The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015774	Lelliottia amnigena strain ZB04, complete genome	4616122	2108615	2117130	4616122		Escherichia_phage(66.67%)	10	NA	NA
WP_064325959.1|2108615_2109230_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	4.3e-28
WP_064325960.1|2109272_2110127_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	36.3	3.3e-26
WP_064325961.1|2110128_2110746_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	2.1e-75
WP_064325962.1|2110756_2113195_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	4.4e-217
WP_064325963.1|2113332_2113617_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_064325964.1|2113720_2114431_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_064325965.1|2114452_2115013_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_064325966.1|2115037_2115376_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_064325967.1|2115477_2115804_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	5.4e-22
WP_064325968.1|2115915_2117130_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.2	3.9e-49
>prophage 2
NZ_CP015774	Lelliottia amnigena strain ZB04, complete genome	4616122	2646957	2733856	4616122	tRNA,lysis,integrase,protease,terminase,tail	Enterobacteria_phage(25.0%)	97	2682371:2682400	2731639:2731668
WP_064326409.1|2646957_2647653_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	28.9	3.1e-06
WP_064326410.1|2647718_2649629_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	2.9e-91
WP_064326411.1|2649759_2650104_+	RidA family protein	NA	NA	NA	NA	NA
WP_064326412.1|2650110_2650299_-	YoaH family protein	NA	NA	NA	NA	NA
WP_087892610.1|2650351_2651725_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	44.7	6.0e-46
WP_064326414.1|2651728_2652307_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_064326415.1|2652491_2653856_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_064326416.1|2653995_2655588_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_064326417.1|2655600_2657157_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	3.9e-41
WP_064326418.1|2657620_2658592_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_064326419.1|2658639_2659440_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_064326420.1|2659452_2660304_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_064326421.1|2660359_2660818_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_064328146.1|2661219_2661786_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_064326422.1|2661738_2662602_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_064326423.1|2662669_2664388_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2664608_2664818_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_064326424.1|2664804_2664975_-	YobF family protein	NA	NA	NA	NA	NA
WP_064326425.1|2665496_2666486_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_064326426.1|2666509_2666800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064326427.1|2666874_2667018_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_064326428.1|2667177_2667417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064326429.1|2667473_2668265_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_064326430.1|2668441_2669815_+	MFS transporter	NA	NA	NA	NA	NA
WP_064326431.1|2669858_2670740_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_064326432.1|2670933_2672982_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.1	7.0e-83
WP_064326433.1|2673001_2673688_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_064326434.1|2673784_2674282_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_064326435.1|2674414_2675698_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_064326436.1|2675666_2678300_+	PqiB family protein	NA	NA	NA	NA	NA
WP_064326437.1|2678355_2679819_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_064326438.1|2679921_2680161_+	YebV family protein	NA	NA	NA	NA	NA
WP_064328147.1|2680265_2680457_+	YebW family protein	NA	NA	NA	NA	NA
WP_064326439.1|2680457_2681102_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.4e-59
WP_064326440.1|2681271_2682213_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2682371:2682400	attL	AGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_157685358.1|2682870_2683746_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_064326442.1|2683870_2684461_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064326443.1|2684554_2684875_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	9.1e-22
WP_064326445.1|2685201_2685777_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.7	2.7e-77
WP_082904971.1|2686197_2686608_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	73.3	3.7e-44
WP_064326447.1|2688001_2688235_-	hypothetical protein	NA	K7PLZ0	Enterobacterial_phage	84.4	8.3e-33
WP_064326448.1|2688346_2689021_-	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	85.7	1.3e-107
WP_064326449.1|2689020_2689323_-	hypothetical protein	NA	K7PHM8	Enterobacterial_phage	87.9	4.2e-45
WP_064326450.1|2689322_2692775_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	83.2	0.0e+00
