The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	597789	605524	5026105		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033088.1|597789_598896_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	2.7e-44
WP_001219875.1|598888_599356_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001350333.1|599342_599753_-	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000857505.1|599770_600646_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_001023616.1|600704_601604_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000699401.1|601603_602689_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_000183037.1|603061_603955_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_001115964.1|604129_605524_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 2
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	695586	705031	5026105		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292758.1|695586_696723_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	2.5e-162
WP_001337891.1|696719_698723_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001296231.1|698847_699309_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|699349_699820_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|699866_700586_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|700582_702268_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240405.1|702489_703221_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|703280_703388_+	protein YohO	NA	NA	NA	NA	NA
WP_000783108.1|703368_704100_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569376.1|704104_705031_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	3.3e-08
>prophage 3
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	1278495	1285635	5026105		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1278495_1281057_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141289.1|1281162_1281819_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001350157.1|1281869_1282637_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	3.7e-69
WP_000847998.1|1282832_1283741_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_000590417.1|1283737_1285000_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|1284996_1285635_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 4
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	1369694	1447653	5026105	plate,capsid,integrase	Enterobacteria_phage(12.5%)	57	1391738:1391753	1449339:1449354
WP_000686688.1|1369694_1371032_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000712317.1|1371028_1371694_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001246529.1|1371706_1373359_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000997068.1|1373416_1373908_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000147346.1|1374099_1376736_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	5.9e-82
WP_001350146.1|1376747_1379228_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	9.9e-07
WP_001520118.1|1379247_1381035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759220.1|1381012_1382131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759222.1|1382227_1383331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001117814.1|1383486_1383747_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
WP_001514353.1|1383748_1384885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557435.1|1384894_1388248_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_001350749.1|1388240_1389851_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001518860.1|1389856_1391287_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
1391738:1391753	attL	AAAAGGAAAAATAAAT	NA	NA	NA	NA
WP_000342483.1|1391759_1393520_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000373316.1|1393483_1394563_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000484008.1|1394543_1395080_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000106967.1|1395083_1395512_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000157825.1|1395511_1396888_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001350145.1|1397189_1398137_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066226.1|1398208_1398805_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_000382418.1|1398807_1399983_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|1399982_1401563_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_000582830.1|1401594_1402419_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|1402676_1403930_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237951.1|1404161_1405493_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775963.1|1405554_1407381_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	7.8e-25
WP_001350144.1|1407380_1410923_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138104.1|1410915_1413804_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.5e-67
WP_000946904.1|1413979_1417348_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_001276486.1|1417360_1417684_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_001078373.1|1417668_1418076_-	DUF2509 family protein	NA	NA	NA	NA	NA
WP_001144304.1|1418072_1418636_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_000857041.1|1418626_1419097_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_000816232.1|1419281_1420076_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1420082_1420958_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|1421108_1423355_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1423367_1423898_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|1424582_1425272_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1425340_1426054_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000758655.1|1426191_1426410_+	lipoprotein YgdR	NA	NA	NA	NA	NA
WP_001199299.1|1426517_1427558_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000004601.1|1427589_1428783_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_000899027.1|1428775_1430935_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
WP_000201043.1|1431520_1432552_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_001120720.1|1432558_1433821_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000741810.1|1433942_1434878_+	DNA-binding transcriptional regulator LysR	NA	NA	NA	NA	NA
WP_000848654.1|1434864_1435557_-	amino acid racemase	NA	NA	NA	NA	NA
WP_000602503.1|1437417_1438179_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
WP_000383248.1|1438208_1439045_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000656011.1|1439331_1440513_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_000065950.1|1440767_1441997_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_000023114.1|1442419_1443640_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000179458.1|1443734_1444448_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.8	1.0e-49
WP_000890061.1|1444482_1446321_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.3	2.5e-31
WP_001350140.1|1446340_1446538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000600410.1|1446624_1447653_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
