The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	199885	273135	5645226	protease,plate,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001295561.1|199885_201238_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201267_203700_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203820_204306_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204309_205335_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205439_205895_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205898_206687_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206686_207835_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207831_208428_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208464_211947_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211959_212919_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213017_215159_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215215_215605_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|215669_216965_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217017_217278_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217264_217465_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217630_218176_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218172_218583_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218596_219307_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219506_220331_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220383_222102_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222212_222920_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222916_223321_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223438_224254_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224293_224947_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224939_225971_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226158_226734_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232493_233297_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233293_234208_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234448_235249_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235326_236097_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236144_237503_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237574_238330_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238363_239086_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239082_239550_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239614_240346_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001302684.1|242160_242610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242612_243209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243287_243509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243529_244009_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243974_245384_-	membrane protein	NA	NA	NA	NA	NA
WP_001310198.1|245394_248829_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248965_250378_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250382_251126_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614378.1|251122_253912_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000343292.1|253920_254682_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246433.1|254686_256018_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256020_256545_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256541_257822_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257846_258929_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258892_260743_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260746_261160_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261250_262642_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262692_262917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262951_263452_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264148_264667_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264876_267018_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|267093_271317_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|271518_271782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|271696_271882_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|271962_273135_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	291921	371147	5645226	portal,plate,lysis,protease,tail,head,integrase,holin,transposase,capsid,terminase	Shigella_phage(45.0%)	95	294460:294476	377975:377991
WP_000749881.1|291921_292977_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|293264_294368_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|294379_295633_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
294460:294476	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|295837_297001_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|296877_297312_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|297227_297533_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|297532_297895_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|297885_298422_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|299098_299395_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|299672_300365_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|300462_300723_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|300715_301267_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|301442_301622_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|301611_302553_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|302549_303044_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|303043_303697_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|303693_304020_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|304016_304406_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|304425_305235_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|305242_306232_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|306245_306998_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|307211_307751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|307894_308128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|308406_308700_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|308836_309172_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|309175_309652_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|309868_310051_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|310141_310435_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135207.1|310960_311311_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000929189.1|311436_311931_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_128484532.1|312164_313661_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|313808_315035_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|315027_315630_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|315640_316870_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|316948_317272_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|317268_317679_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|317653_318160_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|318156_318717_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|318725_318896_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|318879_320376_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|320375_320732_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|320731_321001_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|321142_322978_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|323038_324367_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_001259066.1|325426_325975_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|325974_326400_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|326386_327445_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|327435_328020_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554706.1|328023_328794_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000368084.1|328793_329396_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|329367_329811_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|329831_330242_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|330272_330827_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|330887_331661_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|332485_333229_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|334191_335373_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|335376_335793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|335765_336383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|336382_336841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|336833_337466_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|337496_338087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|338086_338653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|339062_339335_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|339340_339892_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|339888_340641_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|341574_341835_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|341831_342389_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|342385_342607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|342606_342930_+	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_000016225.1|342943_345277_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|345409_346366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|347041_347941_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|348039_348762_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|348928_349207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|349909_350812_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|351057_352116_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|352257_353385_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|353563_354520_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|354529_356728_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|356724_357681_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070685.1|357677_358367_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|358784_359399_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|359646_359976_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|360288_360999_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001265657.1|360967_362611_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|362600_365126_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|365151_365820_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|365877_366465_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|366539_367082_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|367906_368098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|368167_368308_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|368307_368571_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|368834_369215_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|369211_369559_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|369608_371147_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
377975:377991	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	914312	952407	5645226	portal,lysis,protease,tail,holin,integrase	Enterobacteria_phage(52.5%)	47	903754:903768	936043:936057
903754:903768	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|914312_915194_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|915356_915575_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|915614_915782_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|916024_916627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|916837_917059_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|917157_917439_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|917449_917641_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|917613_917796_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|917792_918473_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|919170_919353_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|919349_919520_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|919512_920133_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|920129_920795_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|921006_921966_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|922303_922426_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|922440_923130_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|923313_924057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|924142_924301_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|924381_924780_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|924922_925138_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|925137_925635_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|925631_926099_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|926086_926239_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|929502_929715_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|929642_930767_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|930888_931224_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|931168_933196_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|933282_933606_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|933598_933874_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|933885_934464_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|934460_934862_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|934872_935616_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|935676_936063_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
