The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1060795	1067935	4994918		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1060795_1061434_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1061430_1062693_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1062689_1063598_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1063793_1064561_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1064611_1065268_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1065373_1067935_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1430583	1479077	4994918	protease,capsid,lysis,tail,plate,terminase,holin,integrase	Salmonella_phage(37.88%)	69	1428115:1428131	1481087:1481103
1428115:1428131	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1430583_1432017_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1432232_1433147_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|1433218_1434466_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_064638098.1|1434995_1435196_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	1.6e-32
WP_000253289.1|1435520_1435805_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_064638103.1|1435804_1436590_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.0	4.6e-59
WP_001151811.1|1436593_1436743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064638106.1|1436744_1437344_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	85.7	5.1e-58
WP_064638108.1|1437396_1437585_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	98.4	1.1e-27
WP_061356625.1|1437581_1437749_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	94.5	1.0e-21
WP_064638112.1|1437759_1438056_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	95.9	3.1e-48
WP_064638115.1|1438079_1438667_-	hypothetical protein	NA	A0A2D1GLM1	Escherichia_phage	97.4	5.4e-105
WP_015966849.1|1438663_1439344_-	ATP-binding protein	NA	K7PMI2	Enterobacteria_phage	100.0	5.8e-127
WP_000613347.1|1439352_1439541_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
WP_015966850.1|1439537_1439651_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	2.7e-13
WP_001198866.1|1439643_1439784_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_032234312.1|1439863_1440112_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	98.8	4.5e-37
WP_000915090.1|1440511_1440649_-	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_064638118.1|1440657_1440963_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	93.8	2.6e-26
WP_024220799.1|1441409_1442282_-	hypothetical protein	NA	I6NRL3	Burkholderia_virus	28.4	7.7e-23
WP_064638121.1|1442313_1443027_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	98.7	9.1e-131
WP_000437872.1|1443127_1443328_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	98.5	5.6e-30
WP_000251074.1|1443437_1443734_+	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	96.9	2.1e-44
WP_064638123.1|1443896_1444781_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	87.1	1.9e-130
WP_064638125.1|1444888_1446769_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.4	0.0e+00
WP_000796283.1|1446845_1447172_+	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_029396173.1|1447194_1447641_+	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	92.6	3.4e-75
WP_064638127.1|1447637_1448165_+	HNH endonuclease	NA	A0A1U9HWQ1	Salmonella_phage	37.1	1.1e-19
WP_064638132.1|1448161_1448692_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	96.5	6.0e-95
WP_025269776.1|1448688_1449534_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	57.3	8.4e-91
WP_001254257.1|1449530_1449713_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_064638135.1|1449987_1450668_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	87.6	9.7e-114
WP_064638136.1|1450742_1451465_+	phage antirepressor KilAC domain-containing protein	NA	K7P6K2	Enterobacteria_phage	98.3	5.1e-129
WP_042041846.1|1451464_1451755_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	99.0	6.5e-51
WP_004031420.1|1451751_1452114_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NRL7	Escherichia_phage	100.0	2.0e-62
WP_064638138.1|1452256_1452745_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	96.9	5.0e-88
WP_001570152.1|1453272_1453596_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_001570151.1|1453579_1454056_+	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	100.0	7.5e-89
WP_064638141.1|1454039_1454501_+|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	98.0	5.4e-76
WP_057696221.1|1454710_1455439_+	KilA-N domain-containing protein	NA	A0A2I6PIG6	Escherichia_phage	100.0	1.1e-142
WP_064638144.1|1455441_1455699_+	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	98.8	1.9e-38
WP_064638147.1|1455993_1456548_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.0	4.0e-65
WP_064638150.1|1456550_1458173_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	96.1	0.0e+00
WP_064638153.1|1458172_1459639_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	5.1e-261
WP_138642691.1|1459529_1460264_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_021548388.1|1460278_1461499_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.8	2.6e-202
WP_001066729.1|1461502_1462009_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_029399662.1|1462020_1462962_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	8.3e-156
WP_032197767.1|1463190_1463598_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.3e-68
WP_033544652.1|1463594_1464149_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.3e-79
WP_001142480.1|1464135_1464525_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_033544654.1|1464499_1465063_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_064638156.1|1465066_1466212_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	3.6e-161
WP_000109249.1|1466222_1466663_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_023565715.1|1466666_1467119_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_025404369.1|1467296_1469285_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	4.0e-269
WP_064638160.1|1469284_1469872_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_016233440.1|1469871_1470174_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	2.4e-48
WP_025404368.1|1470176_1471238_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	2.0e-158
WP_032162015.1|1471241_1471583_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.4	2.5e-33
WP_000466689.1|1471636_1471876_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_024233996.1|1471935_1472691_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	87.3	2.8e-114
WP_001270637.1|1472690_1473044_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_064638162.1|1473043_1474243_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	6.4e-185
WP_064638165.1|1474239_1474920_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	6.1e-108
WP_064638168.1|1474919_1475753_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.5	1.1e-58
WP_064638171.1|1475752_1476355_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	92.9	9.2e-100
WP_042353435.1|1476675_1477833_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.8e-221
WP_000368131.1|1478144_1479077_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1481087:1481103	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1709175	1718617	4994918		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1709175_1710102_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1710106_1710838_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1710818_1710926_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1710985_1711717_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1711938_1713624_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1713620_1714340_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1714386_1714857_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1714897_1715359_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1715483_1717484_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1717480_1718617_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1731182	1797723	4994918	capsid,transposase,tRNA,lysis,tail,plate,head,terminase,portal,holin,integrase	Escherichia_phage(42.55%)	74	1758433:1758460	1792639:1792666