1449339:1449354	attR	ATTTATTTTTCCTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	3697575	3713945	5026105	integrase	Enterobacteria_phage(15.38%)	20	3691997:3692010	3707052:3707065
3691997:3692010	attL	CGCTATGGCAAACA	NA	NA	NA	NA
WP_000749897.1|3697575_3698631_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	1.1e-116
WP_001285279.1|3698919_3700023_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-61
WP_000893298.1|3700034_3701288_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_000772643.1|3701643_3702858_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000035054.1|3703285_3703489_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412531.1|3703488_3703920_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_001019374.1|3703932_3704766_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.6e-20
WP_000476150.1|3704758_3704941_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000958749.1|3704934_3706002_+	ash family protein	NA	NA	NA	NA	NA
WP_001065661.1|3705994_3706189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|3706185_3706449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3706445_3706667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058743.1|3706659_3707262_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
3707052:3707065	attR	CGCTATGGCAAACA	NA	NA	NA	NA
WP_000628966.1|3707272_3707614_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208877.1|3707606_3707978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001244111.1|3707964_3710721_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	5.2e-299
WP_001018524.1|3711315_3711477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420671.1|3711493_3711955_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_000909177.1|3711948_3712626_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000246955.1|3712625_3713945_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	44.2	2.4e-36
>prophage 6
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	4260797	4338338	5026105	integrase,portal,terminase,tail,capsid,protease,lysis,head,plate	Salmonella_phage(64.81%)	84	4260697:4260723	4295944:4295970
4260697:4260723	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290939.1|4260797_4261850_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_000102108.1|4261929_4263261_-	NTPase	NA	R9TRQ8	Vibrio_phage	27.1	3.2e-20
WP_001350185.1|4263274_4263457_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	55.9	8.5e-09
WP_001350184.1|4263472_4264042_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|4264187_4264391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460900.1|4264455_4264965_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
WP_001350183.1|4264972_4265206_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000166365.1|4265153_4265612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961902.1|4265805_4266072_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000996717.1|4266189_4266531_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|4266598_4266832_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|4266831_4267059_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104133.1|4267055_4267913_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000017610.1|4267909_4270324_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001154434.1|4270477_4270666_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4270676_4270910_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000552033.1|4271231_4273124_+	NTPase KAP	NA	NA	NA	NA	NA
WP_000885505.1|4273647_4274319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520388.1|4274371_4275421_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	6.4e-173
WP_001098443.1|4275420_4277187_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|4277329_4278163_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|4278179_4279238_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059209.1|4279241_4279892_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673509.1|4279987_4280452_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	2.7e-75
WP_000868175.1|4280451_4280655_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4280658_4280874_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069913.1|4280854_4281367_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_000730951.1|4281368_4281746_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001080919.1|4281742_4282171_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	1.7e-47
WP_001039944.1|4282266_4282698_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_000829132.1|4282690_4283143_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.8	5.9e-59
WP_000833215.1|4283178_4283931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993764.1|4284023_4284602_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177590.1|4284598_4284958_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268277.1|4284944_4285853_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_001086836.1|4285845_4286451_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000104751.1|4286447_4287995_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.6	3.0e-195
WP_001001157.1|4287994_4288597_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.9	9.8e-94
WP_000046111.1|4288732_4289905_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	88.5	5.6e-202
WP_001207656.1|4289914_4290430_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281016.1|4290484_4290787_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|4290801_4290921_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282737.1|4290913_4293991_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.6	0.0e+00
WP_000980395.1|4293987_4294473_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001011776.1|4294469_4295570_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|4295660_4295879_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4296115_4297801_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
4295944:4295970	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|4298070_4298448_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|4298477_4298735_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|4298894_4299182_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189176.1|4299165_4299888_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4299948_4300851_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4300938_4301415_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4301764_4302877_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4302971_4304105_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105432.1|4304114_4305068_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4305064_4305910_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4305969_4306458_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149693.1|4306498_4307626_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	7.9e-28
