The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048406	Mesorhizobium sp. AA22 chromosome, complete genome	6611049	3285276	3293178	6611049	capsid,head,terminase,portal,tail	Brucella_phage(25.0%)	12	NA	NA
WP_163603038.1|3285276_3286875_-|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	27.4	1.3e-39
WP_065012231.1|3286837_3287245_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_065012230.1|3287244_3287559_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_065012229.1|3287555_3287972_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_065012228.1|3287968_3288220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065012227.1|3288216_3288582_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_065012226.1|3288581_3288884_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_065012225.1|3289010_3289199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065012224.1|3289610_3289994_-	hypothetical protein	NA	A0A142K633	Streptomyces_phage	46.0	5.8e-15
WP_065012223.1|3290048_3291629_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	40.7	1.7e-52
WP_065012222.1|3291625_3291988_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_065012221.1|3291984_3293178_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	30.7	4.0e-38
>prophage 2
NZ_CP048406	Mesorhizobium sp. AA22 chromosome, complete genome	6611049	3450728	3459317	6611049	tRNA	uncultured_Mediterranean_phage(85.71%)	9	NA	NA
WP_163603041.1|3450728_3451571_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.3	2.5e-34
WP_029353166.1|3451567_3452347_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	43.9	3.4e-38
WP_029353164.1|3452527_3452749_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.9	5.1e-08
WP_065007765.1|3452777_3453455_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_051695763.1|3453499_3454309_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	49.2	1.3e-51
WP_065007767.1|3454650_3456186_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	4.6e-95
WP_065007768.1|3456185_3456944_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_065007809.1|3456946_3457606_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	40.4	3.9e-19
WP_065007769.1|3457820_3459317_+	peptidoglycan DD-metalloendopeptidase family protein	NA	S6B1Q4	Bacillus_phage	37.5	3.1e-11
>prophage 3
NZ_CP048406	Mesorhizobium sp. AA22 chromosome, complete genome	6611049	6029771	6080301	6611049	transposase,integrase	Acidithiobacillus_phage(22.22%)	38	6023342:6023359	6047703:6047720
6023342:6023359	attL	CCATCGCGTTTTCAGATG	NA	NA	NA	NA
WP_095780361.1|6029771_6030290_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0Z042	Pseudomonas_phage	41.3	1.7e-30
WP_065009155.1|6030386_6032165_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_082982466.1|6032186_6033185_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.6	1.0e-26
WP_065009186.1|6033428_6034529_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065009153.1|6035015_6035669_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065009151.1|6036455_6037010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065009150.1|6037777_6038953_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_065009149.1|6039711_6041007_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_141246641.1|6041743_6042019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065009147.1|6042241_6042748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065009146.1|6042740_6045806_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_065009145.1|6045802_6046069_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_065009144.1|6046087_6047344_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_065009143.1|6048225_6049656_-	dipeptidase	NA	NA	NA	NA	NA
6047703:6047720	attR	CCATCGCGTTTTCAGATG	NA	NA	NA	NA
WP_065009141.1|6050222_6051011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065012429.1|6051148_6052330_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_065012430.1|6052430_6053171_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.6e-29
WP_065012428.1|6053290_6054265_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065012427.1|6054328_6055171_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065012426.1|6055717_6056737_-	aryldialkylphosphatase	NA	NA	NA	NA	NA
WP_082982812.1|6056969_6057383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082982811.1|6057858_6059268_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.8	5.2e-21
WP_065012424.1|6061182_6062013_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_065012423.1|6062128_6063091_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065012422.1|6063422_6063644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141246659.1|6063864_6065376_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	7.9e-116
WP_065008691.1|6065388_6066144_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	46.9	1.2e-56
WP_065007546.1|6066278_6066869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065007547.1|6066865_6069055_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
WP_065007549.1|6069057_6069840_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_163603086.1|6069985_6070168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163603087.1|6070570_6071770_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_141246658.1|6071989_6072268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065007544.1|6073939_6074488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163603088.1|6075285_6076485_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.4	1.1e-80
WP_065007842.1|6076663_6077692_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065008564.1|6078169_6079042_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.7	8.8e-51
WP_065008565.1|6079038_6080301_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.3	5.2e-44
>prophage 4
NZ_CP048406	Mesorhizobium sp. AA22 chromosome, complete genome	6611049	6380996	6438798	6611049	protease,holin,transposase,integrase	Caulobacter_phage(25.0%)	53	6431878:6431901	6434512:6434535
WP_065008855.1|6380996_6381701_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_065008856.1|6381714_6381954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065008858.1|6383812_6384091_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_065008859.1|6384105_6384375_-	DUF4326 domain-containing protein	NA	A0A1L2C8W5	Pseudomonas_phage	56.3	8.1e-24
WP_065008860.1|6384438_6384837_-	single-stranded DNA-binding protein	NA	A0A193GYD7	Enterobacter_phage	34.3	1.5e-10
WP_065008861.1|6385766_6386699_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	46.9	1.0e-68