936043:936057	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|936071_936401_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|936372_939438_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|939437_939767_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|939776_940475_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|940480_941224_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|941160_941769_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|945313_945913_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|945972_947289_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|947290_947560_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|947736_948717_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|948750_949770_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|950266_950428_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|950596_951478_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|951708_952407_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	1074526	1090911	5645226	terminase,integrase,capsid,protease	uncultured_Caudovirales_phage(18.18%)	18	1060235:1060250	1100510:1100525
1060235:1060250	attL	CGATGCTGCGCAGTGT	NA	NA	NA	NA
WP_000188174.1|1074526_1076473_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1076545_1076770_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085207.1|1077174_1078398_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1078394_1079168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1079259_1079484_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_072147362.1|1079493_1080192_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920689.1|1080184_1080370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|1080369_1080561_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770151.1|1080798_1081098_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761782.1|1081094_1082849_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
WP_000557482.1|1083135_1083387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|1083517_1083712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1083715_1083877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1084008_1084497_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1084659_1085583_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000520781.1|1086561_1086882_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1086912_1089189_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1089708_1090911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
1100510:1100525	attR	CGATGCTGCGCAGTGT	NA	NA	NA	NA
>prophage 5
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	1251361	1320926	5645226	portal,protease,tail,head,transposase,holin,integrase	Escherichia_phage(26.67%)	79	1259849:1259864	1281215:1281230
WP_000156526.1|1251361_1253122_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1253307_1253760_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1253835_1254876_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1255232_1255742_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1255960_1256590_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1256552_1258715_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1258724_1259171_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1259293_1261348_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1259849:1259864	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1261379_1261838_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1261933_1262596_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1262768_1263182_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1263226_1263544_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1263601_1264792_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1264886_1265165_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1265161_1265491_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1265581_1266241_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1266648_1267668_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1267645_1267888_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1267955_1270427_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1270520_1270712_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1270708_1270897_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1271470_1271656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1271842_1272232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1272373_1272529_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1272806_1273094_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1273093_1273285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1273312_1273714_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1273822_1274095_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1274078_1274504_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1274710_1275166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1275244_1276336_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1276342_1277089_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1277110_1277881_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1277896_1278310_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1278661_1279435_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1279800_1279938_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1279982_1280195_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1280362_1280641_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1280642_1281692_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1281215:1281230	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1281704_1282076_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1282065_1282437_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1282588_1283407_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1283693_1283933_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1284027_1284741_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1285507_1287358_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1287533_1288746_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1288951_1289266_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1289793_1289979_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1290200_1290314_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1290534_1291068_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1291227_1291500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1291755_1291962_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1292712_1292988_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1293063_1293444_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1293440_1293788_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1293837_1295376_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1295425_1295668_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1297552_1297759_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1297755_1299348_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1299337_1300843_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1300879_1301227_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1301284_1301551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1301532_1302273_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1302286_1302718_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1302744_1303158_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1303138_1305718_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1305714_1306044_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1306043_1306742_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1306752_1307496_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1307441_1308074_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1308264_1308792_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1308925_1312399_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1312466_1313066_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1313130_1314444_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1314445_1314715_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1316707_1317826_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1317822_1319616_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1319634_1320342_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1320338_1320926_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	1571915	1692461	5645226	tRNA,portal,lysis,tail,protease,head,integrase,holin,transposase,capsid,terminase	Enterobacteria_phage(38.18%)	155	1637822:1637837	1666076:1666091
WP_000952736.1|1571915_1572737_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1572892_1573939_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1573935_1574730_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1574896_1576015_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1575983_1576253_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1576314_1576704_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1576836_1577352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1577466_1577619_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1577934_1578411_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1578535_1578859_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|1578842_1579268_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1579336_1580374_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|1580405_1580828_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|1580861_1581578_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1581574_1581892_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1581888_1582191_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1582180_1582498_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1582451_1582769_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1582755_1583193_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1583194_1583386_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1583388_1583976_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1584091_1584196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1584384_1584597_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1584764_1585043_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1585044_1586094_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|1586106_1586481_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1586477_1587299_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1587895_1588063_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023147.1|1588377_1590315_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_001213059.1|1590462_1590645_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1590682_1590952_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1591027_1591243_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1591247_1591592_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1591642_1592176_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1592446_1593016_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1593015_1593162_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1593389_1593596_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1593660_1593885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1594241_1594382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1594511_1594697_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|1594738_1595104_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1595395_1595959_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1595955_1597617_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1597680_1599618_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1599662_1599884_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1599829_1602331_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1602410_1602737_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1602746_1603097_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1603093_1603540_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1603536_1603881_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1603939_1604656_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1604661_1605036_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1605131_1605341_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261921.1|1605393_1608636_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.1	0.0e+00
