The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	1308540	1318192	5365209		Morganella_phage(33.33%)	15	NA	NA
WP_064153438.1|1308540_1309143_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	57.3	5.8e-54
WP_048330747.1|1309142_1309322_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032411696.1|1309920_1310112_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_071925140.1|1310104_1310284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177032.1|1310280_1310598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032421637.1|1310594_1310858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602623.1|1310854_1311076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824364.1|1311072_1311699_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.1	9.1e-26
WP_032421635.1|1311708_1312059_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	2.6e-38
WP_064824365.1|1312051_1314814_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	7.5e-290
WP_148722632.1|1315500_1316106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824367.1|1316118_1316427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824368.1|1316426_1316897_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_072122913.1|1317464_1317785_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.0	4.7e-18
WP_032416291.1|1317814_1318192_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	45.5	5.3e-21
>prophage 2
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	1804014	1813479	5365209	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1804014_1805130_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004209695.1|1805126_1807067_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1807143_1807365_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1807690_1808008_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1808038_1810318_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1810439_1810658_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1811011_1811713_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_032432850.1|1811757_1813479_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	2180313	2290450	5365209	terminase,tail,protease,holin,portal,plate,integrase	Enterobacteria_phage(30.19%)	112	2193804:2193822	2288533:2288551
WP_002901758.1|2180313_2181360_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2181407_2181659_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2182065_2184663_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2185008_2185983_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2186228_2186396_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_016947418.1|2186784_2189457_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2189503_2190106_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2190269_2191037_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2191172_2191481_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2191487_2192657_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2192848_2193586_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2193585_2193912_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
2193804:2193822	attL	CGGCGGCGCGGTGAAAGAT	NA	NA	NA	NA
WP_002901783.1|2194043_2194262_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2194537_2195287_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2195358_2195538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2195696_2197631_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|2197712_2198870_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2199060_2199849_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_016947419.1|2200047_2200590_-	HutD family protein	NA	NA	NA	NA	NA
WP_004210729.1|2200837_2202217_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2202261_2203071_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2203072_2204065_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2204064_2204955_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_032726038.1|2205101_2206319_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	1.9e-120
WP_022631172.1|2206539_2206779_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_023320771.1|2206819_2207929_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	1.3e-184
WP_064824377.1|2207941_2210998_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	56.6	1.8e-292
WP_023320773.1|2211135_2211291_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	69.2	9.8e-14
WP_004179600.1|2211299_2211491_-	YebW family protein	NA	NA	NA	NA	NA
WP_077253214.1|2211879_2212314_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.9e-15
WP_023320775.1|2212418_2212646_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_023320776.1|2212648_2213185_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	68.3	2.4e-59
WP_004215886.1|2213532_2214453_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_023320778.1|2214449_2215193_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	54.8	4.5e-64
WP_023320779.1|2215185_2215554_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.6	8.3e-11
WP_023320780.1|2215550_2215754_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	8.8e-31
WP_023320781.1|2215746_2216010_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	84.8	7.4e-30
WP_023320783.1|2216229_2217309_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023320784.1|2217308_2217938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|2218396_2218630_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_148722633.1|2219040_2219640_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.9	2.3e-90
WP_032726044.1|2219848_2220145_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	6.0e-36
WP_023282412.1|2220141_2220498_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023320786.1|2220613_2221435_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	65.0	1.6e-94
WP_024176410.1|2221691_2221991_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_023301209.1|2221987_2222527_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_023320787.1|2222523_2222871_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_023320788.1|2222867_2223143_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	97.8	5.8e-09
WP_023320790.1|2223604_2223850_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	1.6e-18
WP_163523724.1|2223958_2224336_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023320792.1|2224401_2224587_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
WP_014228567.1|2224908_2225400_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_023320793.1|2225399_2227508_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.3	0.0e+00
WP_020317294.1|2227504_2227720_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_023320794.1|2227716_2229216_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	3.3e-247
WP_187145524.1|2229142_2231176_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PKX4	Enterobacterial_phage	84.9	0.0e+00
WP_023320796.1|2231256_2231583_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.4	1.8e-33
