	Synechococcus_phage	24.7	3.6e-06
WP_065213200.1|1220765_1222124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014166546.1|1222441_1223257_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.1	2.1e-06
WP_014166545.1|1223303_1223984_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014166544.1|1224058_1224502_-	DUF1569 domain-containing protein	NA	NA	NA	NA	NA
WP_014166543.1|1224549_1225347_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014166542.1|1225350_1225809_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014166541.1|1225858_1226791_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	44.5	2.3e-25
WP_065213201.1|1226880_1227186_+	cytochrome c	NA	NA	NA	NA	NA
WP_014166539.1|1227245_1227701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166538.1|1228132_1228690_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_014166537.1|1228694_1229108_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_014166536.1|1229431_1230265_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_065213202.1|1231055_1231928_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	31.8	2.8e-25
WP_107317200.1|1232057_1232138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213203.1|1232410_1233097_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_065213204.1|1233083_1233383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063743049.1|1234361_1235933_-	Eco57I restriction-modification methylase domain-containing protein	NA	Q8V6N5	Halorubrum_phage	32.4	2.6e-08
WP_063743050.1|1235938_1236658_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_065213206.1|1236941_1237238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213207.1|1237227_1237485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081278997.1|1237713_1238127_-|transposase	transposase	transposase	NA	NA	NA	NA
1237662:1237707	attR	ATTTTATGTATCTTTATATAGTTTTATTGCGAAAAATAATATTTAA	NA	NA	NA	NA
>prophage 3
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	1564616	1621488	3171081	transposase	Tupanvirus(15.38%)	50	NA	NA
WP_081278999.1|1564616_1565381_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	29.0	8.3e-13
WP_065213317.1|1565476_1565788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065213317.1|1568084_1568396_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065213319.1|1568415_1568766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213320.1|1568774_1569155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166608.1|1569442_1571638_-	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	38.5	3.3e-86
WP_014166607.1|1571874_1572840_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	2.1e-37
WP_014166606.1|1572840_1573659_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.1	1.8e-21
WP_014166605.1|1573651_1573996_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014166604.1|1574157_1574898_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	1.0e-20
WP_065213321.1|1575105_1576086_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_065213322.1|1576085_1578281_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014166601.1|1578288_1578765_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_065213323.1|1578768_1580247_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_065213324.1|1580339_1582631_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014166598.1|1583540_1584488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014166597.1|1584604_1585462_-	glycoside hydrolase family 25 protein	NA	A0A0A7HER1	Arthrobacter_phage	26.5	2.9e-06
WP_014166596.1|1585462_1586203_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_065213943.1|1586400_1587396_+	PorV/PorQ family protein	NA	NA	NA	NA	NA
WP_065213325.1|1587449_1588574_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_014166593.1|1588608_1590000_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_065213326.1|1590083_1591106_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065213327.1|1591065_1592424_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_065213328.1|1592401_1593487_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014166589.1|1593477_1594479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166588.1|1594488_1595622_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014166587.1|1595633_1596623_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014166586.1|1596612_1598157_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014166585.1|1598137_1599301_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065213329.1|1599302_1600181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213330.1|1600269_1601670_-	UDP-glycosyltransferase	NA	NA	NA	NA	NA
WP_014166582.1|1601681_1602554_-	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_065213331.1|1602543_1603704_-	acylneuraminate cytidylyltransferase	NA	E3T535	Cafeteria_roenbergensis_virus	28.0	6.5e-17
WP_065213332.1|1603713_1604622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166581.1|1604623_1606060_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.8	2.6e-52
WP_014166580.1|1606063_1606942_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065213333.1|1606920_1608087_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014166578.1|1608091_1609258_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041253290.1|1609250_1609901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166576.1|1609903_1610938_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065213334.1|1610939_1611869_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	30.5	1.0e-28
WP_102135401.1|1611945_1613079_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	6.3e-25
WP_014166573.1|1613523_1614408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166572.1|1614418_1615705_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	5.3e-12
WP_014166571.1|1615707_1616571_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014166570.1|1616697_1617435_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065213336.1|1617687_1618878_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	38.4	7.3e-48
WP_065213337.1|1619150_1620065_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	3.6e-39
WP_014165992.1|1620064_1620331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080572502.1|1621176_1621488_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	1637193	1646021	3171081		Escherichia_phage(28.57%)	8	NA	NA
WP_065213350.1|1637193_1638264_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	23.3	7.8e-09
WP_065213351.1|1638263_1639352_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_065213352.1|1639356_1640379_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	36.4	1.3e-45
WP_065213353.1|1640388_1641264_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	59.0	1.5e-98
WP_065213354.1|1641325_1642375_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.1	3.2e-84
WP_065213355.1|1642385_1643750_-	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	34.4	2.8e-64
WP_173668580.1|1643775_1645050_-	nucleotide sugar dehydrogenase	NA	M1H4V0	Acanthocystis_turfacea_Chlorella_virus	28.5	2.7e-24
WP_014164848.1|1645049_1646021_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.6	2.6e-88
>prophage 5
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	1678072	1704709	3171081	transposase,integrase	Leptospira_phage(50.0%)	12	1679944:1679960	1687240:1687256
WP_065213365.1|1678072_1678993_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.0	1.6e-15
WP_065213366.1|1679046_1679943_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1679944:1679960	attL	AAAGGATAAAAATAAAT	NA	NA	NA	NA
WP_065213367.1|1680879_1681473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213362.1|1681472_1682228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213363.1|1682271_1682613_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	42.9	4.4e-06