WP_000807954.1|1608628_1608970_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1608969_1609668_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1609684_1609939_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1610048_1610159_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1610461_1611340_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1611393_1612131_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1612076_1612313_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1612325_1612415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1612434_1614783_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1615373_1618775_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1620878_1621004_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1621083_1621359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1621419_1622781_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1623144_1624008_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1623991_1625128_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1625377_1626604_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1626652_1627774_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|1628135_1629349_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|1629347_1630565_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|1630929_1631118_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1631167_1631494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1631618_1631792_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1631922_1632120_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1632112_1632325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1632314_1632779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1632771_1633005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1633010_1633310_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|1633306_1634707_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|1634907_1635159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1635155_1635566_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1635576_1635849_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1635975_1636200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1636451_1636658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1636657_1637713_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1637725_1638061_+|head	head decoration protein	head	NA	NA	NA	NA
1637822:1637837	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1638073_1638487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1638692_1639235_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1639490_1639772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1640372_1641833_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1641832_1642504_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1642672_1644043_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1644046_1644688_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1644723_1645830_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1645883_1646345_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1646354_1647008_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1647179_1648430_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1648543_1649686_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|1649675_1649912_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1650015_1650840_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1650836_1651538_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1651534_1651837_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1651904_1652237_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1652301_1652424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1652481_1654008_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1654509_1654965_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1654964_1655135_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1655127_1655418_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1655414_1655777_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1655773_1655914_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1655910_1656600_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1656921_1657227_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1657213_1657690_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1657906_1658089_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1658179_1658473_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1658764_1659175_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1659460_1659667_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1659831_1660026_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1660414_1660960_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1660934_1662860_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1662856_1663063_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1663059_1664661_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1664641_1665961_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1665970_1666303_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1666076:1666091	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|1666357_1667383_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|1667424_1667823_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1667834_1668188_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1668199_1668778_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1668774_1669170_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1669177_1669918_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1669933_1670356_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1670337_1670772_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1670764_1673314_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1673310_1673640_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1673639_1674338_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1674343_1675087_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1675023_1675656_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1675716_1679115_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1679181_1679781_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1679845_1682761_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1682760_1683342_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1683461_1684352_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1684370_1684877_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1684913_1685414_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1685492_1685675_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1686172_1686841_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1686897_1687146_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1687221_1687602_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1687598_1687946_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1687995_1689534_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1689836_1691321_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1691507_1692461_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	1777035	1900350	5645226	tail,protease,head,integrase,holin,transposase,capsid,terminase	Stx2-converting_phage(39.18%)	132	1776872:1776899	1884822:1884849
1776872:1776899	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1777035_1778166_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1778143_1778392_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|1778456_1780928_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|1781020_1781212_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1781208_1781397_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1781794_1781962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1781955_1782189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1782166_1782574_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1782596_1782815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1782887_1783187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1783450_1783858_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1783934_1784162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1784145_1784697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1784668_1785709_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|1785740_1786163_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|1786349_1786931_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1786927_1787092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1787790_1788549_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1788827_1789040_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1789260_1789518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1789587_1789866_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1789867_1790914_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1790926_1791286_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1791294_1791825_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1792066_1792264_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1792414_1793473_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1794269_1796123_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1796272_1796488_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1796492_1796837_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1796887_1797421_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1797691_1798261_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1798260_1798407_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1798634_1798820_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1799244_1799472_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1799513_1799879_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1800168_1800732_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1800728_1802390_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|1802453_1804391_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1804435_1804657_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1807183_1807510_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1807519_1807870_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1807866_1808313_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1808309_1808654_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1808711_1809428_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1809433_1809808_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1809903_1810113_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1810165_1813408_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1813400_1813742_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|1813741_1814440_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|1814450_1815194_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|1815139_1815772_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1816114_1817290_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1817241_1819587_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1819654_1820254_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|1820405_1821719_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|1821720_1821990_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1823016_1824342_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|1827006_1828545_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1828594_1828942_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1828938_1829319_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1829658_1829937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1830364_1830511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1830647_1831295_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1831478_1832069_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1834819_1835038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001500821.1|1835525_1836656_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|1836633_1836882_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|1836946_1839391_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|1839483_1839672_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1839668_1839857_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|1840344_1840497_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|1840666_1841056_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|1841158_1841434_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|1841417_1841843_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|1841865_1842819_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|1842825_1843566_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|1843595_1844366_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|1844381_1844777_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1844833_1845190_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1845238_1845451_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1845486_1845858_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|1845854_1846217_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|1846332_1846437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1846625_1846838_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001304183.1|1847367_1847646_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|1848709_1849084_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|1849080_1849902_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|1850128_1850326_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|1850476_1851535_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|1852025_1853876_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1854323_1854530_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|1854529_1855027_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|1855243_1855429_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|1855955_1856270_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1856351_1856576_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|1856617_1856983_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|1857271_1857835_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1857831_1859493_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1859556_1861494_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1861538_1861760_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1864286_1864613_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1864622_1864973_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1864969_1865416_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1865412_1865757_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1865815_1866532_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1866537_1866912_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1867007_1867217_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1867269_1870512_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1870504_1870846_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261967.1|1870845_1871544_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	7.3e-133