WP_001295427.1|1731182_1733216_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1733347_1734457_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1734719_1735001_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1735293_1735836_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1735916_1736591_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945406.1|1736606_1739087_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026154.1|1739100_1740135_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1740216_1740555_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|1740773_1741598_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019938.1|1741718_1741991_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195590.1|1742213_1743002_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1742998_1743799_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001315719.1|1743863_1744682_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1744733_1745480_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|1745453_1746419_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|1746415_1747420_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000858484.1|1747416_1748694_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|1748950_1750003_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1750312_1751167_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|1751195_1752458_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1752467_1752920_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1752950_1753235_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|1753238_1754594_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1754642_1755683_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1755782_1756562_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_064638203.1|1756643_1757543_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1757957_1758275_+	hypothetical protein	NA	NA	NA	NA	NA
1758433:1758460	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001512914.1|1758539_1759553_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	3.7e-194
WP_001306384.1|1759668_1759968_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1760082_1760358_+	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1760368_1760539_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_064638576.1|1760535_1761036_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.1e-90
WP_000557703.1|1761099_1761324_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001512913.1|1761323_1761626_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	1.2e-44
WP_001113271.1|1761625_1761850_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_000027674.1|1761846_1762122_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_064638207.1|1762111_1764391_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_021570163.1|1764630_1767114_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_064638211.1|1767493_1768528_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	9.3e-201
WP_000156861.1|1768527_1770300_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_064638214.1|1770473_1771328_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.7	8.4e-139
WP_001248565.1|1771386_1772460_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	4.3e-201
WP_045172572.1|1772463_1773207_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	100.0	7.1e-126
WP_000988633.1|1773306_1773816_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1773815_1774019_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1774022_1774304_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_064638216.1|1774303_1774801_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.0e-92
WP_057075500.1|1774815_1775241_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	93.6	2.0e-56
WP_001355820.1|1775228_1775672_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	6.4e-66
WP_000917139.1|1775761_1776229_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_001001786.1|1776221_1776674_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_028985811.1|1776740_1777376_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.6e-110
WP_000127163.1|1777372_1777720_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|1777724_1778633_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285332.1|1778625_1779156_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	4.3e-101
WP_064638223.1|1779166_1781377_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	94.0	0.0e+00
WP_001164095.1|1781380_1781908_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	4.4e-90
WP_057075509.1|1782087_1782999_+	restriction endonuclease	NA	Q858R6	Enterobacteria_phage	100.0	8.8e-179
WP_001286716.1|1783348_1784539_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|1784551_1785070_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_064638227.1|1785126_1785372_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.2	2.9e-28
WP_001016257.1|1785425_1786172_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1786186_1787728_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000785970.1|1788020_1788140_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_064638230.1|1788132_1790580_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.6	0.0e+00
WP_000978889.1|1790594_1791074_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_057075513.1|1791073_1792237_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_000468308.1|1792319_1792538_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1792810_1794172_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1792639:1792666	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1794274_1794571_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1794572_1794869_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1795077_1795410_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|1795600_1796323_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675150.1|1796319_1797723_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1844396	1851914	4994918		Escherichia_phage(42.86%)	7	NA	NA
WP_021523160.1|1844396_1845791_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523159.1|1845948_1846944_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|1847175_1848069_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|1848440_1849526_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|1849525_1850425_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|1850482_1851361_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|1851365_1851914_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	1880597	1980159	4994918	protease,capsid,transposase,tRNA,tail,head,terminase,portal,holin,integrase	Escherichia_phage(41.82%)	97	1917081:1917095	1933867:1933881
WP_000399648.1|1880597_1881578_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000450409.1|1882362_1882692_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|1882792_1882975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1883463_1883577_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1883589_1883784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285585.1|1884242_1884611_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|1884684_1884906_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|1884968_1885445_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|1885460_1885940_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234530.1|1886021_1886843_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846713.1|1887063_1887474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102643.1|1888307_1889378_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203535.1|1889374_1890280_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_064638241.1|1890276_1892673_-	dynamin family protein	NA	NA	NA	NA	NA