WP_065213368.1|1682779_1685083_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_065213369.1|1685360_1686281_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	9.0e-14
WP_065213370.1|1686342_1687239_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065213371.1|1688454_1689246_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1687240:1687256	attR	AAAGGATAAAAATAAAT	NA	NA	NA	NA
WP_065213372.1|1689319_1689559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065213373.1|1702558_1703671_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.4	2.3e-133
WP_065213317.1|1704397_1704709_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	1792551	1839854	3171081	transposase,tRNA,protease	Streptococcus_phage(28.57%)	37	NA	NA
WP_065213946.1|1792551_1794030_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	35.4	5.0e-91
WP_014165564.1|1794585_1794837_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_014165563.1|1795054_1796854_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.2	1.8e-21
WP_065213947.1|1797262_1799455_-	radical SAM protein	NA	NA	NA	NA	NA
WP_081279006.1|1800004_1801693_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_065213416.1|1802521_1802770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014165559.1|1803075_1804662_+	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_014165558.1|1804748_1805168_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	37.5	2.0e-16
WP_065213417.1|1805805_1806465_-	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_065213418.1|1806474_1807740_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_014165555.1|1807855_1808131_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_014165554.1|1808162_1808999_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014165553.1|1809281_1809776_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_065213419.1|1809815_1810496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213420.1|1810529_1812194_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_014165550.1|1812277_1812619_+	DUF2853 family protein	NA	NA	NA	NA	NA
WP_014165549.1|1812699_1813533_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014165548.1|1813753_1814458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213421.1|1814429_1814924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014165546.1|1814984_1816397_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	31.9	9.2e-58
WP_065213422.1|1816530_1817247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014165544.1|1817603_1818452_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	34.4	3.8e-27
WP_065213423.1|1818506_1819343_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	28.4	1.3e-27
WP_065213424.1|1820942_1824587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213425.1|1824733_1825270_+	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_158649145.1|1825302_1826979_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_102135421.1|1827238_1828675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014165537.1|1828951_1830196_+	ornithine--oxo-acid transaminase	NA	NA	NA	NA	NA
WP_065213426.1|1830343_1830619_-	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
WP_014165535.1|1830701_1831247_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_065213427.1|1831248_1832169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213428.1|1832253_1833909_+	glucose transporter	NA	NA	NA	NA	NA
WP_014165532.1|1833992_1834880_+	EamA family transporter	NA	NA	NA	NA	NA
WP_014165531.1|1835049_1835955_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_014165530.1|1836486_1837389_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_065213429.1|1837770_1839660_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.1	7.3e-143
WP_080572519.1|1839734_1839854_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	2230601	2266293	3171081	transposase	Leptospira_phage(50.0%)	32	NA	NA
WP_014164599.1|2230601_2230841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065213582.1|2230904_2231768_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.7	1.7e-38
WP_014164597.1|2232068_2232959_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_014164596.1|2232969_2235084_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014164595.1|2235401_2236187_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_065213583.1|2236294_2237242_+	FemAB family protein	NA	NA	NA	NA	NA
WP_041253162.1|2237300_2238383_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.2	2.0e-44
WP_065213584.1|2238477_2240004_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_081279016.1|2240262_2241414_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_014164590.1|2241604_2242351_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_065213586.1|2242479_2244507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014164588.1|2245069_2246311_-	peptidase T	NA	NA	NA	NA	NA
WP_014164587.1|2246313_2247372_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014164586.1|2247429_2247966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014164585.1|2248362_2249202_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014164584.1|2249618_2250533_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_014164583.1|2250532_2251315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014164582.1|2251611_2252820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014164581.1|2252840_2253887_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_065213587.1|2254358_2255180_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065213588.1|2255337_2255565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_123906937.1|2255822_2256110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014164506.1|2256504_2256879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065213589.1|2256930_2258535_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014164508.1|2258639_2259266_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_065213590.1|2259332_2260751_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_065213591.1|2260835_2262260_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_081279017.1|2262256_2262481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014164512.1|2262943_2263132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065213593.1|2263410_2264883_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	2.4e-101
WP_065213594.1|2265086_2265422_+	acyltransferase	NA	NA	NA	NA	NA
WP_081279018.1|2265429_2266293_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	6.2e-41
>prophage 8
NZ_CP016277	Flavobacterium columnare strain Pf1 isolate Yellow catfish chromosome, complete genome	3171081	2943655	2953919	3171081		Bacillus_virus(22.22%)	12	NA	NA
WP_014166646.1|2943655_2944348_+	NUDIX hydrolase	NA	A0A1B0V161	Roseobacter_phage	32.8	1.8e-06
WP_065213828.1|2944725_2945577_+	ribose-phosphate pyrophosphokinase	NA	A0A0S1RV70	Klebsiella_phage	42.6	9.5e-42
WP_081279028.1|2945554_2946397_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	39.2	2.5e-42
WP_065213830.1|2946496_2947033_+	NADAR family protein	NA	A8E2M1	Enterococcus_phage	47.1	3.9e-41
WP_065213831.1|2947029_2947872_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_065213832.1|2947868_2948837_+	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	27.6	9.2e-25
WP_065213833.1|2948912_2949470_+	2OG-Fe(II) oxygenase	NA	M1PY53	Moumouvirus	30.8	2.5e-14
WP_065213834.1|2949537_2950380_+	RNAse Z	NA	A0A1V0SBU2	Catovirus	24.9	6.3e-06
WP_065213835.1|2950452_2951898_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_065213836.1|2951997_2952501_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	52.8	3.8e-30
WP_065213837.1|2952744_2953380_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_065213838.1|2953376_2953919_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	53.6	4.6e-50