WP_020317349.1|2231575_2231869_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_023320797.1|2231858_2232410_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.7	2.2e-52
WP_020804325.1|2232406_2232805_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023320798.1|2232812_2233295_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	69.2	2.6e-60
WP_023320799.1|2233337_2233733_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	1.1e-08
WP_032420719.1|2233753_2234071_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_023320800.1|2234051_2236748_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	63.2	4.0e-203
WP_023320801.1|2236747_2237221_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	1.7e-53
WP_023320802.1|2237207_2237690_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	68.4	6.5e-56
WP_023320803.1|2237697_2238084_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	2.8e-33
WP_064824379.1|2238080_2241149_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	66.4	0.0e+00
WP_023320806.1|2243762_2244677_+	hypothetical protein	NA	A0A1C9EHS8	Gordonia_phage	46.5	1.8e-22
WP_023332914.1|2245565_2247053_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_023320807.1|2247132_2247552_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_023320808.1|2247553_2248819_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.8e-209
WP_023320809.1|2248860_2249502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023320810.1|2249494_2250169_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.6e-79
WP_002901816.1|2250373_2251339_-	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_016947420.1|2251335_2252979_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004190601.1|2253312_2254221_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019705465.1|2254328_2255159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032432934.1|2255137_2257447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023328659.1|2257618_2258788_+	amidohydrolase	NA	NA	NA	NA	NA
WP_023341379.1|2258813_2260205_+	MFS transporter	NA	NA	NA	NA	NA
WP_020802484.1|2260195_2261185_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901908.1|2261337_2262006_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901911.1|2262061_2262286_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901913.1|2262285_2262645_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901915.1|2262673_2262892_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901917.1|2262994_2264392_+	YcjX family protein	NA	NA	NA	NA	NA
WP_032432935.1|2264388_2265450_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_004888583.1|2265539_2266439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901977.1|2266552_2267866_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002901979.1|2268038_2269580_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_004183734.1|2269681_2270734_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_032432937.1|2270804_2271311_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_004176448.1|2271413_2272379_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152134.1|2272375_2273083_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004148146.1|2273155_2273272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004888568.1|2273268_2274885_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190575.1|2275052_2275439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432938.1|2275669_2276503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432941.1|2276627_2277512_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032432942.1|2277684_2278821_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045326769.1|2278893_2280096_+	MFS transporter	NA	NA	NA	NA	NA
WP_009309077.1|2280174_2281044_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	9.6e-50
WP_004218009.1|2281068_2281206_-	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
WP_004176439.1|2281590_2281779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432945.1|2282079_2282994_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032432946.1|2283102_2283864_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	8.2e-21
WP_064824380.1|2284080_2285613_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.7	5.7e-21
WP_004190556.1|2285811_2286378_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004176434.1|2287018_2287510_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032421271.1|2287552_2289097_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
2288533:2288551	attR	CGGCGGCGCGGTGAAAGAT	NA	NA	NA	NA
WP_004176432.1|2289106_2290450_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	2440017	2524936	5365209	terminase,head,tail,integrase,holin,portal,transposase,protease,capsid	Klebsiella_phage(54.17%)	93	2462063:2462081	2497071:2497089
WP_004224598.1|2440017_2440533_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|2440825_2440984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313034.1|2441594_2441855_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_064824382.1|2441987_2442389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032441508.1|2442385_2442610_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	93.2	4.8e-30
WP_032428838.1|2442599_2443325_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	85.0	3.4e-109
WP_032430926.1|2443330_2443849_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.1	5.5e-93
WP_023304718.1|2443953_2444781_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_009309071.1|2444777_2444972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2444968_2445394_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2445390_2445609_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_064824383.1|2445580_2445835_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	92.9	4.2e-38
WP_023304721.1|2445827_2446193_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_064824384.1|2446602_2447016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|2447180_2447840_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_071646927.1|2447995_2448229_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_064824385.1|2448353_2448695_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	54.7	1.1e-20
WP_064824386.1|2449013_2449559_+	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_064824387.1|2449551_2451054_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	64.4	5.1e-200
WP_064824388.1|2451053_2452037_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	56.9	5.0e-103
WP_064824389.1|2452033_2452816_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.5	4.7e-112
WP_071717307.1|2453262_2453586_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_130948582.1|2454112_2454412_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.9	4.0e-40
