The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	787959	858997	3486107	tRNA,holin,transposase	uncultured_virus(14.29%)	57	NA	NA
WP_010946555.1|787959_789045_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|789070_789364_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_042233480.1|789389_790535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213249.1|790543_791983_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011213250.1|792307_794089_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.8	3.0e-13
WP_011213251.1|794130_794784_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011213252.1|794997_795462_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011213253.1|795458_796238_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213254.1|796230_797100_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_011213255.1|797105_797360_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213256.1|797696_798722_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011213257.1|798837_801054_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213258.1|801095_801860_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_011213259.1|801896_802169_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213260.1|802161_803475_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.7	5.6e-17
WP_011213261.1|803494_804310_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213262.1|804302_805130_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010946414.1|805427_805694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213263.1|805948_806701_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213264.1|806838_809580_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_025519356.1|809844_811056_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011213266.1|811123_811696_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011213267.1|811688_812615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.6e-18
WP_025519358.1|812629_813748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213269.1|813817_815137_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011213270.1|815226_816987_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_010946424.1|817172_817463_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	48.9	1.5e-18
WP_011213271.1|817490_819137_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	4.1e-174
WP_011213272.1|819259_819700_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_011213273.1|819956_822074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213274.1|822407_824288_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	6.0e-97
WP_011213275.1|824421_826230_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.8e-13
WP_011213276.1|826318_830602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213277.1|830959_832669_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	30.1	6.6e-10
WP_080019926.1|832830_835680_+	Dot/Icm T4SS effector AnkX	NA	A0A2L2DMI5	Acanthamoeba_polyphaga_mimivirus	22.7	1.6e-08
WP_080019927.1|835686_837399_-|holin	T4SS effector phosphocholine hydrolase Lem3	holin	NA	NA	NA	NA
WP_010946434.1|837485_839792_-	bifunctional SulP family inorganic anion transporter/carbonic anhydrase	NA	NA	NA	NA	NA
WP_011213280.1|839981_840833_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.9	8.8e-72
WP_010946436.1|840850_842218_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011213281.1|842229_842880_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011213282.1|843060_844245_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.0e-41
WP_011213283.1|844331_845354_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.7	3.8e-13
WP_011213284.1|845396_847070_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.9	1.1e-44
WP_010946441.1|847111_847723_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011213285.1|847832_848270_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011213286.1|848269_848695_+	transporter	NA	NA	NA	NA	NA
WP_011213287.1|848734_849907_-	membrane protein	NA	NA	NA	NA	NA
WP_011213288.1|849963_850938_-	type IV secretion system protein IcmL	NA	NA	NA	NA	NA
WP_011213289.1|850950_851910_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_014841157.1|852199_853009_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213291.1|853008_854220_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_011213292.1|854246_854942_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_011213293.1|854941_856942_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_021437009.1|857326_857635_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_104411335.1|857724_858454_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	1.5e-24
WP_021437011.1|858430_858673_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_021437012.1|858688_858997_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	997643	1004483	3486107		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|997643_998420_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|998412_999447_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|999424_1000003_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|1000036_1000762_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|1000758_1001268_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|1001248_1001818_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|1001814_1002342_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1002355_1003318_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1003685_1004483_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 3
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	1307380	1313317	3486107		Staphylococcus_phage(50.0%)	6	NA	NA
WP_011213534.1|1307380_1308454_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	9.5e-31
WP_011213535.1|1308438_1309053_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_011213536.1|1309049_1310258_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	1.0e-97
WP_010946914.1|1310265_1310733_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1310858_1312496_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1312492_1313317_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 4
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2027053	2098529	3486107	protease,integrase,tRNA,transposase	Tupanvirus(20.0%)	59	2032496:2032555	2082208:2082270
