The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	253981	303321	5116831	transposase,plate	Streptococcus_phage(22.22%)	46	NA	NA
WP_000224521.1|253981_255328_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013430.1|255330_255855_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|255851_257144_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|257148_258198_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|258161_260003_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|260008_260434_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|260438_261923_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|261945_262449_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263154_263673_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053624.1|263893_265876_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	1.6e-23
WP_000571853.1|265982_267029_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528851.1|267021_268461_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|268435_268726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|269976_270480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|270573_271062_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|271332_272103_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|272256_272730_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973131.1|272772_275217_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|275456_276035_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001298195.1|276239_277007_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|276977_277718_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|278029_278779_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|278954_279452_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_071778446.1|279534_279744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298188.1|279771_281511_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207578.1|281455_282241_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|282311_283367_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|283418_283712_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|283714_284113_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|284122_284575_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000521561.1|284764_285904_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.7e-31
WP_000602124.1|285900_286515_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|286571_288029_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|288289_288748_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|288839_290084_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|290141_290543_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|290581_291637_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|291925_293029_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|293040_294294_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|294794_295391_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|295477_297115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|297806_298034_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|298139_298367_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|298615_300049_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|301018_301582_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|301789_303321_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
>prophage 2
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	942279	950002	5116831	integrase	uncultured_Caudovirales_phage(50.0%)	10	936266:936280	948606:948620
936266:936280	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
WP_000188148.1|942279_944226_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|944298_944523_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|944927_946166_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|946575_946785_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_000103622.1|946923_947103_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|947236_947434_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|947426_947738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|947730_947958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|947963_948251_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|948247_950002_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
948606:948620	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 3
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	1201165	1246367	5116831	transposase,tRNA,lysis,tail,integrase,portal,capsid,terminase,head	Enterobacteria_phage(49.06%)	60	1204361:1204375	1214875:1214889
WP_001298466.1|1201165_1202272_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1202325_1202787_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248675.1|1202796_1203450_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1203621_1204872_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1204361:1204375	attL	AGCTGGCGCGTGAAG	NA	NA	NA	NA
WP_000741330.1|1204985_1206128_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000088653.1|1206117_1206354_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1206493_1206733_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|1206780_1206999_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000188880.1|1207097_1207313_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548537.1|1207389_1207581_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682300.1|1207553_1207736_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|1207732_1208413_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1208409_1209195_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|1209200_1209497_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|1209571_1209778_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1210253_1210631_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1210608_1211670_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_001337214.1|1211750_1212443_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1212553_1212781_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|1212811_1213351_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147913.1|1213347_1214367_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
WP_000788796.1|1214363_1215077_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
1214875:1214889	attR	AGCTGGCGCGTGAAG	NA	NA	NA	NA
WP_000608370.1|1215155_1215584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182282.1|1215580_1215958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053041.1|1216225_1216681_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224917.1|1216680_1216851_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_000774485.1|1216843_1217134_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_001099712.1|1217130_1217493_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971056.1|1217489_1217630_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204776.1|1217715_1218099_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1218287_1219370_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1219958_1220174_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001297096.1|1220628_1221408_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001298025.1|1221407_1222430_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001228695.1|1222847_1223030_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1223120_1223414_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1223894_1224221_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881607.1|1224427_1224610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867508.1|1225172_1225718_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	1.2e-79
WP_001027310.1|1225692_1227618_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1227614_1227821_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001298484.1|1227817_1229419_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	3.5e-311
WP_000123275.1|1229399_1230719_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
WP_001298472.1|1230728_1231061_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000063225.1|1231116_1232142_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	6.9e-188
WP_000158869.1|1232183_1232579_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752960.1|1232590_1232944_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985116.1|1232955_1233534_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683140.1|1233530_1233926_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	4.2e-69
WP_001298481.1|1233933_1234674_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.6e-128
WP_000479168.1|1234689_1235112_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
WP_000459484.1|1235093_1235528_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000840199.1|1235520_1238088_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
