The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	451469	491441	5214168	integrase,holin,transposase,protease	Mycobacterium_phage(33.33%)	38	481347:481362	492703:492718
WP_047328137.1|451469_452441_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_012296304.1|452442_454878_-	transglycosylase/D,D-transpeptidase PonA2	NA	NA	NA	NA	NA
WP_012296305.1|455116_455455_+	WhiB family transcriptional regulator	NA	A0A220NS58	Mycobacterium_phage	45.3	8.4e-10
WP_005083535.1|455541_456663_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_012296306.1|456659_457703_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_005063257.1|457761_457923_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_005092109.1|457919_458393_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	31.6	5.7e-12
WP_005063262.1|458392_459178_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005083532.1|459184_460030_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005063269.1|460043_460718_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_005113011.1|460813_461176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012296307.1|461342_462140_+	endonuclease III	NA	NA	NA	NA	NA
WP_005113013.1|462141_462795_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005083528.1|462798_463563_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005083527.1|463559_464825_+|protease	acid resistance serine protease MarP	protease	NA	NA	NA	NA
WP_005083526.1|464798_465761_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005072577.1|465793_466315_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005072578.1|466564_467260_+	peptidase	NA	NA	NA	NA	NA
WP_005086931.1|467361_469338_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.3	5.9e-79
WP_005086928.1|469521_471141_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005113014.1|471137_472109_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005113015.1|472101_473016_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012296308.1|473016_474666_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.6e-21
WP_012296309.1|474690_475434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005083519.1|475849_476731_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_005113018.1|477114_478188_+	helicase	NA	NA	NA	NA	NA
WP_005113019.1|478184_479261_+	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_047040733.1|480033_481347_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.3	3.5e-205
481347:481362	attL	CGGGCGTGCCTTCCCG	NA	NA	NA	NA
WP_005117920.1|482662_482920_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005113024.1|482982_483669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005113025.1|483809_484091_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_005113027.1|484225_485005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113028.1|485138_485357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079851503.1|485557_485779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113033.1|485981_486701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005113034.1|486753_487995_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	33.8	2.8e-10
WP_012296311.1|487921_489223_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005113038.1|489209_491441_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
492703:492718	attR	CGGGCGTGCCTTCCCG	NA	NA	NA	NA
>prophage 2
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	2295715	2341555	5214168	integrase,transposase,protease,tRNA	Bacillus_phage(50.0%)	39	2316297:2316356	2327483:2327671
WP_005086043.1|2295715_2296654_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_005115909.1|2296729_2298478_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	5.3e-31
WP_005086041.1|2298477_2301066_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.7	4.9e-33
WP_005086040.1|2301133_2302525_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.9	2.7e-54
WP_005086039.1|2302524_2303436_-	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_005086038.1|2303432_2303825_-	L-ectoine synthase	NA	NA	NA	NA	NA
WP_005086037.1|2303869_2305150_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_074244151.1|2305178_2305724_-	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_005091849.1|2305950_2307594_-	FUSC family protein	NA	NA	NA	NA	NA
WP_005086034.1|2307597_2308221_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005088731.1|2308300_2309509_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_005086032.1|2309511_2309976_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_005086031.1|2309982_2310696_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005086030.1|2310789_2312055_+	MFS transporter	NA	NA	NA	NA	NA
WP_005091846.1|2312116_2312542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047328137.1|2314241_2315213_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_065204164.1|2315192_2316296_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2316297:2316356	attL	CTGATCCAAAATCTTGCTCTTGTCCGCCTTCGACGCCCTGCGGTACTGGGTCCGCAGCTT	NA	NA	NA	NA
WP_005091844.1|2317670_2318423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005110774.1|2318677_2320300_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005110776.1|2320296_2321439_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005110778.1|2321459_2322737_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.5	5.1e-15
WP_005086023.1|2322774_2323272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005075257.1|2323310_2323799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005086022.1|2323779_2324316_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_047328137.1|2325427_2326399_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_065204164.1|2326378_2327482_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_043988055.1|2329850_2330822_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
2327483:2327671	attR	CTGATCCAAAATCTTGCTCTTGTCCGCCTTCGACGCCCTGCGGTACTGGGTCCGCAGCTTGTTGGCTACCTGCCGTCTCGCGGCCATGTCGATCTTGCCTTCCACAACGGGCAAGCCTTCGGGGCCACGCGCTCAAAGTAGGTGAGGCACCACCACCCGCCACGCGCTCAAATTCAGTGAGGCACGTCG	NA	NA	NA	NA
