The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	590779	596604	5393897		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|590779_591346_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|591363_591609_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|591605_592343_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|592903_593170_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|593166_593715_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|593711_593939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|593935_594256_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|594270_596604_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	1065033	1076687	5393897	integrase	Enterobacteria_phage(70.0%)	13	1053167:1053181	1076224:1076238
1053167:1053181	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1065033_1067367_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1067378_1067699_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1067695_1067923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1067919_1068477_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1068473_1068740_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1069281_1070019_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1070015_1070261_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1070278_1070845_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|1071413_1071839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1071838_1072789_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1072776_1073967_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1074319_1075573_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1075583_1076687_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1076224:1076238	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	1286206	1331481	5393897	holin,tRNA,lysis,head	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|1286206_1287592_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1287637_1287850_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1287851_1288718_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|1290188_1290524_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1290525_1290741_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1290742_1290961_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1290957_1291725_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1291721_1292378_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1292374_1292533_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1292529_1293210_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1293206_1294052_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1294067_1294352_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1294440_1294635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1294627_1294738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1294734_1294950_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1295300_1295990_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1296117_1296351_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1296391_1296613_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1296698_1296845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1296885_1297737_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1297741_1299157_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1299156_1299450_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1299446_1299953_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1300059_1300902_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1300901_1301078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|1301074_1301722_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1302222_1302678_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1302677_1302848_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1302840_1303476_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1303472_1303610_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1303602_1304133_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1304129_1304819_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1305728_1305977_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|1305979_1306510_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1306506_1306971_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1307076_1307406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1307776_1308379_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1308378_1309851_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1309863_1311285_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1311259_1312264_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1312305_1312782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1312854_1314240_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1314243_1314672_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1314683_1315778_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1315788_1316028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1316030_1316411_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1316410_1316584_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1316583_1316946_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1316948_1317374_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1317370_1317763_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1317831_1318584_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1318636_1319314_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1319489_1320245_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1320247_1320502_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1320795_1321266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1321282_1321642_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1321741_1321912_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1321901_1322615_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1322680_1323466_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1323593_1324097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1324189_1327636_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|1327678_1328155_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1328154_1328625_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1328621_1329017_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1329003_1331481_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 4
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	1776590	1813926	5393897	head,lysis,tail,portal,plate,integrase,terminase,capsid	Salmonella_phage(87.18%)	47	1776498:1776516	1813998:1814016
1776498:1776516	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1776590_1777571_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|1778058_1779546_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1779644_1780589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1780600_1781479_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1781624_1781846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1781878_1782388_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1782395_1782596_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1782559_1782901_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1782968_1783202_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1783201_1783429_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1783425_1784283_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1784279_1786694_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1786847_1787036_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1787046_1787280_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1787394_1788072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1788347_1790090_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1790151_1791177_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1791176_1792943_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1793085_1793919_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1793935_1794994_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1794997_1795648_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1795743_1796208_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1796207_1796411_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1796414_1796630_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1796610_1797120_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1797124_1797508_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1797504_1797933_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1797919_1798066_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1798028_1798460_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1798452_1798899_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1798895_1799588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1799682_1800255_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1800251_1800614_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1800600_1801509_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1801501_1802101_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|1804319_1805054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1805057_1805789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1805785_1805989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1806018_1807095_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1807233_1808406_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1808415_1808931_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1808983_1809283_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1809297_1809417_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1809409_1812037_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1812033_1812519_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1812515_1813616_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1813707_1813926_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1813998:1814016	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 5
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	2225070	2279866	5393897	transposase,protease,integrase	Escherichia_phage(22.73%)	48	2249698:2249713	2280070:2280085