WP_065008862.1|6386978_6387164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065008863.1|6387356_6388514_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023801727.1|6388972_6389275_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065008864.1|6389271_6389733_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_065008865.1|6390874_6391210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095780349.1|6391206_6392088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156768364.1|6392233_6392551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065008868.1|6392654_6394337_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065008869.1|6399777_6400176_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_065008870.1|6400186_6400789_-	DUF1419 domain-containing protein	NA	NA	NA	NA	NA
WP_065008903.1|6400929_6401883_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_065008871.1|6402850_6403441_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_065008872.1|6403469_6404462_-	hypothetical protein	NA	A0A291AUP8	Sinorhizobium_phage	36.2	7.6e-51
WP_065008873.1|6406005_6406539_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.2	3.7e-20
WP_082982435.1|6406875_6407031_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_095780346.1|6407475_6407913_-	response regulator	NA	NA	NA	NA	NA
WP_141246633.1|6408045_6408471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065008904.1|6409065_6409275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065008905.1|6409394_6409601_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_065008877.1|6409923_6410112_+	hypothetical protein	NA	F1ADP1	Caulobacter_phage	45.3	4.5e-05
WP_082982436.1|6410533_6411313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095780347.1|6411392_6413189_+	methanol/ethanol family PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_082982437.1|6413169_6414033_+	quinoprotein dehydrogenase-associated putative ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065008880.1|6414034_6414568_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_065008881.1|6414585_6415578_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_082982438.1|6415574_6417533_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	40.0	8.1e-12
WP_065008882.1|6417529_6418135_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
WP_065008883.1|6418136_6418478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065008884.1|6418474_6419353_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_065008885.1|6419333_6419744_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_065008886.1|6420207_6420453_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_065008887.1|6420461_6420707_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_082982439.1|6420810_6421020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065008888.1|6421542_6421728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065008889.1|6421724_6421952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163603098.1|6422069_6422531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065006357.1|6424545_6425574_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_141246656.1|6426592_6426970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065006983.1|6427041_6428532_+	radical SAM family RiPP maturation amino acid epimerase	NA	NA	NA	NA	NA
WP_156768225.1|6428528_6428687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065006981.1|6429334_6430576_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065006980.1|6431013_6431844_+	alpha/beta hydrolase	NA	A0A249XU20	Mycobacterium_phage	33.9	2.2e-11
6431878:6431901	attL	GGGGAGCATGAGGATTTGTGGGGC	NA	NA	NA	NA
WP_163603123.1|6432064_6432667_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_065008802.1|6432647_6432896_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095780379.1|6433108_6434509_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_065011708.1|6436771_6437959_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
6434512:6434535	attR	GCCCCACAAATCCTCATGCTCCCC	NA	NA	NA	NA
WP_065011722.1|6437973_6438798_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP048406	Mesorhizobium sp. AA22 chromosome, complete genome	6611049	6453809	6499215	6611049	transposase,integrase	Tetraselmis_virus(25.0%)	30	6484799:6484815	6510601:6510617
WP_095780379.1|6453809_6455210_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_065008802.1|6455422_6455671_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095780378.1|6455651_6456032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082982275.1|6456172_6457750_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_065007357.1|6457836_6458541_-	nitroreductase	NA	NA	NA	NA	NA
WP_141246650.1|6459755_6460130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065011813.1|6461482_6461701_+	hypothetical protein	NA	A0A2P0VMP9	Tetraselmis_virus	50.0	8.9e-05
WP_065011814.1|6461712_6462000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065011815.1|6462138_6462984_-	EamA family transporter	NA	NA	NA	NA	NA
WP_065011819.1|6464130_6464805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082982734.1|6468298_6471313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065011822.1|6471309_6472392_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_065011823.1|6472458_6473022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065011824.1|6473763_6474537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095780369.1|6477250_6478345_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_141246649.1|6478417_6478723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065009289.1|6479139_6479790_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065006357.1|6480199_6481228_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082982149.1|6481452_6482502_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_065006362.1|6483767_6485159_+	insulinase family protein	NA	A0A2P1EIE5	Megavirus	22.8	1.8e-21
6484799:6484815	attL	GCTCGACGACACCAATT	NA	NA	NA	NA
WP_065006359.1|6485163_6486552_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	21.8	8.8e-13
WP_065006361.1|6487778_6489065_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095780374.1|6489111_6489714_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_065007981.1|6489969_6491370_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_163603100.1|6492284_6494624_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_065005808.1|6494717_6495071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065005810.1|6496206_6496947_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	26.7	3.3e-14
WP_065006111.1|6496950_6497964_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_163602977.1|6497893_6498052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082982083.1|6498090_6499215_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
6510601:6510617	attR	GCTCGACGACACCAATT	NA	NA	NA	NA