WP_001303043.1|1871554_1872298_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|1872243_1872876_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_064261927.1|1873122_1876599_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|1876666_1877266_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261932.1|1877330_1878644_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001023426.1|1878645_1878915_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_001079499.1|1884999_1885506_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1884822:1884849	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1885551_1886052_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1886137_1886317_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1886697_1887504_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1887503_1888697_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001416116.1|1888708_1890067_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000763503.1|1890070_1891666_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|1891665_1893228_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1893319_1893364_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1893501_1894383_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1894379_1895000_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1895027_1896611_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1896823_1897696_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1897735_1898326_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1898322_1899081_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1899300_1900350_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2170622	2245828	5645226	portal,tail,head,holin,transposase,capsid,terminase	Enterobacteria_phage(32.56%)	95	NA	NA
WP_000214712.1|2170622_2170826_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2170861_2172322_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2172410_2173694_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2173753_2174068_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2174229_2174871_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2174952_2175582_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2175654_2176230_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2176343_2176613_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_064261928.1|2176614_2177928_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.8	3.7e-85
WP_001230509.1|2177992_2178592_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261927.1|2178659_2182136_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_129137391.1|2182382_2183015_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2182960_2183704_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2183714_2184413_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2184412_2184742_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2187331_2187745_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2187771_2188194_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2188207_2188960_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2188967_2189363_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2189359_2189893_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2189907_2190261_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2190272_2190671_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2190712_2191738_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2191793_2192126_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2192135_2193455_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2193435_2195037_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2195033_2195240_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2195236_2197162_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2197136_2197682_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2198068_2198293_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2198374_2198689_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2199214_2199400_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2199622_2199769_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2199768_2200338_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2200608_2201142_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2201192_2201537_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2201541_2201748_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_001302123.1|2204525_2204957_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2205407_2206121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2206256_2206454_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2206678_2207233_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2207295_2207601_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2207613_2208663_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2208664_2208937_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2209058_2209403_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2209522_2209735_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2209968_2210526_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2210527_2210746_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2210873_2211185_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2211177_2211405_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2211401_2211683_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2211715_2212432_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2212465_2212888_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|2212919_2213963_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2214031_2214457_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2214440_2214683_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2215074_2215413_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2215705_2215858_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2215869_2216508_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2216508_2216718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2217282_2217471_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2217467_2217656_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2217748_2218993_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2219631_2219946_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|2220857_2221154_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_000267292.1|2221233_2223735_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2223680_2223902_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2223946_2225884_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2225947_2227609_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2227605_2228169_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2228458_2228824_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2228865_2229093_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2229517_2229703_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2229930_2230077_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2230076_2230646_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2230916_2231450_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000998048.1|2231613_2233152_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2233201_2233549_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2233545_2233926_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731257.1|2234001_2234295_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_000411805.1|2234299_2234506_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2234954_2236805_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2237283_2237712_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2238348_2239038_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2239034_2239394_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2239406_2240456_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2240457_2240736_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2240903_2241116_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2241304_2241409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2241524_2242109_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2242165_2242561_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2243371_2244112_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2244118_2245081_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2245103_2245529_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2245525_2245828_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2389925	2434833	5645226	tRNA,portal,plate,tail,head,integrase,holin,capsid,terminase	Enterobacteria_phage(76.09%)	60	2392328:2392352	2427475:2427499
WP_000029463.1|2389925_2390675_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|2390674_2391226_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|2391288_2392269_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2392328:2392352	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|2392461_2392899_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403439.1|2392999_2393500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247210.1|2393502_2394441_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|2394529_2394838_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2394934_2395213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2395227_2395566_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158974.1|2395576_2395864_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000514277.1|2395875_2396118_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021666.1|2396114_2396228_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_029238958.1|2396417_2396738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2396761_2396965_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2396961_2397228_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104308.1|2397224_2397524_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_000013477.1|2397846_2398077_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	82.9	4.8e-25
WP_000564228.1|2398149_2398539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001609.1|2398535_2401376_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000708312.1|2401452_2402412_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_000211267.1|2402416_2402728_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001594304.1|2403092_2403362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|2403848_2404895_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|2404894_2406646_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|2406800_2407637_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|2407659_2408712_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|2408757_2409558_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|2409659_2410154_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|2410153_2410354_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2410356_2410680_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2410676_2411069_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|2411065_2411473_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920579.1|2411610_2412078_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000356344.1|2412070_2412706_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271948.1|2412702_2413284_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.9	2.3e-100
WP_000213447.1|2413280_2413631_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111970.1|2413634_2414531_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_000071724.1|2414523_2415132_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217007.1|2415128_2416763_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.0	3.7e-143
WP_000368062.1|2416762_2417365_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.2e-96
WP_077883652.1|2417336_2417627_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.9	7.1e-50
WP_000905082.1|2418232_2418832_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000979945.1|2418858_2419347_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853421.1|2419359_2422167_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000763327.1|2422153_2422282_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2422317_2422683_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|2422737_2423250_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000005394.1|2423249_2424434_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000132850.1|2424591_2425701_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000069998.1|2425853_2426459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302981.1|2426619_2426880_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2427070_2427211_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2427516_2427816_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2427475:2427499	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672328.1|2427820_2430208_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2430222_2431206_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2431488_2431533_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2431655_2432012_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2432064_2432262_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2432358_2432901_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|2432904_2434833_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 10