WP_064824391.1|2454408_2454948_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_004190674.1|2454944_2455289_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2455285_2455561_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_031591489.1|2455796_2456081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064824392.1|2456213_2456486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824393.1|2456810_2457056_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.1e-18
WP_021313631.1|2457117_2457468_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.2e-51
WP_016530193.1|2457625_2458123_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_064824394.1|2458126_2459878_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	9.4e-254
WP_016530191.1|2459874_2460036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530190.1|2460025_2461252_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000999827.1|2461244_2461844_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|2461853_2463092_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
2462063:2462081	attL	GGAACAGCGCCAGCAGCAG	NA	NA	NA	NA
WP_064824395.1|2463169_2463487_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	9.0e-22
WP_004899632.1|2463556_2463754_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004104230.1|2463755_2464088_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	6.5e-55
WP_004216812.1|2464616_2464982_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	1.7e-61
WP_064824396.1|2465038_2465530_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_023339171.1|2465573_2465927_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	98.3	2.4e-60
WP_023284982.1|2465959_2466223_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_042346245.1|2466286_2466679_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_064824397.1|2466748_2469184_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.4	0.0e+00
WP_048290435.1|2469183_2469654_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	2.3e-90
WP_064824398.1|2469834_2470317_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	92.5	5.0e-80
WP_016946669.1|2470326_2470707_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	3.1e-69
WP_064824399.1|2470703_2473772_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.6	0.0e+00
WP_064824400.1|2473847_2475734_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	53.2	1.2e-150
WP_142290973.1|2475733_2476543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824402.1|2476587_2477370_-	hypothetical protein	NA	A0A2H4YHE3	Raoultella_phage	30.9	7.9e-19
WP_064824403.1|2477359_2479552_-	hypothetical protein	NA	A0A2H4YH15	Raoultella_phage	40.1	9.1e-97
WP_064824404.1|2479643_2480192_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.1	4.2e-91
WP_087786203.1|2481119_2481813_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_004146386.1|2481859_2482960_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_017879817.1|2483088_2484207_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_064824405.1|2484330_2485776_-	amidohydrolase	NA	NA	NA	NA	NA
WP_015958358.1|2485775_2487086_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032415663.1|2487252_2488161_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004143055.1|2488262_2488826_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004151560.1|2488822_2489629_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023287596.1|2489798_2490485_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151559.1|2490495_2491152_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_020316477.1|2491162_2492365_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_032433055.1|2492374_2493727_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004151556.1|2493716_2494481_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|2494473_2494863_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_032433057.1|2495940_2497557_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
2497071:2497089	attR	GGAACAGCGCCAGCAGCAG	NA	NA	NA	NA
WP_004152246.1|2497719_2499372_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004148278.1|2499426_2500938_-	anion permease	NA	NA	NA	NA	NA
WP_032412127.1|2501579_2504357_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	8.1e-66
WP_002903618.1|2504424_2505375_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004176303.1|2505355_2506075_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_023301966.1|2506071_2507688_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176301.1|2507843_2508200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183912.1|2508363_2509284_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004190310.1|2509547_2511203_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_015958364.1|2511363_2511759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903632.1|2513594_2514521_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038434949.1|2514510_2515413_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004152239.1|2515412_2516030_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004148291.1|2516033_2516993_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004224637.1|2517129_2517930_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_032105170.1|2517929_2518763_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004143106.1|2518755_2519055_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_032433060.1|2519072_2519915_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004176297.1|2519914_2521570_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|2521794_2522829_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903681.1|2523271_2523634_+	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903683.1|2523620_2523950_+	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903685.1|2523993_2524110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903687.1|2524123_2524936_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	2560145	2571032	5365209		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2560145_2560766_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|2560758_2562024_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_058886406.1|2562035_2562938_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
WP_002210513.1|2563198_2563960_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2563980_2564841_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|2565138_2565399_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2565485_2566574_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|2566604_2567870_-	MFS transporter	NA	NA	NA	NA	NA
WP_032433071.1|2567924_2571032_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	3477402	3491907	5365209	transposase	Bacillus_phage(20.0%)	13	NA	NA
WP_004200385.1|3477402_3478695_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-14
WP_004200386.1|3478697_3479483_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025403908.1|3479488_3480871_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.1	1.8e-29
WP_025403909.1|3480893_3482309_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	2.8e-54