WP_000514100.1|1893845_1894997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405986.1|1896486_1897509_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.5e-200
WP_001323403.1|1897508_1898288_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000349537.1|1898326_1898479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1899216_1899819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235214.1|1899912_1900119_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001000406.1|1901268_1902804_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000609174.1|1902853_1903201_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|1903197_1903581_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_064638245.1|1904090_1904660_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270974.1|1904919_1905321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|1905308_1905716_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000578774.1|1908030_1908579_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_164708657.1|1910002_1911215_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_000973176.1|1915446_1915992_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|1915988_1916732_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166160.1|1916743_1917823_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
1917081:1917095	attL	TTGATGTTGGTATTG	NA	NA	NA	NA
WP_000986321.1|1917884_1918820_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001598514.1|1919277_1920195_+	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_001011008.1|1920296_1921247_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|1921364_1923008_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1923639_1924356_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1924698_1926153_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_085947771.1|1926845_1928007_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001598512.1|1929457_1930255_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_064638252.1|1930490_1931516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.4e-102
WP_000096344.1|1931515_1931719_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064638256.1|1931777_1934219_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.4	2.8e-110
1933867:1933881	attR	TTGATGTTGGTATTG	NA	NA	NA	NA
WP_001070255.1|1934312_1934504_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_053271049.1|1934500_1934689_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_064638259.1|1935256_1935475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952701.1|1935634_1935796_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	54.5	9.2e-07
WP_000444613.1|1936074_1936719_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_001261754.1|1936818_1937046_+	cell division control protein	NA	NA	NA	NA	NA
WP_000693890.1|1937042_1937468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064638265.1|1937539_1938610_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	7.7e-65
WP_064638268.1|1938650_1939073_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.7e-63
WP_000403777.1|1939130_1939487_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001224671.1|1939580_1939763_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_170990077.1|1939755_1939932_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	1.7e-25
WP_064638271.1|1939928_1940444_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.2	1.2e-34
WP_000813256.1|1940735_1940891_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_000737636.1|1941034_1941427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024168546.1|1941723_1942002_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_024188444.1|1942003_1943059_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_000139992.1|1943059_1943425_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_001064894.1|1943421_1944111_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000839572.1|1944907_1945123_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000992100.1|1945542_1946076_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228684.1|1946292_1946478_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001140099.1|1946582_1946933_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_064638275.1|1947080_1947563_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.8	6.0e-86
WP_059328193.1|1947562_1949320_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|1949331_1949514_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_059332703.1|1949513_1950755_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.0e-241
WP_001193632.1|1950732_1951383_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000257489.1|1951397_1952603_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|1952653_1952842_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|1952853_1953159_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|1953167_1953506_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|1953505_1953952_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|1953948_1954293_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|1954352_1955057_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|1955071_1955443_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978930.1|1955466_1955745_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_064638279.1|1955791_1959031_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.5	0.0e+00
WP_001115183.1|1959023_1959365_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_001152453.1|1959364_1960063_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_042630999.1|1960068_1960812_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	4.9e-151
WP_052167187.1|1960748_1961357_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	3.1e-103
WP_064638283.1|1961417_1964897_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.0	0.0e+00
WP_001721301.1|1964964_1965564_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	3.8e-106
WP_071952703.1|1965628_1969084_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_064638287.1|1969083_1969665_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.1e-101
WP_000799406.1|1969897_1970761_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1970744_1971881_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359463.1|1972130_1973360_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1973505_1974627_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_064638292.1|1974702_1976163_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1976162_1976834_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423719.1|1977001_1978372_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001297479.1|1978375_1979017_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1979052_1980159_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	2382108	2434100	4994918	capsid,transposase,lysis,tail,head,terminase,portal,integrase	Enterobacteria_phage(32.65%)	70	2406347:2406362	2438796:2438811
WP_000527751.1|2382108_2383569_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_120795384.1|2385544_2385658_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2385726_2385960_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2386276_2386867_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_085947771.1|2386940_2388103_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000090891.1|2388400_2389033_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_023568777.1|2388969_2389713_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.6e-146