WP_001295905.1|4307654_4308386_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|4308610_4309279_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|4309278_4309995_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756578.1|4310001_4310733_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4310750_4311479_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|4311696_4312212_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4312337_4312661_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255185.1|4312657_4313488_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|4313484_4314498_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136522.1|4314596_4316027_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566398.1|4316037_4317039_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|4317075_4318794_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178690.1|4318926_4319895_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458845.1|4319906_4321559_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|4321702_4322602_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4322922_4323618_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|4324043_4325702_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001400542.1|4325698_4326655_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|4326805_4327921_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188133.1|4327917_4329864_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4329936_4330161_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4330483_4330804_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4330834_4333111_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097883.1|4334124_4335108_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	3.4e-43
WP_001101561.1|4335104_4338338_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	1.3e-83
>prophage 7
NZ_CP016007	Escherichia coli strain NGF1 chromosome, complete genome	5026105	4649521	4695686	5026105	integrase,portal,terminase,tRNA,tail,capsid,lysis,head	Enterobacteria_phage(64.91%)	64	4647839:4647853	4676205:4676219
4647839:4647853	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001298466.1|4649521_4650628_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4650681_4651143_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248679.1|4651152_4651806_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4651977_4653228_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4653341_4654484_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4654473_4654710_-	excisionase	NA	NA	NA	NA	NA
WP_000488402.1|4654849_4655089_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.0e-37
WP_000763364.1|4655136_4655355_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000151206.1|4655453_4655669_-	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	6.5e-32
WP_064640965.1|4655676_4656429_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	3.2e-150
WP_000682312.1|4656425_4656584_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
WP_000186789.1|4656580_4657261_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_001350280.1|4657257_4658043_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	3.1e-148
WP_000995436.1|4658048_4658345_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233575.1|4658420_4658627_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.4e-28
WP_001616716.1|4659108_4660041_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	3.6e-87
WP_000414677.1|4660037_4660511_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001295669.1|4660592_4661285_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|4661395_4661623_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|4661653_4662193_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147907.1|4662189_4663209_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	65.0	6.1e-112
WP_000788891.1|4663205_4663907_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	7.1e-128
WP_000145920.1|4663903_4664197_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	90.3	2.3e-40
WP_000371307.1|4664485_4665238_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_072142085.1|4666067_4666169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053011.1|4666165_4666621_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|4666620_4666791_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774484.1|4666783_4667074_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099712.1|4667070_4667433_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971073.1|4667429_4667570_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	3.2e-08
WP_001204794.1|4667655_4668039_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|4668227_4669310_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4669899_4670115_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193273.1|4670119_4670434_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001168526.1|4670430_4670670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101164.1|4670804_4671338_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001228695.1|4671554_4671737_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_071527053.1|4671688_4671796_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	97.1	8.2e-12
WP_001298464.1|4671827_4672121_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4672601_4672928_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4673134_4673317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453576.1|4673880_4674426_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027281.1|4674400_4676326_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
4676205:4676219	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|4676322_4676529_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001337540.1|4676525_4678127_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123325.1|4678107_4679439_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_000201478.1|4679448_4679781_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118193.1|4679836_4680862_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000158881.1|4680903_4681299_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000752962.1|4681310_4681664_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	6.4e-61
WP_000985128.1|4681675_4682254_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	4.3e-78
WP_000683157.1|4682250_4682646_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_001350276.1|4682653_4683394_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	1.5e-131
WP_000479203.1|4683409_4683832_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|4683813_4684248_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840215.1|4684240_4686802_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000847379.1|4686798_4687128_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152626.1|4687127_4687826_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_001337536.1|4687830_4688574_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090899.1|4688510_4689143_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_000515311.1|4689203_4692617_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001230375.1|4692686_4693286_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_001350275.1|4693350_4695411_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	5.7e-125
WP_000654168.1|4695407_4695686_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