WP_000847330.1|1238084_1238414_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001152619.1|1238413_1239112_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_001519691.1|1239117_1239861_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090917.1|1239797_1240430_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_065089924.1|1240490_1243973_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_021518115.1|1244031_1246092_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
WP_000654175.1|1246088_1246367_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	9.9e-25
>prophage 4
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	2672847	2854396	5116831	transposase,tRNA,protease,tail,integrase,plate,holin,capsid,terminase,head	Escherichia_phage(24.55%)	175	2812705:2812722	2854641:2854658
WP_000829343.1|2672847_2674863_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
WP_001267498.1|2674877_2675741_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_001295467.1|2675908_2676622_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001296286.1|2676834_2677869_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001298451.1|2677885_2678764_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000176187.1|2678909_2679482_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001068682.1|2679481_2679952_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000892033.1|2680050_2681112_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000489655.1|2681324_2682788_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166449.1|2682808_2683168_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|2683305_2684052_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198327.1|2684101_2685391_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|2685476_2686103_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296287.1|2686427_2687465_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001028626.1|2687464_2688103_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296288.1|2688274_2690341_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121350.1|2690345_2691887_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_065089939.1|2691925_2694169_-	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_000017553.1|2694350_2694503_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|2694520_2694712_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|2695022_2695541_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2695556_2696096_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_021573208.1|2696314_2696797_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	89.4	3.2e-71
WP_001531861.1|2696793_2697423_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	2.4e-114
WP_001546697.1|2697412_2697721_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_065089940.1|2697707_2698112_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.0	8.7e-62
WP_065089941.1|2698341_2701098_-|tail	tail fiber domain-containing protein	tail	A0A0A0YWB2	Escherichia_phage	65.0	4.7e-74
WP_001188254.1|2701293_2701551_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
WP_016236144.1|2701866_2702577_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.1	1.8e-102
WP_000508164.1|2702683_2702893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065089942.1|2702895_2703756_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.2	4.6e-36
WP_033546982.1|2703781_2704285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643933.1|2704401_2704962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033546983.1|2704964_2707514_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.5	6.9e-205
WP_045133331.1|2707513_2709211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065089943.1|2709212_2711834_-	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	38.7	2.4e-72
WP_000332878.1|2711833_2712379_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_065089944.1|2712378_2712843_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	1.2e-83
WP_065089945.1|2712842_2715314_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000179260.1|2715313_2715919_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_000424496.1|2715918_2716242_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	1.7e-52
WP_000012377.1|2716292_2716628_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627084.1|2716638_2717076_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	96.6	7.7e-72
WP_065089946.1|2717127_2718114_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	1.6e-186
WP_047089539.1|2718128_2718824_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	2.1e-92
WP_000133160.1|2718826_2719123_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_033559459.1|2719119_2720799_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.7	4.0e-302
WP_000335899.1|2720813_2721020_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_065089947.1|2721723_2722095_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	4.5e-57
WP_065089948.1|2722185_2723661_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.4e-295
WP_065089949.1|2723657_2724368_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	84.7	2.9e-105
WP_021537576.1|2724408_2724747_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	91.1	2.1e-53
WP_065089950.1|2724861_2725503_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	59.1	5.6e-55
WP_000212745.1|2725506_2725794_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_065089951.1|2725795_2726209_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	83.9	9.0e-22
WP_065089952.1|2726205_2726874_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	74.2	5.2e-88
WP_065089953.1|2726870_2727365_-	hypothetical protein	NA	G9L6B1	Escherichia_phage	47.3	2.9e-27
WP_001231255.1|2727426_2727771_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	4.1e-60
WP_001066741.1|2727888_2728674_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_065089954.1|2728670_2729480_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	93.8	1.6e-115
WP_000402896.1|2729495_2729696_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001282459.1|2729846_2730077_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2730231_2730816_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001102254.1|2731124_2731424_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
WP_065089955.1|2731420_2732242_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	99.6	4.7e-163
WP_000063834.1|2732238_2733180_+	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
WP_065089956.1|2733229_2733478_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	97.6	8.8e-41
WP_001335975.1|2733635_2733887_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163459.1|2733879_2734530_+	adenine methylase	NA	G9L699	Escherichia_phage	99.1	2.5e-127
WP_001055436.1|2734526_2735186_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
WP_052934176.1|2735188_2736445_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.3	4.9e-236
WP_000138282.1|2736637_2738215_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|2738283_2739750_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937948.1|2739911_2741288_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	1.2e-41
WP_065089957.1|2741356_2749408_-	RatA-like protein	NA	NA	NA	NA	NA
WP_000806616.1|2749528_2750506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298406.1|2750560_2752738_-	intimin-like inverse autotransporter SinH	NA	NA	NA	NA	NA
WP_001196894.1|2752946_2753162_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001296291.1|2753224_2754697_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001177062.1|2754814_2755993_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000409205.1|2756003_2756624_-	ancillary SecYEG translocon subunit YfgM	NA	NA	NA	NA	NA
WP_001107167.1|2756641_2757916_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000551807.1|2758026_2759145_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001090835.1|2759171_2760179_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000003317.1|2760463_2761618_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_000963841.1|2761767_2762199_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
WP_001137632.1|2762347_2764660_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_000736362.1|2764660_2769622_-	alpha2-macroglobulin	NA	NA	NA	NA	NA
WP_000108634.1|2769828_2770674_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_001298396.1|2771166_2771943_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_000133524.1|2772085_2773369_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|2773427_2773628_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|2773639_2773975_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2773976_2775827_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|2775843_2776359_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2776454_2776778_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2776794_2777181_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2777208_2778423_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_001241357.1|2778534_2779023_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940006.1|2779292_2780033_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553454.1|2780151_2780955_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001298397.1|2781099_2781954_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983031.1|2782144_2783425_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244186.1|2783416_2784556_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_001298395.1|2784924_2785347_+	DoxX family protein	NA	NA	NA	NA	NA