WP_001152624.1|2389718_2390417_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847345.1|2390416_2390746_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_064638348.1|2390742_2393322_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.9	0.0e+00
WP_000459480.1|2393314_2393749_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000479139.1|2393730_2394153_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_001439072.1|2394168_2394909_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|2394916_2395312_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000985116.1|2395308_2395887_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|2395898_2396252_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158876.1|2396263_2396659_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000063254.1|2396700_2397726_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001358225.1|2397781_2398114_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123245.1|2398123_2399443_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	3.1e-233
WP_001324962.1|2399423_2401025_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000198149.1|2401021_2401228_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|2401224_2403150_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|2403124_2403670_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|2404058_2404292_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2404349_2404760_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2404911_2405085_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2405256_2405412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985912.1|2405491_2405557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2405559_2405748_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2405758_2405971_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2406333_2406831_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2406347:2406362	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|2406827_2407361_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2407357_2407669_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2407673_2407889_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066485.1|2408641_2408857_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_024172454.1|2409155_2409368_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122985911.1|2409422_2409512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|2409789_2410542_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001439074.1|2410555_2411605_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2411606_2411885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2411951_2412203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2412419_2412575_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2412646_2412934_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2412933_2413173_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2413197_2413503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2413705_2414038_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589013.1|2414474_2415815_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001315552.1|2417480_2417837_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	6.3e-40
WP_001151260.1|2417833_2418256_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.3e-63
WP_000054514.1|2418296_2419262_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	4.2e-54
WP_000705355.1|2419242_2419764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|2419747_2419975_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2420056_2420464_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379588.1|2420632_2420788_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|2420947_2421166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2421733_2421922_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2421918_2422110_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048327.1|2422202_2424674_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2424746_2424998_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_064638355.1|2425032_2426313_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001360138.1|2426332_2426443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|2426500_2427520_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|2427531_2428746_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2428951_2429278_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|2429412_2429754_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2429788_2430349_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_077249271.1|2430351_2431062_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2431169_2431475_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041535.1|2431673_2434100_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
2438796:2438811	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 8
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	2807257	2848479	4994918	capsid,tail,head,terminase,portal,holin	Escherichia_phage(55.56%)	43	NA	NA
WP_001079090.1|2807257_2807788_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_064638392.1|2809279_2809861_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	7.0e-105
WP_071952687.1|2809860_2813316_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_001721301.1|2813380_2813980_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	3.8e-106
WP_064638400.1|2814047_2817527_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001152453.1|2818902_2819601_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_001115183.1|2819600_2819942_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_000978930.1|2823219_2823498_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000097528.1|2823906_2824611_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	2.8e-116
WP_001209399.1|2824670_2825015_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2825011_2825458_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001147820.1|2825457_2825796_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2825804_2826110_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2826121_2826310_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257522.1|2826360_2827566_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_000466255.1|2828207_2829449_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000478564.1|2829448_2829631_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_001140903.1|2829642_2831400_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_001140099.1|2832028_2832379_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001228684.1|2832483_2832669_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_000992100.1|2832885_2833419_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193288.1|2833482_2833833_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000839572.1|2833837_2834053_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193722.1|2834920_2835799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|2836048_2836435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029397194.1|2836787_2837165_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	9.0e-37
WP_061157899.1|2837165_2838221_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	1.3e-88
WP_024168546.1|2838222_2838501_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_050542959.1|2838728_2839025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813267.1|2839264_2839420_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	72.5	5.4e-12