WP_005110781.1|2331066_2332386_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005110783.1|2332413_2333400_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_005088716.1|2333468_2334224_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012296529.1|2334261_2334705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012296530.1|2334644_2335595_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005088710.1|2335596_2335785_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_005086013.1|2335859_2336495_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005110790.1|2336504_2336999_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_052612354.1|2337004_2338126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005115912.1|2338367_2338823_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005091833.1|2338819_2340301_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005086006.1|2340346_2341555_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	2624496	2670350	5214168	integrase,transposase	Bacillus_phage(33.33%)	47	2635301:2635316	2652066:2652081
WP_043988055.1|2624496_2625468_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005111103.1|2626659_2627313_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005058086.1|2627368_2627920_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005058085.1|2628257_2628506_+	DUF3297 family protein	NA	NA	NA	NA	NA
WP_052612273.1|2628851_2629526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122624.1|2629914_2630169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043371284.1|2630516_2631779_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_074232791.1|2631979_2632429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043988055.1|2633574_2634546_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005122627.1|2635060_2635738_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.9	9.9e-26
2635301:2635316	attL	GGTTCCGGCGCGTTCG	NA	NA	NA	NA
WP_005122628.1|2636133_2636946_+	membrane protein	NA	NA	NA	NA	NA
WP_005122630.1|2636973_2637174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005122632.1|2637459_2638701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005122633.1|2638990_2639323_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005122635.1|2639326_2640415_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012296566.1|2641711_2641963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082111.1|2642278_2643028_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	3.4e-35
WP_005082113.1|2643146_2644559_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.3	5.8e-12
WP_005111108.1|2644727_2645447_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_005111110.1|2645715_2646741_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_012296567.1|2646649_2647000_+	ectoine synthase	NA	NA	NA	NA	NA
WP_005114383.1|2647134_2647809_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_005111115.1|2647907_2648873_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012296568.1|2648956_2649487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082127.1|2649503_2650277_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_005082129.1|2650347_2651112_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_047328144.1|2651220_2652192_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
2652066:2652081	attR	CGAACGCGCCGGAACC	NA	NA	NA	NA
WP_074304272.1|2652188_2652926_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_005111118.1|2653088_2653667_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005086751.1|2653724_2654159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082136.1|2654216_2654648_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005082139.1|2654651_2655098_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005082141.1|2655181_2655517_+	YnfA family protein	NA	NA	NA	NA	NA
WP_005111120.1|2655513_2656773_+	amino acid permease	NA	NA	NA	NA	NA
WP_005082147.1|2656747_2657746_-	cation transporter	NA	NA	NA	NA	NA
WP_005126012.1|2657745_2658129_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	29.8	2.4e-05
WP_005086746.1|2658169_2658847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082154.1|2658846_2659167_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005111122.1|2659209_2661012_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005111124.1|2661034_2661664_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005111128.1|2661782_2663105_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.0	1.3e-05
WP_005111129.1|2663101_2664016_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005093450.1|2664008_2665661_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_005086731.1|2666022_2667348_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.7	5.5e-12
WP_005082162.1|2667331_2668162_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005082163.1|2668164_2669250_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_047328144.1|2669378_2670350_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	2957604	2966163	5214168		Streptococcus_phage(16.67%)	7	NA	NA
WP_005068898.1|2957604_2958276_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.1	4.9e-17
WP_005093596.1|2958389_2959313_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	31.6	1.1e-08
WP_005091054.1|2959314_2960184_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	45.6	5.8e-55
WP_005068903.1|2960285_2962652_-	RelA/SpoT family protein	NA	A0A291L9W9	Bordetella_phage	38.4	1.8e-13
WP_005082386.1|2962682_2963216_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	36.4	8.1e-15
WP_005093597.1|2963212_2964889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005090079.1|2964888_2966163_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.6	1.5e-22
>prophage 5
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	2971429	3029478	5214168	transposase,protease,tRNA	Tupanvirus(50.0%)	55	NA	NA