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2593229	2645664	5645226	tRNA,transposase,integrase,tail	Enterobacteria_phage(61.29%)	60	2586453:2586468	2645743:2645758
2586453:2586468	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2593229_2594963_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2595139_2595628_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2595747_2596140_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2596139_2598218_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2598210_2599359_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2599560_2600205_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2600215_2600605_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2600619_2601669_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2601671_2602532_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2602550_2604152_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2604197_2605859_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2606001_2606505_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2606525_2608490_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2608494_2609421_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2609417_2610305_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2610431_2611010_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2611012_2611363_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2612142_2612571_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2612577_2614002_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2613976_2614777_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2614943_2615930_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2615944_2617459_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2617528_2618518_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|2619314_2619818_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2619897_2620149_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2620263_2620350_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2620611_2620935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2621105_2621603_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2621639_2621879_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2622070_2623282_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2623343_2624009_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|2624365_2625367_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|2625372_2625720_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2625749_2626400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2626415_2626820_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2626909_2627047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2627118_2627322_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2627343_2627694_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2627704_2627983_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2627994_2628237_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2628233_2628347_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2628439_2628856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2628879_2629083_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2629079_2629346_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2629342_2629642_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|2629964_2630195_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|2630267_2630633_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2630639_2633462_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2633538_2634498_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2634502_2634817_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2636022_2636439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2636482_2637055_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2637211_2637700_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2640502_2640631_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2640666_2641032_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2641086_2641599_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_072141434.1|2641598_2641778_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	88.1	9.8e-26
WP_085948178.1|2641834_2643047_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000132765.1|2644253_2644577_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2644527_2645664_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2645743:2645758	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2703248	2770333	5645226	portal,tail,head,integrase,holin,transposase,terminase	Enterobacteria_phage(32.56%)	66	2718912:2718927	2774678:2774693
WP_001023396.1|2703248_2703518_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|2703519_2704689_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230509.1|2704753_2705353_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261933.1|2705420_2708900_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_129137391.1|2709146_2709779_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2709724_2710468_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303038.1|2710478_2711177_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000847298.1|2711176_2711506_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|2711502_2714082_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2714062_2714476_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2714502_2714934_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2714947_2715688_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2715669_2715936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2715993_2716341_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2716377_2717883_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2717872_2719465_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2718912:2718927	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2719461_2719668_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2721552_2722062_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2722456_2722681_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2722762_2723077_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2723603_2723789_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303555.1|2724160_2724343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2724498_2725032_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2725082_2725427_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2725431_2725638_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2725957_2727170_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2727252_2729103_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2730642_2731332_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2731328_2731688_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2731700_2732750_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2732751_2733030_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2733197_2733410_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2733596_2733701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2733810_2734374_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2734500_2734812_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2734808_2734961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2734993_2735350_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2735346_2735571_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2735592_2736291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|2736325_2736748_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|2736779_2737817_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2737885_2738311_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2738307_2738535_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2738632_2739277_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2739551_2739704_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2740184_2740373_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2740369_2740558_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2740653_2743125_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2743183_2743387_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2743386_2744409_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2744644_2745442_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2745931_2753914_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2754175_2755228_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2755541_2756858_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2756959_2758414_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2758756_2759473_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2760098_2761742_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2761859_2762810_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2762911_2763829_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2764285_2765221_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2765282_2766362_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2766373_2767117_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2767113_2767659_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2768020_2768401_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2768397_2768745_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2768794_2770333_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2774678:2774693	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2784998	2847099	5645226	lysis,tail,protease,head,integrase,holin,transposase,capsid,terminase	Stx2-converting_phage(65.0%)	80	2830805:2830864	2847094:2848403
WP_001303036.1|2784998_2786165_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2787488_2788139_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2788363_2789239_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|2789379_2789649_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|2789650_2790964_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_064261938.1|2791028_2791628_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	5.2e-111
WP_000515107.1|2791694_2795174_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_050546863.1|2795433_2796066_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2796011_2796749_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2796802_2797726_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2797796_2797970_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2798077_2798398_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001303038.1|2798414_2799113_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2799112_2799454_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|2799446_2802689_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|2802740_2802950_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2803045_2803420_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2803425_2804142_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2804200_2804545_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2804541_2804988_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2804984_2805335_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2805344_2805671_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|2808197_2808419_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173023.1|2808463_2810401_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	100.0	0.0e+00
WP_001301491.1|2810464_2812126_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2812122_2812686_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|2812976_2813342_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2813383_2813611_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2814073_2814331_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2814327_2814825_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2815027_2815465_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2815461_2815959_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2815958_2816174_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2816250_2816523_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2816563_2816743_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143113.1|2816879_2818817_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_001303568.1|2819060_2819384_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2819680_2819950_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2819961_2820921_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2821570_2822059_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2822049_2822721_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2822717_2823323_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2823322_2824045_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|2824119_2824884_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|2825158_2825341_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2825337_2825865_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2825861_2826308_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2826264_2826501_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2826511_2826727_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001303053.1|2826859_2827081_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_001220560.1|2827655_2828267_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000998048.1|2828355_2829894_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2829943_2830291_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2830287_2830668_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