WP_010947570.1|2027053_2027491_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010947571.1|2027708_2028491_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011214098.1|2028599_2029559_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011214099.1|2029558_2030854_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010946556.1|2031012_2031306_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946555.1|2031331_2032417_-|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
2032496:2032555	attL	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACA	NA	NA	NA	NA
WP_011214101.1|2032869_2033766_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011214102.1|2033769_2034051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021437159.1|2034037_2034388_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011214104.1|2034421_2035084_-	Dot/Icm T4SS effector Lem14	NA	NA	NA	NA	NA
WP_011214105.1|2035453_2037091_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014841922.1|2037143_2037782_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_027229338.1|2037895_2038684_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_080454273.1|2039135_2041976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214109.1|2042482_2043109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214110.1|2043391_2046526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214111.1|2047098_2048973_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011214112.1|2049230_2049509_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_010947583.1|2049637_2052088_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	5.1e-213
WP_011214113.1|2052321_2053596_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.2	1.4e-134
WP_010947585.1|2053736_2054381_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_010947586.1|2054383_2055715_-	trigger factor	NA	NA	NA	NA	NA
WP_011214115.1|2056585_2057812_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011214116.1|2057934_2059785_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	5.6e-71
WP_011214117.1|2059812_2060487_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	7.5e-26
WP_011214118.1|2060476_2060869_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011214119.1|2060880_2061636_-	signal peptidase I	NA	NA	NA	NA	NA
WP_032802662.1|2061743_2063549_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.1e-22
WP_011214120.1|2063770_2064787_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011214121.1|2064861_2066001_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_011214122.1|2065997_2066468_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_011214123.1|2066571_2067105_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011214124.1|2067379_2068705_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_014844191.1|2068968_2072199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214126.1|2073077_2074610_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_014844192.1|2074630_2075695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214128.1|2075786_2076227_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_010947600.1|2076461_2076989_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_011214129.1|2077225_2078443_+	Dot/Icm T4SS effector LegC2/YlfB	NA	NA	NA	NA	NA
WP_011214130.1|2078764_2079079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214131.1|2079243_2080353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214132.1|2080783_2081869_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|2081894_2082188_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011214133.1|2082365_2082641_-	acylphosphatase	NA	NA	NA	NA	NA
2082208:2082270	attR	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACAGAG	NA	NA	NA	NA
WP_011214134.1|2082797_2083151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214135.1|2083332_2084664_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_011214136.1|2084892_2085858_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.6	1.9e-78
WP_080020008.1|2085921_2087643_-	Dot/Icm T4SS effector LegLC8	NA	NA	NA	NA	NA
WP_013101554.1|2087754_2088021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214139.1|2088074_2088494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214140.1|2088503_2089784_-	MFS transporter	NA	NA	NA	NA	NA
WP_011214141.1|2090260_2091541_+	chloride channel protein	NA	NA	NA	NA	NA
WP_021437098.1|2091739_2091955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021437099.1|2092123_2093191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214144.1|2093431_2093935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214145.1|2094198_2094678_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011214146.1|2094697_2096503_+	potassium transporter	NA	NA	NA	NA	NA
WP_011214148.1|2098079_2098415_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_080020154.1|2098406_2098529_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2246216	2256339	3486107		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2246216_2247905_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2248036_2249044_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011214268.1|2249167_2250493_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2250511_2251660_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011214270.1|2251868_2252981_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.7e-51
WP_010947740.1|2253076_2254216_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011214271.1|2254404_2256339_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	3.8e-147
>prophage 6
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2632451	2640697	3486107	integrase,tRNA,transposase	Moraxella_phage(16.67%)	7	2636608:2636620	2641553:2641565
WP_015961445.1|2632451_2633453_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	3.4e-91
WP_010948064.1|2633657_2633897_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014842313.1|2634099_2634543_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.2	1.1e-20
WP_015961446.1|2634551_2636285_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_014844507.1|2636371_2638237_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2636608:2636620	attL	TATTGAAGAAGCA	NA	NA	NA	NA
WP_011213396.1|2638577_2639753_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_032831057.1|2639818_2640697_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	46.7	5.9e-71
2641553:2641565	attR	TGCTTCTTCAATA	NA	NA	NA	NA
>prophage 1