WP_047328137.1|2971429_2972401_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005057549.1|2972520_2972940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012296605.1|2973126_2973738_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005057545.1|2973683_2974439_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005111401.1|2974518_2975046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082395.1|2975127_2975709_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_005068926.1|2975705_2976557_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_012296606.1|2976566_2977589_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_005090088.1|2977566_2978589_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_005090090.1|2978585_2979713_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005082398.1|2979712_2980678_-	phosphatidylinositol mannoside acyltransferase	NA	NA	NA	NA	NA
WP_005057532.1|2980674_2981337_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_005057529.1|2981333_2981882_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_005082399.1|2981874_2983929_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.0	3.6e-103
WP_012296607.1|2984021_2985116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005082401.1|2985209_2985980_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_005082403.1|2985960_2986590_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_012296608.1|2986624_2987107_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
WP_005082406.1|2987330_2987651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204061.1|2988134_2989538_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_005082408.1|2989672_2989855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082410.1|2989936_2990359_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005082413.1|2990361_2991726_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005082414.1|2991728_2992820_-	phenazine antibiotic biosynthesis protein	NA	NA	NA	NA	NA
WP_005082418.1|2992909_2993179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005115945.1|2993171_2994197_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_005082421.1|2994270_2994660_-	RidA family protein	NA	NA	NA	NA	NA
WP_005082423.1|2994707_2995730_-	dipeptidase	NA	NA	NA	NA	NA
WP_005082425.1|2995764_2996580_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_005082426.1|2996784_2997447_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005111414.1|2997603_2999088_+	amino acid permease	NA	NA	NA	NA	NA
WP_074232793.1|2999368_2999944_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005111421.1|2999921_3001610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005090104.1|3002126_3003173_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005090106.1|3003774_3004662_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_005090108.1|3004914_3007143_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_005093617.1|3007225_3007897_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005114439.1|3008167_3008350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043988055.1|3008855_3009827_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_012296610.1|3010130_3010571_+	bacteriophage protein	NA	NA	NA	NA	NA
WP_005090116.1|3011268_3012099_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_005090118.1|3012095_3012836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005093625.1|3012844_3013918_-	XdhC family protein	NA	NA	NA	NA	NA
WP_047328137.1|3015066_3016038_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005076312.1|3017699_3018512_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
WP_012296611.1|3018511_3019882_-	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_012296612.1|3019944_3021351_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005057393.1|3021347_3022256_-	urate oxidase	NA	NA	NA	NA	NA
WP_005057392.1|3022270_3022597_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_005076325.1|3022593_3023136_-	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_005111438.1|3023122_3025117_-	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_005057387.1|3025238_3025949_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005057383.1|3026104_3026845_+	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_012296613.1|3026799_3027777_-	allantoinase PuuE	NA	NA	NA	NA	NA
WP_019344575.1|3028164_3029478_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.8	2.1e-205
>prophage 6
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	4038203	4110800	5214168	terminase,protease,portal,capsid,transposase,head,integrase,tail	Mycobacterium_phage(45.95%)	98	4055578:4055595	4100065:4100082
WP_005094627.1|4038203_4039073_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_005094629.1|4039158_4040145_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005112101.1|4040183_4041413_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005061581.1|4041429_4042113_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_005080341.1|4042222_4043365_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_005061585.1|4043426_4043867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005080340.1|4043863_4045486_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005061589.1|4045498_4046335_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005080339.1|4046346_4047315_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_012296703.1|4047333_4047972_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005080337.1|4048110_4048443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005112104.1|4048502_4049204_+|protease	Clp protease	protease	B5LJM1	Mycobacterium_phage	37.7	2.8e-07
WP_005097236.1|4049236_4049686_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005112106.1|4049682_4050864_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_005094641.1|4050860_4051877_-	pirin family protein	NA	NA	NA	NA	NA