WP_002901758.1|2225070_2226117_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2226164_2226416_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2226822_2229420_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2229765_2230740_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2230985_2231153_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|2231541_2234214_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2234260_2234863_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2235026_2235794_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2235929_2236238_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2236244_2237414_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2237605_2238343_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2238342_2238669_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2238800_2239019_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2239294_2240044_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2240115_2240295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2240453_2242388_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|2242469_2243627_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004151904.1|2243817_2244606_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|2244804_2245347_-	HutD family protein	NA	NA	NA	NA	NA
WP_004151902.1|2245594_2246974_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2247018_2247828_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2247829_2248822_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2248821_2249712_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2249698:2249713	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_004151900.1|2249858_2251076_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|2251283_2251946_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2251942_2252371_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_000019473.1|2252899_2253880_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152648.1|2254070_2254406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2254720_2255185_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2255365_2255848_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2255857_2256238_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2256234_2259303_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_024940942.1|2261599_2262334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|2262337_2263069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2263293_2263893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2264134_2266078_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2266326_2267031_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001261740.1|2268026_2268818_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2268981_2269329_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2269322_2270162_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2270289_2270790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|2271296_2272061_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|2272237_2272942_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|2274851_2276339_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2276418_2276838_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2276839_2278105_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2278180_2279008_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2279194_2279866_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
2280070:2280085	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 6
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	2312799	2384553	5393897	plate,holin,transposase,integrase,terminase	uncultured_Caudovirales_phage(35.29%)	83	2310880:2310894	2319820:2319834
2310880:2310894	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2312799_2313561_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2313777_2315310_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2315508_2316057_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2316253_2317435_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2317415_2317658_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2317617_2317764_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2317836_2318070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2318312_2318525_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2318521_2318746_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2318735_2319446_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2319451_2319970_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2319820:2319834	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2320074_2320902_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2320898_2321093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2321089_2321515_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2321511_2321730_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2321701_2321956_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2321948_2322314_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2322483_2322672_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2322664_2322979_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2323149_2323818_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2323915_2324137_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2324713_2326372_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2326373_2327336_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2327332_2327809_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2327805_2328588_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2328993_2329242_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|2329244_2329775_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2329771_2330161_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2330395_2330716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2331081_2331570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2331520_2332921_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2333158_2334610_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2334665_2335214_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2335265_2336468_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2336471_2336966_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2336977_2337919_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2337958_2338240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2338208_2338628_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2338624_2339131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2339130_2339517_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2339611_2340052_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2340055_2341201_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2341211_2341502_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2341442_2342635_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2342961_2343387_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2343422_2343575_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2343564_2345568_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2345567_2346167_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|2346242_2346470_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2346472_2347495_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2347494_2347836_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2347885_2348068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2348110_2348677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2348730_2349384_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2349385_2349739_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2349738_2350935_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2350931_2351705_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2351704_2352571_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|2352570_2352768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2355118_2355847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2355857_2356589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2356585_2356795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|2356899_2357184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2357406_2357655_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|2358500_2358992_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|2359034_2360579_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|2360588_2361932_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|2361928_2362618_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|2362614_2364321_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2364325_2364817_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|2365081_2367736_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|2367737_2370107_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|2370107_2370887_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|2370950_2371481_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2371549_2372080_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2372147_2372678_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2372746_2373277_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|2373344_2373875_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|2373862_2376280_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|2376324_2376582_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151600.1|2376578_2377718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|2377701_2381127_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|2382798_2384553_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	2579130	2590017	5393897		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2579130_2579751_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2579743_2581009_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2581020_2581923_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2582183_2582945_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2582965_2583826_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2584123_2584384_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2584470_2585559_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2585589_2586855_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2586909_2590017_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	3247003	3290104	5393897	transposase,plate,tRNA	Microcystis_virus(25.0%)	42	NA	NA