WP_156529680.1|3482607_3482871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102003640.1|3483052_3484250_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_004201210.1|3484306_3484747_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_004189161.1|3484743_3485094_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_038434044.1|3485124_3486717_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004200391.1|3487056_3488061_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	5.2e-31
WP_004200392.1|3488527_3488650_+	small membrane protein	NA	NA	NA	NA	NA
WP_004103677.1|3489207_3490374_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	1.8e-112
WP_023321278.1|3490536_3491907_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	4.2e-31
>prophage 7
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	3521258	3528904	5365209	transposase	Stx2-converting_phage(16.67%)	7	NA	NA
WP_004189161.1|3521258_3521609_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004201210.1|3521605_3522046_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_102003640.1|3522102_3523299_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_004200428.1|3523828_3525415_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	1.7e-36
WP_004200430.1|3525715_3527563_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004103714.1|3527590_3528172_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	3.9e-31
WP_004200433.1|3528262_3528904_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.8e-35
>prophage 8
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	3770143	3838506	5365209	terminase,tail,tRNA,integrase,portal,holin,protease	Klebsiella_phage(22.73%)	75	3792874:3792898	3838701:3838725
WP_002913226.1|3770143_3770956_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|3770955_3771969_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032433350.1|3772032_3773169_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_064824412.1|3773279_3774257_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|3774343_3775519_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|3775728_3776949_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023286748.1|3777107_3779096_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|3779157_3779439_-	YfcL family protein	NA	NA	NA	NA	NA
WP_021440519.1|3779470_3780019_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|3780018_3780828_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004174960.1|3780827_3781652_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913342.1|3781654_3782740_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_002913346.1|3782781_3783714_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|3783881_3784433_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|3784453_3784939_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023286749.1|3785148_3787293_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_021313703.1|3787292_3788603_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|3788762_3789047_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913360.1|3789420_3790743_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|3790804_3791566_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|3791855_3792785_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
3792874:3792898	attL	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_023332914.1|3793635_3795123_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_064824415.1|3795573_3796125_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	1.9e-88
WP_142367700.1|3796215_3797520_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	51.0	3.7e-05
WP_064824417.1|3797530_3798292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824418.1|3798284_3799640_+	BNR-4 repeat-containing protein	NA	NA	NA	NA	NA
WP_071925142.1|3799691_3800606_-	hypothetical protein	NA	A0A1C9EHS8	Gordonia_phage	45.0	6.9e-22
WP_064824419.1|3803221_3806287_-	kinase	NA	A0A286S259	Klebsiella_phage	69.7	0.0e+00
WP_042944781.1|3806283_3806664_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	1.1e-34
WP_014228581.1|3806671_3807154_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.2	3.6e-54
WP_071925143.1|3807140_3807614_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.1	1.8e-50
WP_064824421.1|3807613_3810310_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.2	1.6e-196
WP_042944776.1|3810290_3810608_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	5.5e-19
WP_064824422.1|3810628_3811027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077268722.1|3811069_3811552_-|tail	phage tail protein	tail	O64327	Escherichia_phage	68.2	7.0e-58
WP_064824423.1|3811559_3811958_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	59.4	1.9e-40
WP_064824424.1|3811954_3812506_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.0	3.5e-53
WP_042944770.1|3812495_3812789_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042944768.1|3812781_3813108_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.8e-33
WP_071925144.1|3813189_3815205_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	83.6	0.0e+00
WP_064824426.1|3815149_3816649_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	3.9e-248
WP_020317294.1|3816645_3816861_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_064824427.1|3816857_3818966_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.8	0.0e+00
WP_029498846.1|3818965_3819457_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	2.4e-66
WP_014228566.1|3819720_3820020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038423250.1|3820211_3820460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017146255.1|3820558_3820804_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	58.0	2.3e-17
WP_064824428.1|3820868_3821111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071925145.1|3821107_3821293_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.5	4.3e-24
WP_071925146.1|3821243_3821519_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.1	2.3e-26
WP_064824430.1|3821526_3822156_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	7.6e-105
WP_071925147.1|3822155_3822437_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	4.1e-18
WP_064824431.1|3822423_3822810_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	87.5	7.5e-55
WP_064824432.1|3822957_3824010_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.1	1.3e-170
WP_064824433.1|3824160_3824352_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	87.3	3.4e-24
WP_064372835.1|3824532_3824937_-	antitermination protein	NA	S5M7R9	Escherichia_phage	50.8	7.9e-31
WP_064353132.1|3824926_3825571_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.0	2.7e-81
WP_077268723.1|3825567_3826212_-	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	55.7	5.1e-40
WP_017145559.1|3826181_3827153_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	60.4	1.5e-107
WP_064351853.1|3827149_3828676_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.3	1.2e-204
WP_017145557.1|3828668_3828944_-	NUMOD4 motif family protein	NA	NA	NA	NA	NA
WP_042921061.1|3829418_3829889_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	1.7e-61