WP_064326451.1|2692828_2693440_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	63.0	1.3e-56
WP_064326452.1|2693557_2693746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064326453.1|2693763_2694474_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	87.7	4.2e-128
WP_064326454.1|2694476_2695232_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	78.8	3.6e-117
WP_064326455.1|2695228_2695576_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	64.3	5.7e-38
WP_064326456.1|2695630_2695984_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	97.4	2.7e-59
WP_064326457.1|2696060_2698973_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	36.6	1.0e-143
WP_032645632.1|2698969_2699284_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_064326458.1|2699280_2699592_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.9	5.3e-35
WP_064326459.1|2699631_2700567_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.0	1.6e-66
WP_064326460.1|2700636_2701047_-	DUF4128 domain-containing protein	NA	I6PDJ8	Cronobacter_phage	51.4	1.1e-32
WP_064326461.1|2701043_2701628_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.7	9.4e-49
WP_064326462.1|2701629_2701980_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	2.8e-32
WP_064326463.1|2701981_2702464_-	hypothetical protein	NA	A0A2I7RGM5	Vibrio_phage	29.9	5.6e-07
WP_064326464.1|2702500_2702728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064326465.1|2702781_2703735_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.4	4.2e-131
WP_064326466.1|2703745_2704519_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	3.7e-69
WP_064326467.1|2704599_2705697_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	56.4	6.3e-115
WP_064326468.1|2705698_2707087_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.1	7.0e-127
WP_064326469.1|2708372_2709362_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.5	3.1e-36
WP_064326470.1|2709403_2709967_+	hypothetical protein	NA	A0A088FAX8	Idiomarinaceae_phage	56.0	3.1e-09
WP_064326471.1|2710033_2710318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064326472.1|2710712_2710934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064326473.1|2711035_2711560_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	97.1	2.2e-89
WP_064326474.1|2711911_2712376_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	61.0	5.7e-41
WP_064326475.1|2712372_2712867_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	87.8	2.7e-81
WP_064326476.1|2712844_2713069_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	1.2e-31
WP_064326477.1|2713785_2714601_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	87.1	5.4e-127
WP_087892613.1|2714597_2714738_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064328149.1|2714734_2715097_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	79.8	3.4e-49
WP_071892390.1|2715099_2715306_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	1.5e-25
WP_064326478.1|2715305_2715908_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	84.0	2.8e-96
WP_064326479.1|2716296_2716521_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	64.9	1.3e-22
WP_064326480.1|2717043_2717928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064328150.1|2718098_2719193_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	37.0	3.4e-52
WP_064326481.1|2719405_2720092_-	phage replication protein	NA	G8C7U6	Escherichia_phage	62.1	8.3e-81
WP_082904972.1|2720088_2720946_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	71.1	6.3e-102
WP_064326482.1|2721089_2721641_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.9	1.3e-31
WP_064326483.1|2721643_2721871_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.2	6.0e-20
WP_082904973.1|2721943_2722357_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.0	1.1e-46
WP_064326484.1|2722448_2723471_+	hypothetical protein	NA	U5P4L0	Shigella_phage	51.7	2.6e-94
WP_064326485.1|2723494_2724001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064326486.1|2724575_2724761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892393.1|2724748_2725030_-	hypothetical protein	NA	A9YWZ2	Burkholderia_phage	40.9	5.4e-10
WP_064326488.1|2725528_2728837_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	61.0	0.0e+00
WP_064326489.1|2728851_2729892_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	73.7	1.3e-149
WP_064326490.1|2729931_2730174_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	87.3	1.6e-31
WP_064326491.1|2730238_2730511_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	62.2	8.0e-27
WP_064326492.1|2730479_2731565_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	67.9	3.4e-145
WP_064326493.1|2731886_2732225_-	YebY family protein	NA	NA	NA	NA	NA
2731639:2731668	attR	AGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_064326494.1|2732239_2733112_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_064326495.1|2733113_2733488_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_064326496.1|2733625_2733856_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	3.1e-16
