The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016029	Legionella pneumophila strain Pontiac chromosome, complete genome	3545003	987650	994489	3545003		Acinetobacter_phage(42.86%)	9	NA	NA
WP_011945950.1|987650_988427_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	1.9e-57
WP_014841226.1|988419_989454_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.3	2.7e-75
WP_014841227.1|989431_990010_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	1.0e-55
WP_010946572.1|990043_990769_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_041174037.1|990765_991275_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|991255_991825_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|991821_992349_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|992362_993325_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|993691_994489_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP016029	Legionella pneumophila strain Pontiac chromosome, complete genome	3545003	1143149	1149468	3545003		Escherichia_phage(33.33%)	9	NA	NA
WP_013101291.1|1143149_1143818_+	SOS response-associated peptidase	NA	S5VY94	Leptospira_phage	24.7	5.7e-10
WP_011215133.1|1143952_1144459_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	2.3e-27
WP_027266380.1|1144445_1145723_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	46.0	4.2e-94
WP_050598142.1|1146233_1146482_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	59.7	1.5e-19
WP_080275907.1|1146508_1146604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042755010.1|1146610_1147216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027265458.1|1147467_1148406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027265457.1|1148473_1148980_-	antirestriction protein ArdA	NA	A0A0H4TJV8	Mycobacterium_phage	33.3	3.4e-15
WP_027265456.1|1149045_1149468_-	single-stranded DNA-binding protein	NA	A0A077SK05	Escherichia_phage	42.2	1.6e-18
>prophage 3
NZ_CP016029	Legionella pneumophila strain Pontiac chromosome, complete genome	3545003	1379297	1385234	3545003		Staphylococcus_phage(50.0%)	6	NA	NA
WP_027220755.1|1379297_1380371_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	28.6	2.1e-30
WP_027220754.1|1380355_1380970_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	6.0e-22
WP_027220753.1|1380966_1382175_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.5	3.5e-98
WP_050598095.1|1382182_1382650_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1382775_1384413_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1384409_1385234_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 4
NZ_CP016029	Legionella pneumophila strain Pontiac chromosome, complete genome	3545003	2297226	2307350	3545003		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2297226_2298915_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2299046_2300054_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014844301.1|2300177_2301503_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.1e-47
WP_011214269.1|2301522_2302671_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_027220141.1|2302879_2303992_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	2.3e-51
WP_010947740.1|2304087_2305227_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011946925.1|2305415_2307350_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 5
NZ_CP016029	Legionella pneumophila strain Pontiac chromosome, complete genome	3545003	2768321	2801354	3545003	integrase,transposase	Acinetobacter_phage(25.0%)	31	2789263:2789322	2800008:2800069
WP_014842361.1|2768321_2771366_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014842362.1|2772036_2773185_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014842363.1|2773214_2774333_+	DUF3494 domain-containing protein	NA	NA	NA	NA	NA
WP_154080660.1|2774636_2774795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027265134.1|2774842_2775184_+	helix-turn-helix domain-containing protein	NA	A0A218MNC9	uncultured_virus	39.0	4.5e-11
WP_027265133.1|2775200_2775692_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.8	1.3e-11
WP_014842364.1|2775940_2776192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842365.1|2776272_2776467_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014842366.1|2776599_2776953_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_014842368.1|2777809_2778313_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014842369.1|2778315_2779497_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_065211439.1|2779801_2779969_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_014842370.1|2780093_2781299_+	aminotransferase	NA	NA	NA	NA	NA
WP_014842371.1|2781505_2783281_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_080031823.1|2783620_2784055_+	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_014842373.1|2784090_2784417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_110540214.1|2784475_2784916_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014842375.1|2784931_2785258_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_014842376.1|2785525_2786536_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014842377.1|2786830_2787166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842378.1|2787335_2788667_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	35.6	3.0e-58
2789263:2789322	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAATAAAATCAAGTAGT	NA	NA	NA	NA
WP_014842379.1|2789422_2790298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842380.1|2790429_2791935_-	cytidine deaminase	NA	V9LZ62	Vibrio_phage	36.4	9.9e-10
WP_027220509.1|2792332_2792863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842383.1|2793079_2793445_-	TraK family protein	NA	NA	NA	NA	NA
WP_014842384.1|2793883_2795650_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	29.7	2.6e-54
WP_014842385.1|2795729_2795984_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	40.6	5.5e-06
WP_014842386.1|2796446_2797253_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_027220510.1|2797264_2797936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842389.1|2798618_2799848_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	32.8	1.8e-49
WP_042754787.1|2800178_2801354_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	5.5e-16
2800008:2800069	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAATAAAATCAAGTAGTTA	NA	NA	NA	NA