WP_071925148.1|3829914_3830112_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	53.4	4.0e-12
WP_064824436.1|3830207_3830861_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	59.9	2.2e-70
WP_142367702.1|3831183_3831531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824438.1|3831869_3832229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824439.1|3832275_3833088_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_064824452.1|3833169_3834015_+	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.0	2.7e-73
WP_064824441.1|3834360_3834585_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	9.2e-13
WP_077268724.1|3834577_3835069_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	66.7	2.5e-31
WP_064824443.1|3835292_3835547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064824444.1|3835547_3836219_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.8	2.9e-54
WP_071925149.1|3836226_3836412_+	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	63.0	8.9e-14
WP_064824445.1|3836552_3837242_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_064824446.1|3837330_3838506_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	84.8	9.9e-199
3838701:3838725	attR	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 9
NZ_CP015025	Klebsiella pneumoniae strain Kpn223 chromosome, complete genome	5365209	4625102	4665076	5365209	terminase,lysis,tail,head,tRNA,holin,portal,plate,integrase,capsid	Erwinia_phage(24.44%)	50	4634594:4634609	4665613:4665628
WP_002916879.1|4625102_4626116_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|4626353_4626569_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_064824447.1|4626680_4628426_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	1.0e-74
WP_004174339.1|4628644_4630486_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|4630585_4631092_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023343301.1|4631450_4631669_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_032433542.1|4631762_4632170_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_032433545.1|4632210_4633371_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_064824448.1|4633370_4633850_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433547.1|4633866_4636305_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
4634594:4634609	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_014343413.1|4636297_4636417_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_004195711.1|4636449_4636725_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_032433549.1|4636785_4637301_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_019724797.1|4637314_4638496_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433550.1|4638605_4639685_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_032433551.1|4639696_4640425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125116968.1|4640430_4642761_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_076026137.1|4642696_4643284_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.8	4.1e-52
WP_032433553.1|4643291_4644200_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_014343405.1|4644204_4644552_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_015959011.1|4644548_4645190_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_045326985.1|4645532_4646576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032433555.1|4646904_4647354_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_032433558.1|4647346_4647814_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032427129.1|4647776_4647935_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_032433560.1|4647909_4648341_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032433563.1|4648337_4648835_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433564.1|4648821_4649112_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_019725382.1|4649116_4649320_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_009309691.1|4649319_4649826_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_072196895.1|4649922_4650642_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.2	3.1e-94
WP_025710540.1|4650669_4651728_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_032433566.1|4651801_4652656_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_009309687.1|4652821_4654591_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433567.1|4654590_4655634_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_032433569.1|4656146_4656341_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433571.1|4656339_4656771_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433573.1|4656909_4657860_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_071557792.1|4657837_4658146_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_162897204.1|4658182_4658338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048292468.1|4658766_4659207_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_072198081.1|4659325_4661395_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_032433578.1|4661543_4661765_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_032433580.1|4661764_4661992_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433585.1|4662059_4662398_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_023343330.1|4662361_4662562_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_039818858.1|4662569_4663079_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_001630878.1|4663109_4663373_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_032433588.1|4663502_4664078_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_032433590.1|4664077_4665076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
4665613:4665628	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
>prophage 1
NZ_CP015026	Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence	170926	5116	77369	170926	transposase	Salmonella_phage(45.45%)	58	NA	NA
WP_064824453.1|5116_6133_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077268725.1|7892_8861_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	6.7e-185
WP_127114079.1|8922_9309_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	96.9	4.7e-65
WP_000612626.1|9305_9653_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_064824457.1|9701_11240_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	2.0e-279
WP_064824458.1|11291_12230_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023287224.1|12262_13177_-	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.0	9.0e-06
WP_064824459.1|13187_14057_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_023287222.1|14073_14697_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_023288222.1|14683_16120_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_064824460.1|16249_17443_-	MFS transporter	NA	NA	NA	NA	NA
WP_077268725.1|17486_18455_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	6.7e-185
WP_064824461.1|18536_19208_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077268726.1|19298_20267_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	1.3e-183