WP_061157900.1|2839756_2840227_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.2	2.1e-35
WP_000753060.1|2840223_2840400_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224672.1|2840392_2840575_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_021575571.1|2840719_2841193_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_029402725.1|2841189_2841612_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	7.4e-64
WP_001262367.1|2841652_2842723_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_000693883.1|2842794_2843220_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001397087.1|2843838_2844177_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000379575.1|2844469_2844625_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171933.1|2844784_2845003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2845567_2845756_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_064638404.1|2845752_2845944_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064638407.1|2846037_2848479_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.4	5.4e-114
>prophage 9
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	3695065	3798982	4994918	protease,capsid,lysis,tail,plate,head,terminase,portal,holin,integrase	Enterobacteria_phage(31.43%)	117	3720661:3720677	3797771:3797787
WP_000131044.1|3695065_3697099_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3697227_3697815_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|3697828_3699301_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3699314_3700985_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|3702059_3702623_+	tyrosine-type DNA invertase IpbA	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|3702952_3703747_+	LuxR family transcriptional regulator HyxR	NA	NA	NA	NA	NA
WP_001406334.1|3703900_3704662_+	protein HyxA	NA	NA	NA	NA	NA
WP_071593451.1|3705807_3707001_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209088.1|3707184_3707850_+	membrane protein	NA	NA	NA	NA	NA
WP_001315273.1|3708095_3708791_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064638464.1|3708783_3710211_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102101.1|3710221_3710941_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|3711469_3712324_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046293.1|3712549_3713875_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|3713983_3714220_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3714231_3714825_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3714984_3715854_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001315271.1|3716102_3716960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064638466.1|3717081_3721335_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3720661:3720677	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3722450_3722552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3722914_3723178_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3723177_3723318_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3723352_3723580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|3724402_3724945_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|3725019_3725607_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3725664_3726333_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|3726358_3728884_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001315269.1|3728873_3730517_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|3730485_3731196_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3731508_3731838_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3732085_3732700_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|3733117_3733807_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3733803_3734760_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_064638469.1|3734756_3736955_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	2.5e-38
WP_000121354.1|3736964_3737921_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111353.1|3737899_3738310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201382.1|3738573_3739647_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.9	3.8e-48
WP_154740970.1|3739656_3739818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332875.1|3740825_3742241_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_001220593.1|3742230_3743517_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000864668.1|3743518_3744076_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000777326.1|3744078_3746211_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_064638471.1|3746207_3747419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174391.1|3747415_3748801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060707.1|3748790_3749780_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000698458.1|3749793_3751005_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	33.1	3.1e-14
WP_000078678.1|3751006_3752119_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000198515.1|3752121_3752529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682702.1|3752551_3753955_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_000154259.1|3754002_3755022_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	4.3e-81
WP_001332888.1|3755098_3756025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|3757095_3757869_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|3757929_3758484_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_071952692.1|3758514_3758904_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	7.2e-13
WP_001106828.1|3758925_3759366_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_021563757.1|3759337_3759940_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.0e-99
WP_000554706.1|3759939_3760710_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383552.1|3760713_3761298_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_053265522.1|3761288_3762347_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.0	1.2e-198
WP_000424732.1|3762333_3762759_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|3762758_3763307_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_001764259.1|3763306_3764386_-	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.4	2.6e-206
WP_001764258.1|3764382_3765711_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	1.2e-245
WP_000679479.1|3765772_3766303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557407.1|3766394_3768227_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.9	1.7e-301
WP_000661047.1|3768368_3768638_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_053265523.1|3768637_3768994_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_001764254.1|3768993_3770490_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	100.0	1.7e-275
WP_000497751.1|3770473_3770644_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|3770652_3771213_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|3771209_3771716_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_052921849.1|3771690_3772101_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
WP_000927711.1|3772097_3772421_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601363.1|3772423_3772624_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_064638492.1|3772673_3773879_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.2e-223
WP_001193631.1|3773893_3774544_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466242.1|3774521_3775763_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000605606.1|3775762_3775945_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_137471691.1|3775956_3777453_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929190.1|3777686_3778181_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	8.6e-88