WP_002910404.1|3247003_3248260_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3248530_3249142_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|3249141_3249990_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3250173_3251121_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3251245_3252925_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3252925_3253972_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3254194_3254470_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3254742_3255327_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3255444_3256536_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3256618_3256828_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3257029_3257944_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3258075_3259491_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|3259510_3259954_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3259956_3260493_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|3260473_3261490_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3261519_3263283_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3263416_3266827_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3266810_3267968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3267971_3268238_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3268535_3268721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|3268981_3269284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3269341_3270322_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3270658_3271549_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3271724_3272618_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|3272639_3272768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|3272793_3273687_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|3273708_3273825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|3273870_3274764_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3274785_3275091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004227470.1|3275137_3276226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3276607_3277114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3277110_3277440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3277436_3277619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|3277760_3278729_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|3280334_3280844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|3280833_3280986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3281080_3281587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3281583_3282093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3282093_3283449_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|3286412_3288110_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3288113_3288767_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3288763_3290104_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	3548253	3555878	5393897		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3548253_3549255_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3549448_3550615_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3550795_3551350_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3551364_3552255_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3552286_3553156_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3553182_3554247_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3554471_3555878_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 10
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	3593645	3600552	5393897	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3593645_3595124_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3595120_3595843_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3596161_3597523_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|3597765_3598662_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3598904_3599678_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3599688_3600552_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	3900321	3973972	5393897	tRNA,protease,transposase,holin,terminase,integrase,tail,capsid	Salmonella_phage(40.0%)	86	3905963:3905980	3972961:3972978
WP_004152006.1|3900321_3902325_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3902334_3903210_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3903329_3904043_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3904258_3905293_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3905309_3906188_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3905963:3905980	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|3906341_3906908_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3906911_3907382_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3907443_3908505_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|3908559_3908676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|3908727_3910191_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3910200_3910560_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3910687_3911599_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3911595_3912297_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3912395_3913682_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3913777_3914404_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3914621_3916055_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|3916064_3916958_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|3917221_3918259_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|3918255_3918897_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|3919077_3921138_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3921141_3922674_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|3922727_3924956_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|3925326_3925500_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_074401226.1|3925596_3926508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|3926581_3927814_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|3928107_3929286_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|3929269_3931138_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|3931357_3931840_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|3931836_3932466_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|3932455_3932761_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|3932747_3933152_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|3933275_3933428_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004221284.1|3933436_3935806_-|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152452.1|3935957_3936254_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004152453.1|3936344_3936602_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|3936605_3936803_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_157833602.1|3936911_3937100_+	ash family protein	NA	NA	NA	NA	NA
WP_004152455.1|3937183_3937879_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152456.1|3938069_3938252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|3938256_3938655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|3938929_3939544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152459.1|3939553_3942943_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152460.1|3942942_3945687_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152461.1|3945699_3946197_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152462.1|3946189_3946660_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152463.1|3946661_3949139_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004153043.1|3949138_3949750_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152465.1|3949798_3950077_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|3950069_3950462_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152467.1|3950471_3951479_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_019404949.1|3951491_3952169_-	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004152470.1|3952171_3952477_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152471.1|3952473_3954153_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152472.1|3954156_3954360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152473.1|3955065_3955587_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004164044.1|3955630_3957106_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152523.1|3957102_3957687_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|3957764_3958022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|3958096_3958435_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|3958434_3958674_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|3958666_3959335_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|3959331_3959544_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|3959544_3959715_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|3959714_3960458_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|3960454_3960880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|3960876_3961068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|3961051_3961462_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|3961654_3962002_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|3962121_3962907_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152536.1|3962903_3963671_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152537.1|3963670_3963880_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|3964027_3964261_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|3964414_3964996_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|3965216_3965366_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|3965362_3965662_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|3965658_3966558_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|3966567_3967590_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|3967641_3967890_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|3967999_3968293_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|3968285_3968444_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|3968440_3969034_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|3969030_3969213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|3969209_3969401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|3969417_3970668_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|3970860_3972438_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|3972505_3973972_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
3972961:3972978	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 12