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	787959	858997	3486107	tRNA,holin,transposase	uncultured_virus(14.29%)	57	NA	NA
WP_010946555.1|787959_789045_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|789070_789364_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_042233480.1|789389_790535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213249.1|790543_791983_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011213250.1|792307_794089_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.8	3.0e-13
WP_011213251.1|794130_794784_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011213252.1|794997_795462_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011213253.1|795458_796238_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213254.1|796230_797100_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_011213255.1|797105_797360_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213256.1|797696_798722_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011213257.1|798837_801054_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213258.1|801095_801860_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_011213259.1|801896_802169_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213260.1|802161_803475_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.7	5.6e-17
WP_011213261.1|803494_804310_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213262.1|804302_805130_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010946414.1|805427_805694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213263.1|805948_806701_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213264.1|806838_809580_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_025519356.1|809844_811056_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011213266.1|811123_811696_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011213267.1|811688_812615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.6e-18
WP_025519358.1|812629_813748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213269.1|813817_815137_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011213270.1|815226_816987_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_010946424.1|817172_817463_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	48.9	1.5e-18
WP_011213271.1|817490_819137_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	4.1e-174
WP_011213272.1|819259_819700_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_011213273.1|819956_822074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213274.1|822407_824288_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	6.0e-97
WP_011213275.1|824421_826230_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.8e-13
WP_011213276.1|826318_830602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213277.1|830959_832669_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	30.1	6.6e-10
WP_080019926.1|832830_835680_+	Dot/Icm T4SS effector AnkX	NA	A0A2L2DMI5	Acanthamoeba_polyphaga_mimivirus	22.7	1.6e-08
WP_080019927.1|835686_837399_-|holin	T4SS effector phosphocholine hydrolase Lem3	holin	NA	NA	NA	NA
WP_010946434.1|837485_839792_-	bifunctional SulP family inorganic anion transporter/carbonic anhydrase	NA	NA	NA	NA	NA
WP_011213280.1|839981_840833_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.9	8.8e-72
WP_010946436.1|840850_842218_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011213281.1|842229_842880_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011213282.1|843060_844245_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.0e-41
WP_011213283.1|844331_845354_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.7	3.8e-13
WP_011213284.1|845396_847070_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.9	1.1e-44
WP_010946441.1|847111_847723_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011213285.1|847832_848270_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011213286.1|848269_848695_+	transporter	NA	NA	NA	NA	NA
WP_011213287.1|848734_849907_-	membrane protein	NA	NA	NA	NA	NA
WP_011213288.1|849963_850938_-	type IV secretion system protein IcmL	NA	NA	NA	NA	NA
WP_011213289.1|850950_851910_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_014841157.1|852199_853009_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213291.1|853008_854220_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_011213292.1|854246_854942_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_011213293.1|854941_856942_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_021437009.1|857326_857635_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_104411335.1|857724_858454_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	1.5e-24
WP_021437011.1|858430_858673_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_021437012.1|858688_858997_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	997643	1004483	3486107		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|997643_998420_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|998412_999447_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|999424_1000003_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|1000036_1000762_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|1000758_1001268_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|1001248_1001818_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|1001814_1002342_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1002355_1003318_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1003685_1004483_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 3
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	1307380	1313317	3486107		Staphylococcus_phage(50.0%)	6	NA	NA
WP_011213534.1|1307380_1308454_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	9.5e-31
WP_011213535.1|1308438_1309053_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_011213536.1|1309049_1310258_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	1.0e-97
WP_010946914.1|1310265_1310733_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1310858_1312496_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1312492_1313317_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 4
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2027053	2098529	3486107	protease,integrase,tRNA,transposase	Tupanvirus(20.0%)	59	2032496:2032555	2082208:2082270