WP_047645117.1|3778306_3778657_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	2.6e-62
WP_000738423.1|3779182_3779476_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3779566_3779749_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180488.1|3779965_3780442_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	1.1e-84
WP_000544528.1|3780428_3780734_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_000136427.1|3780962_3781766_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.6	8.6e-69
WP_064638495.1|3781987_3782677_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3782673_3782814_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001468345.1|3782810_3783173_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	3.3e-60
WP_063100010.1|3783169_3783460_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	3.3e-47
WP_000224907.1|3783452_3783623_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_050010320.1|3783622_3784078_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_001303586.1|3784074_3784176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017329.1|3784265_3784775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064638497.1|3784824_3785307_-	hypothetical protein	NA	K7P7J4	Enterobacteria_phage	72.3	1.9e-10
WP_096891597.1|3785713_3785923_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	79.7	4.7e-27
WP_000062289.1|3785940_3786141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488730.1|3786137_3786431_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_060710352.1|3786427_3787129_-	Replication protein P	NA	Q9EYB6	Enterobacteria_phage	98.7	1.9e-128
WP_077249259.1|3787125_3788145_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.0e-110
WP_001182873.1|3788141_3788681_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3788711_3788939_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3789049_3789742_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_060710353.1|3790030_3790501_+	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	40.1	5.6e-20
WP_060710354.1|3790500_3790884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|3791357_3791564_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_064638499.1|3791639_3791936_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.4e-48
WP_000100847.1|3791941_3792727_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186811.1|3792723_3793404_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_077249260.1|3793400_3793562_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.0	5.0e-21
WP_000129285.1|3793554_3794112_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000188870.1|3794188_3794404_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_033554594.1|3794502_3794721_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	4.1e-34
WP_000488407.1|3794768_3795047_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051887.1|3795245_3796409_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3796613_3797867_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3797771:3797787	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3797878_3798982_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 10
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	3834868	3897060	4994918	tRNA,transposase,protease,plate	Enterobacteria_phage(12.5%)	50	NA	NA
WP_000611742.1|3834868_3835282_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3835285_3837136_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3837099_3838182_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|3838206_3839487_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3839483_3840008_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|3840010_3841342_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|3841346_3842108_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614334.1|3842116_3844876_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000088859.1|3844872_3845616_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3845620_3847033_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3847141_3850576_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|3850586_3851939_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000908057.1|3852488_3853403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3853412_3853892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3854028_3854814_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3855353_3856085_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3856149_3856617_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3856613_3857336_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3857369_3858125_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3858196_3859555_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|3859602_3860373_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3860450_3861251_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3861491_3862406_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3862402_3863206_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|3868967_3869540_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3869727_3870759_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3870751_3871405_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3871444_3872260_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|3872377_3872782_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3872778_3873486_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_063121749.1|3873597_3875316_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|3876396_3877377_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3877626_3878337_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3878350_3878773_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_064638511.1|3878769_3879315_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3879480_3879681_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3879667_3879928_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3879976_3881275_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3881339_3881729_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3881785_3883927_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3884025_3884985_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3884997_3888480_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3888516_3889113_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3889109_3890258_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3890257_3891046_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3891049_3891505_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3891609_3892635_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3892638_3893124_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3893245_3895678_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3895707_3897060_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 11