WP_099156434.1|2785421_2786769_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_065089958.1|2786942_2787815_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|2787826_2788921_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001276657.1|2788953_2789952_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493464.1|2789976_2791488_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
WP_001124927.1|2791510_2792494_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001298394.1|2792590_2795872_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001298408.1|2795989_2797183_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|2797246_2798500_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883112.1|2798828_2800019_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2800063_2800402_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298400.1|2800462_2801797_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215878.1|2801786_2802500_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2802664_2804092_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001298398.1|2804667_2808555_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
WP_000734193.1|2808812_2810369_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298403.1|2810365_2810902_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|2810926_2811562_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001298401.1|2811770_2812619_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
2812705:2812722	attL	AATTGTGATATGTGTGAA	NA	NA	NA	NA
WP_040091219.1|2813262_2813910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904983.1|2813990_2814545_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	2.8e-87
WP_077626228.1|2814571_2814973_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_000376436.1|2814976_2815396_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_000805534.1|2815367_2815961_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	1.1e-60
WP_065089959.1|2815960_2816755_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	94.2	3.3e-81
WP_000049950.1|2816754_2817435_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_040091350.1|2817431_2818631_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.9	1.3e-185
WP_001270634.1|2818630_2818984_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_040091349.1|2818983_2819736_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	66.7	2.4e-89
WP_021527589.1|2820510_2820864_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.0	1.3e-29
WP_040091347.1|2820863_2821931_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.2	1.7e-157
WP_000155118.1|2821933_2822236_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	1.8e-48
WP_001349561.1|2822235_2822823_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_040091345.1|2822822_2824811_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	73.8	1.8e-269
WP_040091344.1|2824988_2825441_-	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109255.1|2825444_2825885_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	1.6e-56
WP_000046924.1|2825895_2827041_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_033544654.1|2827044_2827608_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_040091341.1|2827582_2827972_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
WP_040091340.1|2827958_2828513_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	3.0e-81
WP_040091339.1|2828509_2828917_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	6.7e-70
WP_040091337.1|2828882_2829251_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	86.1	2.6e-52
WP_040091336.1|2829291_2830233_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	3.7e-156
WP_032330425.1|2830244_2830748_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.6	1.6e-73
WP_040091335.1|2830752_2831973_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	82.2	1.9e-181
WP_086070094.1|2831987_2832725_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	1.3e-108
WP_040091332.1|2832612_2834079_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	93.9	1.3e-267
WP_021563489.1|2834078_2835701_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	6.0e-312
WP_000162796.1|2835703_2836276_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779569.1|2836337_2836862_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_065089960.1|2836845_2837322_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	1.3e-85
WP_000781776.1|2837325_2837667_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_021529146.1|2838070_2838505_-	hypothetical protein	NA	B6SD39	Bacteriophage	62.1	4.8e-42
WP_024234090.1|2838786_2840979_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_000170998.1|2840982_2841195_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2841315_2841939_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000801672.1|2842572_2842722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051350.1|2842718_2843621_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_024234091.1|2843623_2844925_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	4.0e-132
WP_000769011.1|2844940_2845489_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001683173.1|2845600_2847082_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.8	7.9e-36
WP_024428386.1|2847155_2849234_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.1	2.4e-272
WP_024234094.1|2849290_2850049_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_021563493.1|2850114_2850336_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021544533.1|2850325_2850607_+	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	65.5	9.7e-28
WP_021544534.1|2850607_2850751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021544535.1|2850750_2851371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024234150.1|2851413_2852805_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.7	1.9e-212
WP_001291430.1|2852801_2853002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001138341.1|2852998_2854396_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2854641:2854658	attR	AATTGTGATATGTGTGAA	NA	NA	NA	NA
>prophage 5
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	4129146	4140708	5116831	integrase	Enterobacteria_phage(88.89%)	13	4128964:4128986	4139598:4139620
4128964:4128986	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|4129146_4130334_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|4130380_4130908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|4130914_4132000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|4132296_4132869_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4132942_4133443_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001279711.1|4133439_4134174_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|4134726_4134993_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|4134989_4135580_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|4135572_4135860_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459296.1|4135852_4136308_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4136443_4136764_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|4136778_4139112_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_065089978.1|4139670_4140708_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.3	2.2e-72
4139598:4139620	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 6
NZ_CP014667	Escherichia coli strain ECONIH2 chromosome, complete genome	5116831	5040663	5081585	5116831	lysis,protease,tail,integrase,portal,holin,terminase	Enterobacteria_phage(50.0%)	49	5040414:5040433	5085538:5085557
5040414:5040433	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001218287.1|5040663_5041878_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|5042253_5043249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|5043816_5044437_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|5044436_5044799_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|5044789_5045326_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|5045453_5046278_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|5046343_5046706_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|5047174_5047687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|5048002_5048695_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|5048792_5049053_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|5049045_5049597_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|5049593_5050430_+	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_000933943.1|5050422_5050659_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.7	2.7e-39