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	4045322	4124932	5393897	tRNA,lysis,head,portal,plate,terminase,integrase,tail,capsid	Salmonella_phage(72.0%)	87	4090026:4090072	4126593:4126639
WP_002914079.1|4045322_4046060_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4046191_4047523_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4047568_4047952_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4048265_4048955_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4049012_4050098_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4050301_4050727_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4050796_4051495_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_004151994.1|4051529_4054190_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4054310_4055666_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4055707_4056031_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4056034_4057333_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4063298_4065872_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4066001_4066733_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4066729_4067710_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4067841_4068579_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4068849_4069185_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4069291_4069339_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|4069439_4070600_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4070596_4071469_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4071531_4072653_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4072662_4073733_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4074075_4074585_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004150976.1|4074577_4075801_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4075814_4076297_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4076305_4077676_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4077732_4078191_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4078310_4078658_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4078697_4079465_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4079496_4080045_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4080063_4080312_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4080571_4081936_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4082099_4082891_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4082910_4084197_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4084316_4084907_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4085031_4085910_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4085996_4087658_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4087805_4088147_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4088213_4088504_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4088493_4088970_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4089080_4089563_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4090026:4090072	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4090166_4090544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4090571_4090790_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4090856_4091951_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4091947_4092433_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4092429_4095060_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4095052_4095172_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4095186_4095486_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4095538_4096054_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4096063_4097236_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4097384_4098458_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150989.1|4098509_4099628_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4099637_4101587_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4101588_4102260_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4102252_4103161_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4103147_4103510_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4103506_4104079_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4104173_4105040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4105062_4105509_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4105501_4105924_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4105886_4106045_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4106019_4106448_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4106444_4106828_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4106832_4107342_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4107322_4107538_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4107541_4107745_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4107744_4108209_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4108304_4108958_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4108961_4110014_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4110030_4110864_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4111004_4112768_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4112767_4113811_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4113867_4114137_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4114658_4115660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4115659_4116739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4116725_4117409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4117504_4117738_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4117749_4117938_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4118100_4120485_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4120481_4121333_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4121329_4121557_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4121556_4121790_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4121857_4122196_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4122159_4122360_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4122367_4122877_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4122909_4123152_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4123274_4123904_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4123906_4124932_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4126593:4126639	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP014647	Klebsiella pneumoniae strain KPNIH36 chromosome, complete genome	5393897	4844048	4892891	5393897	tRNA,head,protease,portal,terminase,tail,capsid	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4844048_4844543_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4844546_4845185_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4845154_4845439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4845496_4845889_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4845904_4846333_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4846598_4847726_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4847916_4848315_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4848488_4849856_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4849943_4851002_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4851138_4852077_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4852491_4852962_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4853337_4853601_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4853699_4853966_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4854016_4854292_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|4854371_4856339_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4856344_4857277_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4857284_4857488_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4857619_4858549_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4858584_4860030_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4860118_4863916_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|4863953_4865423_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4865425_4866007_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4866014_4866503_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4866502_4867495_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4867565_4868609_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4868914_4870855_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4870934_4871126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4871354_4872356_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4872355_4872964_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4873187_4873640_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4873662_4874130_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4874140_4875490_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4875600_4875843_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004150953.1|4875832_4877284_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4877295_4878177_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4878534_4879500_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4879524_4879821_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4879974_4880166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4880168_4881830_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4881813_4882170_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4882300_4882453_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4882445_4882889_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4882888_4883188_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4883184_4883520_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4883516_4884758_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4884759_4885320_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4885371_4886538_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4886801_4887314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4887362_4887698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4888040_4890176_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4890175_4890541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4890537_4890906_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4890902_4891217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4891209_4891398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4891390_4891660_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4892111_4892891_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP014648	Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-821, complete sequence	40448	0	5257	40448	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_001217881.1|2856_3414_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|3647_4202_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|4552_5257_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP014648	Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-821, complete sequence	40448	8705	9470	40448	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001389365.1|8705_9470_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 3