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	4303760	4363547	4994918	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4303760_4305113_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4305206_4305758_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4305913_4307287_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4307462_4308461_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596021.1|4308493_4309489_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001313531.1|4309475_4310498_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205807.1|4310511_4312014_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4312153_4313110_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4313419_4313950_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239577.1|4314026_4314377_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|4314370_4314622_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4314833_4315175_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060966.1|4315177_4318957_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4318953_4320687_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4320892_4321531_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4321853_4323197_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4323275_4323482_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175285.1|4323806_4324361_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937656.1|4324423_4325362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886903.1|4325573_4326314_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000084622.1|4328565_4328946_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023155073.1|4329034_4329895_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001350569.1|4330002_4330968_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|4331075_4331738_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4331782_4333195_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4333503_4334124_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4334342_4334981_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826426.1|4335115_4336324_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	6.4e-209
WP_000604913.1|4336331_4336946_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	4.7e-43
WP_050541734.1|4338201_4338957_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4339027_4339477_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4339518_4339746_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4339750_4340065_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4340071_4340467_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4340793_4341069_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170808.1|4341197_4341884_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949514.1|4341883_4342738_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4342747_4343398_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776510.1|4343411_4343876_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4343885_4344191_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_023154553.1|4344206_4345604_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4345958_4347023_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4347130_4347886_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569706.1|4347882_4348632_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4348813_4349143_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4349291_4349567_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_024257752.1|4349683_4351309_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943970.1|4351392_4352556_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
WP_000101690.1|4352558_4353197_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4353206_4353605_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012551.1|4353622_4354282_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4354332_4355031_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220132.1|4355049_4355451_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4355577_4356309_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4356489_4358931_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4358969_4359395_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4359599_4360898_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4361001_4361199_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4361280_4362285_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4362287_4363547_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 12
NZ_CP015995	Escherichia coli strain S51 chromosome, complete genome	4994918	4402606	4449568	4994918	transposase,integrase	Enterobacteria_phage(25.0%)	32	4400303:4400318	4452959:4452974
4400303:4400318	attL	GTGCTGATGCCGGTTT	NA	NA	NA	NA
WP_001218742.1|4402606_4403791_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_064638549.1|4403940_4404951_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000253907.1|4405046_4407173_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083369.1|4407235_4408513_+	MFS transporter	NA	NA	NA	NA	NA
WP_024170639.1|4408509_4409943_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_021547729.1|4410136_4411531_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_032145493.1|4412795_4413830_+	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_021547726.1|4413973_4415647_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001238008.1|4415712_4415910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|4416049_4416316_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_021547725.1|4416312_4417884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021547724.1|4417930_4419010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021547722.1|4420373_4421111_-	porin family protein	NA	NA	NA	NA	NA
WP_021547720.1|4422007_4423096_+	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
WP_021547719.1|4423088_4424723_+	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.6	2.3e-20
WP_021547718.1|4424712_4426713_+	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_000937307.1|4426712_4427066_+	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_021547717.1|4427123_4428662_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_021547716.1|4428666_4429857_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_064638552.1|4429846_4434919_-	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_021547714.1|4434899_4436225_-	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
WP_021547713.1|4436229_4437879_-	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
WP_021547712.1|4438464_4438989_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.9e-62
WP_001310555.1|4439283_4440300_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_021547711.1|4440304_4440541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541817.1|4441247_4442476_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001334006.1|4443124_4443445_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_164708657.1|4444052_4445265_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_021547710.1|4445432_4446362_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000066154.1|4446749_4447355_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
WP_000531854.1|4447440_4448289_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_001352368.1|4448359_4449568_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
4452959:4452974	attR	GTGCTGATGCCGGTTT	NA	NA	NA	NA
>prophage 1
NZ_CP015997	Escherichia coli strain S51 plasmid pS51_2, complete sequence	98216	0	98106	98216	integrase,head,tail,holin	Escherichia_phage(71.43%)	99	13482:13498	66519:66535
WP_071952717.1|625_907_+	hypothetical protein	NA	A0A1B0VBS6	Salmonella_phage	90.3	5.9e-41
WP_000887652.1|974_1304_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580770.1|1300_1744_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_042630947.1|1730_2333_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.0	3.5e-99
WP_000434681.1|2334_4254_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	99.4	0.0e+00
WP_000175490.1|4250_4616_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	97.5	2.1e-46
WP_064638611.1|4628_7616_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
WP_001165933.1|7605_7917_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000432101.1|7945_8734_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	3.0e-143
WP_024183645.1|8740_9418_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.1	2.6e-127
WP_000068873.1|9615_10104_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.5e-87