2830805:2830864	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2830858_2832071_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064261939.1|2832111_2833485_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	2.1e-253
WP_000539354.1|2833481_2834303_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|2834483_2834780_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2834921_2835137_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2835211_2835907_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2836408_2836930_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2837498_2837681_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2837658_2837931_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394301.1|2837989_2838250_+	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000065362.1|2838432_2838801_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2838873_2839038_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2839006_2839150_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2839224_2839521_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2839526_2840312_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|2840308_2840989_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|2840985_2841168_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2841140_2841332_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|2841342_2841624_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2841722_2841944_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2841940_2842888_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2843754_2844105_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2844292_2844637_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2844714_2844906_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_074469436.1|2844886_2845783_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	3.8e-174
WP_085948178.1|2845885_2847099_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2847094:2848403	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCACTTTCGCAAGTCAGCAGTGATCTGTCTGGCATCCTTCAAAGACAGGGATGGGTATCGACCAAGCCCAAGTCGATTAGGCTTGCCATGCCAGCGATAGCGGTACTGGAACTGGATGACCCCCTTCGGTGAAATTCGTACGCTGAGGCCATCGGCATCAGCCACTTCTTGTGGGCCAGAATATGGTTTACCATAAATAGTACGCAGTTTTGTGTCGCTTATAGCCATAAATAATATTTGGTACGCTCAGAAATAATGGTTTGGTACACATCTGGTACACAATATCACATGGACAACAGCGCACAGTAAACAACTATATTTGACGTTCGTAGACATACTCAGGTGAAAAAAGGGTTGTTTTTCGAGTTATAACAGACAGTTAATTAACTACATTGGACAATGCTAGACAATGACAGACACAGATAAGCAACCTACCTTCCTCTTTCACGATTACGAAACCTTTGGCACGCACCCCGCGTTAGATCGCCCTGCACAGTTCGCAGCCATTCGCACCGATGACGAATTCAATGTCATCGGCGAACCCGAAGTCTTTTACTGCAAGCCCGCGGATGACTATTTACCCCAGCCTGGAGCAGTATTAATTACCGGTATTACCCCGCAGGAAGCTCGGGCGAAAGGAGAAAACGAAGCCGCATTTGCCGCCCGTATTCACTCGCTTTTTACCGTACCGAAGACCTGTATTCTGGGCTACAACAATGTGCGTTTCGACGACGAAGTCACACGCAACGTTTTTTATCGTAATTTCTACGATCCTTACGCCTGGAGCTGGCAGCATGATAACTCGCGCTGGGATTTACTGGATGTTATGCGTGCCTGCTATGCCCTGCGCCCGGAAGGAATAAACTGGCCTGAAAATGATGACGGTCTACCGAGCTTTCGCCTTGAGCATTTAACCAAAGCGAATGGTATTGAACATAGCAACGCCCACGATGCGATGGCTGATGTGTACGCCACTATTGCGATGGCGAAACTGGTAAAAACGCGTCAACCACGCCTGTTTGATTATCTCTTTACCCATCGTAATAAACACAAACTGATGGCGTTGATTGATGTTCCGCAGATGAAACCCCTGGTTCACGTTTCCGGAATGTTTGGGGCATGGCGCGGCAATACCAGCTGGGTGGCACCGCTGGCGTGGCATCCTGAAAATCGCAATGCCGTAATTATGGTGGATTTGGCAGGAGATATTTCGCCATTACTGGAACTGGATAGCGACACATTGCGCGAGCGTT	NA	NA	NA	NA
>prophage 13
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2930602	2967852	5645226	tRNA,portal,plate,lysis,tail,head,integrase,holin,capsid,terminase	Escherichia_phage(40.43%)	49	2934902:2934929	2966045:2966072
WP_000675144.1|2930602_2932006_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2932002_2932725_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2932915_2933248_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2933395_2934757_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2934902:2934929	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2935031_2935250_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882987.1|2935331_2936495_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000978915.1|2936494_2936974_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000069920.1|2936988_2939436_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000785970.1|2939428_2939548_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2939580_2939856_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2939912_2940431_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286714.1|2940443_2941634_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_000905091.1|2941693_2942287_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001145598.1|2942317_2942806_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	3.7e-83
WP_000368070.1|2942805_2943408_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_000216996.1|2943842_2945264_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	1.5e-196
WP_001285344.1|2945260_2945872_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121492.1|2945864_2946773_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_000127172.1|2946777_2947125_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001093756.1|2947121_2947757_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_001001774.1|2947823_2948276_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917172.1|2948268_2948736_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|2948698_2948872_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040660.1|2948843_2949269_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_000736588.1|2949256_2949682_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_001144113.1|2949696_2950194_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000123125.1|2950193_2950475_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_000846399.1|2950478_2950682_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2950681_2951191_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2951290_2952034_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248573.1|2952037_2953111_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_001085969.1|2953165_2954020_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_000156861.1|2954193_2955966_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038195.1|2955965_2957000_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_001177885.1|2957212_2957482_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000042038.1|2957705_2958143_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|2958267_2959218_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|2959195_2959504_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000268557.1|2960104_2962393_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027665.1|2962382_2962658_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_001113260.1|2962654_2962879_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_001277943.1|2962878_2963181_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_000557701.1|2963180_2963405_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217679.1|2963468_2963969_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000043869.1|2964146_2964422_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2964536_2964836_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985261.1|2964951_2965965_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|2966229_2966547_-	hypothetical protein	NA	NA	NA	NA	NA
2966045:2966072	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2966952_2967852_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 14
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	2993483	3065780	5645226	tRNA,portal,tail,head,transposase,holin,capsid,terminase	Enterobacteria_phage(55.74%)	70	NA	NA
WP_001301615.1|2993483_2995517_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_085948178.1|2998076_2999289_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001411921.1|3000792_3002073_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3003786_3007416_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3007477_3007795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3009035_3010124_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3010134_3011664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3011682_3012414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3012406_3013543_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3013539_3015543_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001171554.1|3015926_3016307_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3016303_3016651_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3016700_3018239_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001295430.1|3018620_3019091_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3019137_3019857_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3019853_3021539_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|3022053_3022302_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3022463_3023105_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3023186_3023603_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3023763_3024033_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268879.1|3024034_3025204_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001230508.1|3025268_3025868_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_015994252.1|3025935_3029415_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_149025382.1|3029674_3030307_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000967271.1|3030252_3030990_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_001416667.1|3031043_3031967_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3032037_3032211_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3032318_3032639_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|3032655_3033354_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|3033353_3033695_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3033687_3036930_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3036977_3037187_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3037282_3037657_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|3037671_3038388_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|3038453_3038798_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3038794_3039241_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3039237_3039588_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3039598_3039925_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_064261943.1|3039921_3042345_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	93.7	0.0e+00
WP_001063099.1|3042290_3042512_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3042556_3044494_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3044557_3046219_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3046215_3046779_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3047068_3047434_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3047475_3047703_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3048127_3048313_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3048540_3048687_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3048686_3049256_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3049526_3050060_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3050110_3050455_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411802.1|3050459_3050666_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_064261944.1|3051113_3052964_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_000752026.1|3053462_3053732_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3053741_3054689_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3055195_3055630_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3055622_3055817_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|3055813_3056419_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|3056418_3057141_-	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_000290551.1|3057215_3057893_-	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001254256.1|3058168_3058351_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3058347_3058875_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001310475.1|3058871_3059318_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|3059274_3059511_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3059521_3059737_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|3059869_3060148_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_085948178.1|3060800_3062014_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_027868261.1|3063268_3063970_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|3064029_3064137_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3064117_3064849_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3064853_3065780_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	3310061	3315448	5645226	integrase	Enterobacteria_phage(50.0%)	6	3300512:3300528	3312476:3312492