NZ_CP014648	Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-821, complete sequence	40448	12808	17345	40448	transposase	Escherichia_phage(75.0%)	4	NA	NA
WP_004217321.1|12808_13513_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|14816_15485_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|15674_16490_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|16640_17345_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP014648	Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-821, complete sequence	40448	20683	32089	40448	integrase,transposase	Salmonella_phage(33.33%)	13	23338:23370	32082:32114
WP_001389365.1|20683_21448_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|21674_21980_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|21990_23196_-	chromate efflux transporter	NA	NA	NA	NA	NA
23338:23370	attL	CGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_000376616.1|23351_23555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|23682_24522_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|24515_24863_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|25026_25818_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|25823_26114_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|26225_26723_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|26867_27881_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|28083_28434_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|28559_29120_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|29122_32089_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
32082:32114	attR	CGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 1
NZ_CP014649	Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence	133484	18638	73719	133484	transposase,integrase,terminase,tail,holin	Salmonella_phage(37.93%)	64	13122:13138	83954:83970
13122:13138	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004178082.1|18638_20126_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|20528_20954_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|20953_22225_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152707.1|24093_24576_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|24572_25202_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|25191_25497_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|25483_25888_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|26011_26164_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004207261.1|26172_28539_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152432.1|28695_28992_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|29306_29996_+	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|30081_30465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|30607_33373_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|33372_35283_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|35282_38114_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|38124_38664_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|38663_39128_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|39127_41626_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|41625_42231_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|42230_42554_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|42604_42946_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|42956_43394_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152444.1|43447_44434_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152445.1|44448_45129_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|45131_45428_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|45424_47107_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|47121_47328_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|48129_48441_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|48507_49983_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|49979_50564_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|50641_50899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|50973_51312_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|51311_51551_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|51543_52212_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|52208_52421_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|52421_52592_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|52591_53335_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|53331_53757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|53753_53945_-	hypothetical protein	NA	A0A1B1W2B6	Salmonella_phage	47.3	1.6e-05
WP_004152532.1|53928_54339_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|54531_54879_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|54998_55784_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152536.1|55780_56548_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152537.1|56547_56757_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|56904_57138_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|57291_57873_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|58093_58243_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|58239_58539_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|58535_59435_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|59444_60467_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|60518_60767_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|60876_61170_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|61162_61321_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|61317_61911_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|61907_62090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|62086_62278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|62294_63545_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152062.1|64945_65917_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|65916_67083_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|67834_68845_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_001515717.1|69561_70302_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|71445_72393_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|72419_72731_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|72750_73719_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
83954:83970	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 1
NZ_CP014650	Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence	113639	10758	42817	113639	integrase,transposase	Escherichia_phage(25.0%)	31	17251:17268	52015:52032
WP_004152392.1|10758_13788_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|13894_14920_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|14916_15696_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|15983_16865_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|17114_18434_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
17251:17268	attL	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
WP_004152398.1|18710_19895_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|20398_20758_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|21414_21825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|21923_22544_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|22632_25530_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|25602_26307_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|28050_28911_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001300294.1|30821_31490_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|31525_31762_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|31758_32121_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|32138_33833_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|33884_34307_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|34342_34468_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|35199_35910_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|35983_36400_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|36396_36627_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072093212.1|36583_37045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|37279_37486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|37531_37840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|37867_38197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|38222_38621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|38627_38960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|38959_39742_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|40633_40864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|40955_41429_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|41548_42817_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
52015:52032	attR	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP014650	Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence	113639	47392	59484	113639		Enterobacteria_phage(25.0%)	12	NA	NA
WP_004152345.1|47392_49420_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|49531_49747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|49971_50304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|50680_51655_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|51651_52857_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|53178_54075_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|54475_55747_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|55746_56178_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|56409_57381_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|57383_58055_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|58115_58346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|58782_59484_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