WP_023320124.1|20682_21231_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077254766.1|21353_21935_-|transposase	transposase	transposase	A0A1B0VFY5	Salmonella_phage	59.3	6.4e-90
WP_071571073.1|21954_22140_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	59.6	1.3e-09
WP_032413443.1|22852_23296_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_032413375.1|23292_23763_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_017901409.1|23872_24133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077268727.1|25471_26422_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.4e-182
WP_032437437.1|27925_28462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437439.1|28477_29038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437442.1|29052_29712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255423.1|29972_30941_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_032437445.1|31338_31908_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_016947114.1|31966_32662_+	molecular chaperone	NA	NA	NA	NA	NA
WP_032437450.1|32673_35067_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032437452.1|35087_36107_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_077254753.1|36361_37330_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	2.7e-170
WP_064824462.1|37390_37888_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.3e-78
WP_017898986.1|37884_38235_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_046092923.1|39240_40272_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_077268728.1|41127_42096_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.8e-182
WP_064824464.1|42414_43440_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_064824465.1|43898_49580_+	DUF4011 domain-containing protein	NA	A0A240FAT5	Liberibacter_phage	46.1	1.9e-08
WP_004114612.1|51470_51818_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_023288266.1|51814_52153_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
WP_011251285.1|52908_53220_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_011251286.1|53216_53636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077268729.1|53782_54751_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.5e-171
WP_032437385.1|55879_57247_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_017900871.1|57349_58111_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_017900872.1|58107_58665_+	HutD family protein	NA	NA	NA	NA	NA
WP_032430756.1|58698_60231_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.2	9.0e-67
WP_017900874.1|60241_61117_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|61147_61828_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032430757.1|61830_62475_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017900876.1|62471_63569_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
WP_160421093.1|64844_65753_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017900878.1|65806_67201_+	cytosine permease	NA	NA	NA	NA	NA
WP_032430760.1|67212_68421_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017900880.1|68413_69223_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_015632445.1|69963_70371_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032437391.1|72245_72710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032437392.1|73303_74059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437406.1|75158_75962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254769.1|76022_77369_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015026	Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence	170926	89878	144682	170926	integrase,transposase	Escherichia_phage(26.67%)	43	92188:92204	142655:142671
WP_077252861.1|89878_89992_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	3.6e-10
WP_049257520.1|90083_91655_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	4.2e-19
92188:92204	attL	TTCATCGTTTTCACGAA	NA	NA	NA	NA
WP_077254762.1|92647_93616_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
WP_017901321.1|93633_94059_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261275.1|94055_94286_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901322.1|94538_97115_-	EstP	NA	NA	NA	NA	NA
WP_017901323.1|97117_99325_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032437422.1|100055_100838_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
WP_017901324.1|100834_101857_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
WP_007372130.1|103742_103922_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_025999313.1|106859_107342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900939.1|107617_108022_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_017900938.1|108750_109833_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_017900937.1|109954_113029_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.4	0.0e+00
WP_017900936.1|113080_114334_+	lactose permease	NA	NA	NA	NA	NA
WP_017900810.1|115492_115771_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210286.1|115864_116077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170924655.1|116989_117448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|118699_119584_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_159042860.1|119744_120821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|120970_121675_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000904895.1|121849_122464_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	4.3e-36
WP_001082319.1|122529_123333_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|123332_124169_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000427619.1|126858_127863_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001043260.1|128832_129648_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001445143.1|129930_130182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|130212_131706_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|131916_132141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|132137_132875_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|133360_133501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|133506_134211_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016946353.1|134348_135416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|135501_135756_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023332914.1|136268_137756_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_017901102.1|137841_138978_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|139043_139361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|139512_139836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|139832_140591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|140587_141547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901101.1|141589_141997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901100.1|142006_142450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|143713_144682_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
142655:142671	attR	TTCATCGTTTTCACGAA	NA	NA	NA	NA