WP_005094643.1|4051926_4052271_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005080331.1|4052267_4052726_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012296704.1|4052831_4053527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005094646.1|4053582_4054527_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005080329.1|4054618_4055449_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	7.4e-07
WP_075908865.1|4055576_4055858_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
4055578:4055595	attL	TACTCGTGAGTAAGAACT	NA	NA	NA	NA
WP_065204112.1|4055992_4056193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204113.1|4056189_4056663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204114.1|4056716_4056980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065204115.1|4057129_4057903_+	hypothetical protein	NA	A0A2P1N364	Mycobacterium_phage	67.8	2.0e-43
WP_065204116.1|4058056_4058350_+	hypothetical protein	NA	A0A0A7RXV8	Mycobacterium_phage	58.8	2.9e-22
WP_065204117.1|4058349_4058682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204118.1|4058693_4058969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122814.1|4058965_4059313_+	hypothetical protein	NA	A0A142F2I3	Mycobacterium_phage	51.8	2.8e-08
WP_065204119.1|4059494_4059761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122820.1|4059757_4059949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017205692.1|4059945_4060185_+	hypothetical protein	NA	A0A2H4GST7	Mycobacterium_phage	60.6	1.4e-06
WP_065204176.1|4060211_4061069_+	recE	NA	A0A2D1G8R5	Mycobacterium_phage	53.7	1.3e-78
WP_062923744.1|4061065_4062238_+	hypothetical protein	NA	A0A2P1CGD3	Mycobacterium_phage	66.2	3.3e-93
WP_062923745.1|4062264_4062606_+	hypothetical protein	NA	G8I4S2	Mycobacterium_phage	66.4	1.1e-33
WP_062923746.1|4062627_4063470_+	DUF2303 family protein	NA	G8I4S3	Mycobacterium_phage	67.1	7.8e-105
WP_153995372.1|4063477_4063654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204120.1|4063802_4064324_+	hypothetical protein	NA	A0A1J0MDV9	Mycobacterium_phage	28.6	7.9e-07
WP_005122860.1|4064320_4064524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122861.1|4064648_4065788_+	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	37.5	1.3e-33
WP_065204121.1|4065787_4066144_+	hypothetical protein	NA	A0A222ZL32	Mycobacterium_phage	81.9	8.2e-48
WP_065204122.1|4066140_4066719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204123.1|4066798_4067710_+	hypothetical protein	NA	A0A1B3B1T0	Gordonia_phage	65.5	4.9e-44
WP_065204124.1|4067779_4068079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204125.1|4068075_4068408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204126.1|4068550_4069738_+	hypothetical protein	NA	G8I6V0	Mycobacterium_virus	26.2	4.1e-27
WP_005122870.1|4070010_4070415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122871.1|4070411_4070618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065204127.1|4070632_4070935_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	55.4	2.0e-18
WP_005122876.1|4071336_4071576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204128.1|4071572_4073141_+|terminase	terminase	terminase	A0A0U4JAE0	Arthrobacter_phage	46.5	3.7e-124
WP_005122879.1|4073342_4074641_+|portal	phage portal protein	portal	A0A142K7D9	Mycobacterium_phage	61.5	1.9e-150
WP_065204129.1|4074654_4075434_+|head,protease	HK97 family phage prohead protease	head,protease	A0A142K7Z8	Mycobacterium_phage	68.5	1.2e-86
WP_005122881.1|4075460_4076756_+|capsid	phage major capsid protein	capsid	M4WNS1	Mycobacterium_phage	64.7	2.4e-145
WP_065204130.1|4076755_4077013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204131.1|4077012_4077606_+	hypothetical protein	NA	G8I6P2	Mycobacterium_virus	40.5	1.9e-20
WP_065204132.1|4077602_4077953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065204133.1|4077952_4078342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122886.1|4078341_4078593_+	hypothetical protein	NA	A0A142KC17	Gordonia_phage	52.2	2.4e-09
WP_065204134.1|4078692_4079247_+	hypothetical protein	NA	A0A142KC18	Gordonia_phage	70.1	4.8e-71
WP_065204177.1|4079258_4079510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122890.1|4079597_4079885_+	hypothetical protein	NA	A0A142KC20	Gordonia_phage	56.0	3.5e-17
WP_065204135.1|4079893_4080349_+	hypothetical protein	NA	A0A142KC21	Gordonia_phage	63.9	1.4e-31
WP_065204136.1|4080348_4084212_+|tail	phage tail tape measure protein	tail	A0A068F1L4	Mycobacterium_phage	48.7	4.7e-165
WP_005122894.1|4084211_4085279_+	hypothetical protein	NA	A0A142KC23	Gordonia_phage	67.5	1.1e-143
WP_043988055.1|4085387_4086359_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_065204137.1|4086363_4088046_+	hypothetical protein	NA	A0A142KC24	Gordonia_phage	72.7	1.9e-256
WP_065204138.1|4088045_4088489_+	hypothetical protein	NA	A0A142KC25	Gordonia_phage	60.7	2.5e-38
WP_065204139.1|4088481_4089585_+|tail	phage tail protein	tail	A0A142KC26	Gordonia_phage	67.0	1.5e-148
WP_065204178.1|4089595_4092052_+	hypothetical protein	NA	A0A142KC27	Gordonia_phage	30.6	4.2e-74
WP_025989150.1|4092072_4092381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062923755.1|4092450_4093434_+	hypothetical protein	NA	B3VGF8	Mycobacterium_virus	49.7	2.2e-10
WP_017205726.1|4093453_4093825_+	hypothetical protein	NA	A0A2L1IWK7	Gordonia_phage	50.0	2.9e-19
WP_052614791.1|4093961_4094618_+	M15 family metallopeptidase	NA	A0A0K1LIU2	Mycobacterium_phage	69.5	5.2e-88
WP_065204140.1|4094614_4095790_+	hypothetical protein	NA	A0A1X9SFG9	Mycobacterium_phage	71.6	2.3e-126
WP_005122906.1|4095816_4096029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005122907.1|4096025_4096388_+	DUF2746 domain-containing protein	NA	NA	NA	NA	NA
WP_065204141.1|4096445_4096910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079669558.1|4096990_4098241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065204143.1|4098306_4098603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065204144.1|4098670_4098931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065204145.1|4099031_4099946_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	30.8	3.6e-23
WP_005061787.1|4100069_4100957_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