WP_000061519.1|5050655_5051474_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|5051470_5051965_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|5051964_5052618_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|5052614_5052941_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|5052937_5053327_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|5053346_5054189_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|5054196_5055186_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|5055203_5055545_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|5055557_5056106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5056092_5057019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|5057283_5057487_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|5057637_5058690_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|5058766_5059093_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|5059096_5059573_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|5059569_5060013_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|5060051_5060426_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_001205132.1|5060524_5060707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373423.1|5061064_5061559_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|5061558_5063661_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5063657_5063870_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|5063797_5065378_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|5065322_5067350_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|5067436_5067760_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5067752_5068028_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|5068039_5068618_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|5068614_5069016_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|5069026_5069770_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|5069830_5070217_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5070225_5070555_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|5070526_5073592_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|5073591_5073921_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152410.1|5073930_5074629_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|5074634_5075378_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|5075275_5075923_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_021518114.1|5075983_5079466_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_021518115.1|5079524_5081585_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5085538:5085557	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
>prophage 1
NZ_CP014668	Escherichia coli strain ECONIH2 plasmid pECO-bc6, complete sequence	101201	3303	48562	101201	integrase,transposase	Escherichia_phage(31.25%)	39	NA	NA
WP_001067837.1|3303_4008_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_077459403.1|4037_4265_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000949451.1|4254_4761_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|4943_5759_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001332815.1|6105_7992_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|8032_8560_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|8663_10043_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|10045_11329_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|11318_12449_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|12453_13149_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|13135_13621_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|13645_14131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189113.1|18066_19575_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|20076_20481_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|20477_20825_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|21904_22927_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_065089989.1|22926_23706_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	1.0e-138
WP_000977394.1|24444_25236_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|25242_27213_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|28455_28728_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001072358.1|29574_30744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332784.1|31110_31299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066947.1|31419_32160_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309253.1|32402_33380_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_000990667.1|34554_35196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|37517_37736_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|37737_38043_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016979.1|38043_38853_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_000239529.1|38990_39266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|39259_39904_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103694.1|40132_41104_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340835.1|41108_41501_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000109079.1|42775_43213_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000619112.1|43209_43458_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000115885.1|43592_44111_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343766.1|44129_45350_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001298676.1|45768_46599_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000544830.1|46592_47390_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|47389_48562_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
>prophage 1
NZ_CP014669	Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence	113852	10758	43072	113852	transposase	Salmonella_phage(27.27%)	32	NA	NA
WP_004152392.1|10758_13788_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|13894_14920_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|14916_15696_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|15983_16865_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|17114_18434_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|18710_19895_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|20398_20758_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|21414_21825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|21923_22544_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_023307208.1|22632_25530_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|25624_26230_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|26889_28071_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|28497_28812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|29066_29423_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|29412_29814_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|29810_30101_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|30175_33142_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|33220_34225_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|34406_34610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|34623_34827_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|34860_35229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|35272_35767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|35797_36370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272716.1|36366_36615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|37051_37741_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|37772_38462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|39016_39235_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001568026.1|39236_39542_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_072158608.1|39710_40106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|40132_40456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315256.1|40452_41469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705993.1|41803_43072_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.1e-59
>prophage 2
NZ_CP014669	Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence	113852	47605	59697	113852		Enterobacteria_phage(25.0%)	12	NA	NA
WP_019706038.1|47605_49633_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|49744_49960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|50184_50517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|50893_51868_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|51864_53070_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|53391_54288_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|54688_55960_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|55959_56391_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|56622_57594_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|57596_58268_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|58328_58559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|58995_59697_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