3300512:3300528	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3310061_3310994_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3311305_3312463_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3312637_3313774_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3312476:3312492	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3313783_3314464_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3314450_3314918_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_064261946.1|3314917_3315448_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	3.7e-68
>prophage 16
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	3557167	3617868	5645226	tRNA,tail,transposase,holin,integrase	Enterobacteria_phage(30.0%)	59	3574615:3574629	3622827:3622841
WP_000997403.1|3557167_3558205_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3558411_3558831_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3558899_3559598_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3559629_3562290_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3562403_3563759_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3563804_3564128_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3564124_3565423_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3571198_3573772_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3573901_3574633_-	polyphenol oxidase	NA	NA	NA	NA	NA
3574615:3574629	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|3574629_3575610_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3575744_3576482_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3576752_3577094_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3577197_3577245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3577343_3578504_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3578546_3579668_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3579678_3580749_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3580958_3581324_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3581473_3581992_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3581981_3583208_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3583223_3583706_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3583782_3584130_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3584171_3584939_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3584969_3585518_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3585536_3585785_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3585921_3587283_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3587449_3588241_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3588262_3589549_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3589603_3590197_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3590319_3591198_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|3591283_3592945_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3593093_3593435_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3593496_3593787_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3593776_3594253_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3594384_3594867_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3595712_3595961_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3596462_3597053_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3597235_3597886_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3597964_3599023_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3599152_3599575_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3599735_3600005_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|3600006_3600573_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|3600622_3600970_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3600966_3601347_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3601703_3602048_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3602052_3602268_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3602417_3604271_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3604678_3604846_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3604931_3605675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3605927_3606551_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3606547_3607213_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3607209_3607821_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3607795_3608362_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_085948178.1|3609016_3610230_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001417601.1|3610813_3611116_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150582.1|3611191_3612400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3612795_3613209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3613306_3613705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|3615347_3616661_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3616662_3617868_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3622827:3622841	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 17
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	4190822	4289424	5645226	plate,protease,tail,head,transposase,integrase	Shigella_phage(40.0%)	117	4258362:4258379	4278633:4278650
WP_001107466.1|4190822_4192757_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000145975.1|4192856_4193486_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|4193611_4193905_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001148001.1|4194060_4194537_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212627.1|4194784_4196218_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673572.1|4196257_4197430_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813037.1|4197445_4198411_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|4198537_4198795_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|4198815_4199127_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047341.1|4199385_4200357_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4200585_4200864_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_000357265.1|4200911_4202171_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|4202225_4202480_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|4202639_4202933_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476484.1|4202932_4203568_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|4203586_4204138_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|4204142_4204925_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|4204932_4205742_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|4205951_4206929_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001302021.1|4206942_4207929_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	2.5e-38
WP_000030005.1|4207949_4208516_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030527.1|4208512_4209088_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4209056_4209614_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4209620_4210346_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4210393_4211827_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4211849_4212137_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_001301839.1|4212254_4212746_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4212791_4213646_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4213642_4213915_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|4214128_4214761_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047079.1|4214757_4215486_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001302019.1|4215482_4216136_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809770.1|4216365_4218702_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4218797_4219727_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_001310491.1|4220400_4224861_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081695.1|4224873_4226292_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_000445148.1|4226475_4227603_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.1e-72
WP_000979870.1|4227662_4228127_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209030.1|4228123_4228999_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001301938.1|4228995_4229685_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108469.1|4229732_4231223_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
WP_000224714.1|4231331_4232225_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523844.1|4232346_4233138_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000528251.1|4234356_4235094_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|4235047_4235248_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|4235362_4235827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|4235865_4236111_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|4236146_4236329_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|4236475_4238515_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|4238614_4239175_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4239397_4239601_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4239680_4240202_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|4240236_4241148_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|4241147_4241708_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|4241698_4242781_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4242780_4243218_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4243210_4243825_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|4243814_4244939_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|4244922_4246272_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|4246258_4248334_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|4248460_4248937_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4248951_4249317_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|4249325_4250828_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|4250824_4251070_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|4251070_4251631_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|4251627_4252047_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|4252043_4252430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4252473_4253421_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_064261950.1|4253420_4254545_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	4.9e-78
WP_000094804.1|4254721_4255195_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|4255313_4256639_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|4256622_4258212_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|4258211_4259876_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
4258362:4258379	attL	CGCCACGGCAAAATCACC	NA	NA	NA	NA
WP_000360581.1|4259875_4260457_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|4260459_4260750_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|4260746_4261055_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|4261035_4261263_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|4261272_4261491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4261474_4261903_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4261937_4262438_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4262509_4262935_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|4263004_4263514_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|4263510_4263807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|4263796_4263994_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|4263986_4264319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|4264357_4264543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|4264539_4265091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|4265094_4265610_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|4265609_4266143_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|4266146_4266689_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|4266786_4267317_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|4267328_4267622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4267626_4267899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4267895_4268177_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4268178_4268433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|4268445_4268667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4268669_4269602_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|4269672_4271763_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|4271764_4272013_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|4272203_4272734_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000366129.1|4273676_4274174_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|4274179_4274818_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4275212_4275605_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4275620_4276049_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|4276267_4277395_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4277588_4277987_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001301636.1|4278140_4279508_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	5.1e-21
4278633:4278650	attR	GGTGATTTTGCCGTGGCG	NA	NA	NA	NA