4100065:4100082	attR	TACTCGTGAGTAAGAACT	NA	NA	NA	NA
WP_005080328.1|4100984_4101371_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_005077815.1|4101401_4101683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005098430.1|4101712_4103032_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_005094654.1|4103016_4103232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005080326.1|4103202_4103637_+	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_005098433.1|4103633_4104782_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_012296705.1|4104778_4105336_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005080323.1|4105336_4105795_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_005080322.1|4105847_4106345_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_005080321.1|4106341_4107115_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_012296706.1|4107303_4108053_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.2	1.6e-37
WP_005094666.1|4108093_4108966_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_012296707.1|4108962_4109505_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_005061819.1|4109550_4109772_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_043988055.1|4109828_4110800_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	4276869	4286361	5214168		Burkholderia_phage(25.0%)	8	NA	NA
WP_005112210.1|4276869_4277994_-	acyltransferase	NA	A9YX16	Burkholderia_phage	28.4	2.3e-19
WP_005085927.1|4277990_4279259_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	3.3e-06
WP_012296730.1|4279308_4280115_-	macrocin O-methyltransferase	NA	A0A2R8FDY2	Brazilian_cedratvirus	52.6	4.9e-56
WP_005085925.1|4280325_4281018_-	class I SAM-dependent methyltransferase	NA	Q98VI8	Paramecium_bursaria_Chlorella_virus	30.2	3.7e-12
WP_005112211.1|4281250_4282381_-	acyltransferase	NA	A9YX16	Burkholderia_phage	27.6	4.1e-16
WP_005085923.1|4282548_4283610_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3IB24	Synechococcus_phage	26.1	4.1e-18
WP_005094865.1|4283772_4285032_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	39.2	1.6e-05
WP_005062166.1|4285494_4286361_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	57.5	2.8e-89
>prophage 8
NZ_CP016192	Mycobacteroides abscessus strain FLAC046 chromosome, complete genome	5214168	5106828	5147029	5214168	integrase,transposase	Gordonia_phage(33.33%)	43	5104664:5104683	5150117:5150136
5104664:5104683	attL	GCGTGGTGGCGGTGGCGGCG	NA	NA	NA	NA
WP_043988055.1|5106828_5107800_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_154021781.1|5107858_5108035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012296813.1|5108130_5108535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012296814.1|5108645_5109245_+	MPT63 family protein	NA	NA	NA	NA	NA
WP_012296815.1|5109490_5109841_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_005112734.1|5109837_5110782_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_005135561.1|5110842_5111790_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_005125282.1|5111858_5112212_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005112737.1|5112323_5112707_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005112738.1|5112703_5113831_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_005112739.1|5113835_5114273_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_005112740.1|5114349_5115768_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_005112741.1|5115811_5116153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012296816.1|5116133_5118098_-	dCTP deaminase	NA	NA	NA	NA	NA
WP_005112744.1|5118122_5118614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005114846.1|5119016_5119382_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005112749.1|5119386_5120085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005114847.1|5120147_5120411_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012296817.1|5120694_5121153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005112752.1|5121286_5121685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005112753.1|5121677_5123933_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005112754.1|5123919_5125128_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005112755.1|5125144_5126347_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	28.8	1.5e-16
WP_005112756.1|5126405_5127155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005112757.1|5127536_5128472_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005116118.1|5128468_5129125_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012296818.1|5129130_5130879_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	24.3	2.4e-15
WP_005112760.1|5130749_5132027_-	MFS transporter	NA	NA	NA	NA	NA
WP_005112761.1|5132023_5132737_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005112763.1|5132733_5133594_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005112765.1|5133594_5134095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005116120.1|5134326_5134746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012296819.1|5134774_5135272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005112771.1|5135268_5136483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005112772.1|5136469_5136910_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005112773.1|5137127_5137592_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_052612356.1|5137641_5138019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005118249.1|5138141_5139503_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005116465.1|5139499_5140354_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	37.8	2.2e-38
WP_005112775.1|5140576_5143117_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005112777.1|5143113_5144190_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005112778.1|5144186_5146400_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021268860.1|5146396_5147029_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
5150117:5150136	attR	CGCCGCCACCGCCACCACGC	NA	NA	NA	NA