WP_001467310.1|10273_10831_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	3.0e-105
WP_000132942.1|11122_12142_-|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	97.3	6.4e-178
WP_064638645.1|12134_13652_-	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	100.0	2.6e-292
13482:13498	attL	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_064638613.1|13919_20687_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	99.2	0.0e+00
WP_000224043.1|20720_21161_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|21157_21406_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_032190829.1|21551_23498_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	99.8	0.0e+00
WP_064638616.1|23500_26413_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	99.7	0.0e+00
WP_024175651.1|26488_27130_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	100.0	5.2e-117
WP_001697579.1|27318_27879_-	Ref family protein	NA	Q71TG3	Escherichia_phage	96.8	5.5e-99
WP_001697578.1|28125_28437_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	100.0	1.6e-47
WP_033561681.1|28487_29519_-|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	98.5	3.5e-192
WP_000542332.1|29526_29748_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_000874156.1|30352_30562_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|30672_31524_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_001260610.1|31556_32669_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.3	1.5e-175
WP_000124155.1|33246_34731_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_064638618.1|34730_35924_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.2	4.0e-179
WP_001326849.1|36009_36462_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_023356283.1|36550_37594_-	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
WP_000113019.1|37621_37801_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_001216033.1|37805_38186_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.3e-62
WP_001697569.1|38185_38407_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	1.9e-31
WP_001697568.1|38551_39016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064638621.1|39100_39760_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	97.6	2.2e-115
WP_000988656.1|39741_40116_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	98.4	4.4e-68
WP_000269004.1|40122_40416_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_064638623.1|40594_40828_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	9.5e-37
WP_064638625.1|40910_41753_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	64.1	1.8e-93
WP_000951712.1|41749_41959_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_064638628.1|41960_42686_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	72.6	7.0e-86
WP_064580158.1|42682_42922_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.4	1.8e-35
WP_000158003.1|42914_43118_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_064638630.1|43201_43780_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	84.8	1.3e-90
WP_064638633.1|43974_44481_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.6e-92
WP_000107691.1|44554_45817_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	6.0e-234
WP_009453059.1|46118_46820_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	99.6	2.7e-143
WP_001354545.1|46816_47494_-	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484112.1|47490_48117_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	2.3e-122
WP_000095380.1|48618_48774_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_033561736.1|48840_49419_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	99.0	4.4e-107
WP_033561735.1|49421_49667_-	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	9.6e-40
WP_000235786.1|49813_50191_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_023156135.1|50200_51418_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.0	5.1e-222
WP_000896801.1|51421_52150_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602717.1|52136_52922_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212018.1|52923_53940_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000535208.1|53932_54565_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_047615429.1|54611_55610_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.2	5.3e-193
WP_001276599.1|55609_56974_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_032162331.1|57446_57611_-	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	5.3e-18
WP_000467133.1|57610_58045_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_047653009.1|59802_63090_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	99.1	0.0e+00
WP_032332856.1|63086_63992_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	5.9e-159
WP_001177860.1|63984_64269_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_047609418.1|64730_65519_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.0	2.9e-85
WP_047609419.1|65558_65975_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	1.0e-57
WP_000336812.1|66000_66141_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281112.1|66152_66545_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	100.0	4.0e-72
66519:66535	attR	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_001113742.1|66879_67764_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154679.1|68056_68866_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	100.0	1.2e-158
WP_064638635.1|69034_70231_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	99.7	3.1e-224
WP_000038866.1|70247_71249_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_032332879.1|71474_73181_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_032332878.1|73241_74831_+	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.2	4.8e-305
WP_032332877.1|74840_75656_+	hypothetical protein	NA	A0A077SK43	Escherichia_phage	96.7	1.0e-109
WP_000035301.1|75691_76273_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|76284_76794_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001697749.1|77340_77805_-	hypothetical protein	NA	Q71TB7	Escherichia_phage	98.7	4.3e-89
WP_001697750.1|77804_78509_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.1	8.7e-134
WP_042631101.1|78677_79523_-	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.9	3.6e-150
WP_001187871.1|79552_80353_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_064638637.1|80517_81552_-	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	96.2	1.5e-182
WP_071952729.1|81526_81769_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	7.5e-37
WP_000039791.1|82390_82903_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_033561728.1|82906_83446_+	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	99.4	6.8e-46
WP_033561727.1|83526_84093_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	5.6e-99
WP_000523978.1|84104_84716_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_064638640.1|84730_85612_+	hypothetical protein	NA	A0A077SLL9	Escherichia_phage	100.0	9.8e-175
WP_064638643.1|85693_89116_+	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	98.6	0.0e+00
WP_000002800.1|89115_89472_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047919.1|89468_90902_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.6	5.3e-271
WP_001189835.1|90901_91738_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.3e-152
WP_001286326.1|91816_92251_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_071952731.1|92262_95181_+|tail	tail fiber protein	tail	A0A077SK37	Escherichia_phage	90.2	0.0e+00
WP_042631143.1|95183_95717_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.0	4.3e-93
WP_001164123.1|95745_96273_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	1.4e-91
WP_024183650.1|96276_98106_-	hypothetical protein	NA	Q858V4	Yersinia_virus	47.6	7.6e-12