WP_000497723.1|4279597_4280665_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|4280728_4281667_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|4282101_4282572_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|4282936_4283200_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|4283255_4283528_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000350957.1|4283619_4285587_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854038.1|4285592_4286522_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_001310167.1|4286529_4286733_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|4286915_4287845_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055927.1|4287978_4289424_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 18
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	4743174	4755458	5645226	integrase	Enterobacteria_phage(90.0%)	12	4731590:4731603	4756271:4756284
4731590:4731603	attL	TATGGTGCGGAGAT	NA	NA	NA	NA
WP_001218978.1|4743174_4744362_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
WP_000704989.1|4744581_4746102_-	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000446145.1|4746742_4747315_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638631.1|4747388_4747889_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283041.1|4747885_4748620_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_001149160.1|4749170_4749437_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980233.1|4749433_4750033_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001244665.1|4750025_4750313_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4750305_4750761_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4750896_4751217_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783661.1|4751231_4753565_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001219063.1|4754276_4755458_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
4756271:4756284	attR	TATGGTGCGGAGAT	NA	NA	NA	NA
>prophage 19
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	5249575	5264240	5645226	tail,integrase,tRNA	Enterobacteria_phage(40.0%)	18	5250856:5250871	5268385:5268400
WP_000956557.1|5249575_5250109_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|5250526_5250808_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5250856:5250871	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5251152_5251350_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5251685_5251970_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5251966_5252317_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5252307_5252844_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5254165_5254765_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5254829_5256143_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5256144_5256414_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5256525_5257098_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5257170_5257800_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5257881_5258523_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5258683_5258932_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5258993_5260091_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5260179_5261217_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5261350_5261593_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5261758_5262742_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_064261955.1|5262824_5264240_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5268385:5268400	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 20
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	5401120	5460148	5645226	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5401120_5402380_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5402382_5403387_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5403468_5403666_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5403769_5405068_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5405272_5405698_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5405736_5408178_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5408358_5409090_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5409216_5409618_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5409636_5410335_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5410385_5411045_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5411062_5411461_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5411470_5412109_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5412111_5413275_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5413358_5414984_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5415100_5415376_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5415524_5415854_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5416035_5416785_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5416781_5417537_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5419063_5420461_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5420476_5420782_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5420791_5421256_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5421269_5421920_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5421929_5422784_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|5422783_5423470_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|5423598_5423874_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5424200_5424596_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5424602_5424917_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5424921_5425149_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5425190_5425640_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5425710_5426505_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5427127_5427559_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5427566_5428775_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5428909_5429548_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5429765_5430386_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5430694_5432107_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5432151_5432814_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5432921_5433887_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5433994_5434855_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|5434943_5435324_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|5435441_5437385_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5437574_5438315_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5438526_5439465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|5439527_5440082_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5440406_5440613_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5440708_5442052_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5442374_5443013_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5443218_5444952_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5444948_5448728_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5448730_5449072_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5449283_5449535_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|5449528_5449879_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5449958_5450489_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5450798_5451755_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5451894_5453397_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5453410_5454433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5454419_5455415_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5455447_5456446_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5456621_5457995_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5458150_5458702_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5458795_5460148_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 21
NZ_CP015846	Escherichia coli O157:H7 strain FRIK2069, complete genome	5645226	5492568	5505144	5645226	integrase	Enterobacteria_phage(81.82%)	15	5487601:5487616	5506096:5506111
5487601:5487616	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|5492568_5493843_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|5494010_5494316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|5494392_5495127_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|5495164_5496409_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|5496734_5497307_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|5497380_5497881_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|5497877_5498612_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|5499163_5499430_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|5499426_5500017_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|5500009_5500297_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459294.1|5500289_5500745_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|5500880_5501201_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|5501215_5503549_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|5503904_5504099_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|5504316_5505144_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5506096:5506111	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP015847	Escherichia coli O157:H7 strain FRIK2069 plasmid p0157, complete sequence	95599	831	63135	95599	protease,integrase,transposase	Stx2-converting_phage(26.67%)	58	NA	NA
WP_085948178.1|831_2044_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|2010_2091_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|2767_3574_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_001159868.1|3574_3880_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|3881_4100_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|4558_5242_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|5238_5859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|5855_6056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|6463_7441_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_064261959.1|7725_8466_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	1.0e-23
WP_010891288.1|8586_8817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303402.1|9298_9493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|9559_10999_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|11002_13123_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217739.1|13172_16169_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|16170_16686_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000971918.1|18576_18978_-	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000096786.1|19069_19903_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001004187.1|19960_20473_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|20459_21632_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|21670_22648_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000082782.1|22644_23244_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000173396.1|23240_23588_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082929.1|23602_24157_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001231211.1|24153_24588_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173152.1|24618_25842_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|25843_27349_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001302177.1|27348_29316_-	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_001302175.1|29316_30192_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_072141201.1|30278_32975_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302181.1|33846_34845_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|34918_36640_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|36729_37836_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|37835_38657_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071525077.1|39258_39438_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001171554.1|40542_40923_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|40919_41267_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|41316_42855_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_071527313.1|42948_43122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034097.1|43284_47187_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_085950648.1|47306_47402_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
WP_001172748.1|48412_48802_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|48845_51056_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001302179.1|51232_51418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105064.1|52758_52965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421248.1|53059_53335_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|53334_53619_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130945.1|54530_55388_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|55380_55455_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083831.1|55690_55945_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766796.1|56184_56523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302200.1|56560_56770_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233853.1|56815_57277_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|57521_57734_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|57866_58427_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|58529_59390_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|59448_60195_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000998048.1|61596_63135_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