WP_010947570.1|2027053_2027491_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010947571.1|2027708_2028491_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011214098.1|2028599_2029559_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011214099.1|2029558_2030854_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010946556.1|2031012_2031306_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946555.1|2031331_2032417_-|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
2032496:2032555	attL	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACA	NA	NA	NA	NA
WP_011214101.1|2032869_2033766_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011214102.1|2033769_2034051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021437159.1|2034037_2034388_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011214104.1|2034421_2035084_-	Dot/Icm T4SS effector Lem14	NA	NA	NA	NA	NA
WP_011214105.1|2035453_2037091_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014841922.1|2037143_2037782_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_027229338.1|2037895_2038684_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_080454273.1|2039135_2041976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214109.1|2042482_2043109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214110.1|2043391_2046526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214111.1|2047098_2048973_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011214112.1|2049230_2049509_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_010947583.1|2049637_2052088_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	5.1e-213
WP_011214113.1|2052321_2053596_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.2	1.4e-134
WP_010947585.1|2053736_2054381_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_010947586.1|2054383_2055715_-	trigger factor	NA	NA	NA	NA	NA
WP_011214115.1|2056585_2057812_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011214116.1|2057934_2059785_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	5.6e-71
WP_011214117.1|2059812_2060487_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	7.5e-26
WP_011214118.1|2060476_2060869_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011214119.1|2060880_2061636_-	signal peptidase I	NA	NA	NA	NA	NA
WP_032802662.1|2061743_2063549_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.1e-22
WP_011214120.1|2063770_2064787_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011214121.1|2064861_2066001_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_011214122.1|2065997_2066468_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_011214123.1|2066571_2067105_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011214124.1|2067379_2068705_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_014844191.1|2068968_2072199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214126.1|2073077_2074610_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_014844192.1|2074630_2075695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214128.1|2075786_2076227_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_010947600.1|2076461_2076989_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_011214129.1|2077225_2078443_+	Dot/Icm T4SS effector LegC2/YlfB	NA	NA	NA	NA	NA
WP_011214130.1|2078764_2079079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214131.1|2079243_2080353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214132.1|2080783_2081869_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|2081894_2082188_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011214133.1|2082365_2082641_-	acylphosphatase	NA	NA	NA	NA	NA
2082208:2082270	attR	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACAGAG	NA	NA	NA	NA
WP_011214134.1|2082797_2083151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214135.1|2083332_2084664_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_011214136.1|2084892_2085858_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.6	1.9e-78
WP_080020008.1|2085921_2087643_-	Dot/Icm T4SS effector LegLC8	NA	NA	NA	NA	NA
WP_013101554.1|2087754_2088021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214139.1|2088074_2088494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214140.1|2088503_2089784_-	MFS transporter	NA	NA	NA	NA	NA
WP_011214141.1|2090260_2091541_+	chloride channel protein	NA	NA	NA	NA	NA
WP_021437098.1|2091739_2091955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021437099.1|2092123_2093191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214144.1|2093431_2093935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214145.1|2094198_2094678_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011214146.1|2094697_2096503_+	potassium transporter	NA	NA	NA	NA	NA
WP_011214148.1|2098079_2098415_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_080020154.1|2098406_2098529_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2246216	2256339	3486107		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2246216_2247905_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2248036_2249044_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011214268.1|2249167_2250493_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2250511_2251660_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011214270.1|2251868_2252981_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.7e-51
WP_010947740.1|2253076_2254216_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011214271.1|2254404_2256339_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	3.8e-147
>prophage 6
NZ_CP016030	Legionella pneumophila strain OLDA chromosome, complete genome	3486107	2632451	2640697	3486107	integrase,tRNA,transposase	Moraxella_phage(16.67%)	7	2636608:2636620	2641553:2641565
WP_015961445.1|2632451_2633453_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	3.4e-91
WP_010948064.1|2633657_2633897_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014842313.1|2634099_2634543_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.2	1.1e-20
WP_015961446.1|2634551_2636285_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_014844507.1|2636371_2638237_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2636608:2636620	attL	TATTGAAGAAGCA	NA	NA	NA	NA
WP_011213396.1|2638577_2639753_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_032831057.1|2639818_2640697_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	46.7	5.9e-71
2641553:2641565	attR	TGCTTCTTCAATA	NA	NA	NA	NA
