The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	131063	166187	5831209	transposase	Escherichia_phage(30.77%)	38	NA	NA
WP_000998051.1|131063_132602_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|132651_132999_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|132995_133376_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001274561.1|133659_134505_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772032.1|134589_134787_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_053920163.1|134806_135295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|135291_135669_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|135715_136093_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|136255_136477_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|136539_137016_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|137031_137505_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|137846_138665_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|138819_138978_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820574.1|139048_141895_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|142267_143140_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|143238_144111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387788.1|146698_147301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|147395_147674_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|149264_149834_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|149999_150383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|150936_151641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|151677_152334_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|152330_152840_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1B2IBQ4	Erwinia_phage	35.0	6.5e-14
WP_064234909.1|152935_153640_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001300294.1|155029_155698_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|155733_155970_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|155966_156329_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|156346_158041_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|158092_158515_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|158550_158826_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|158839_159190_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|159261_159696_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|160698_160941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|160972_161623_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|161728_162928_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_065897011.1|162959_163871_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067855.1|164656_165361_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|165482_166187_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	1257183	1279381	5831209	integrase,transposase,tail,holin	Stx2-converting_phage(42.86%)	26	1248829:1248843	1280252:1280266
1248829:1248843	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1257183_1258389_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1258390_1259704_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1259700_1261332_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1261332_1261731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1261828_1262242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150573.1|1262637_1263912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1263987_1264290_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1264325_1265081_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1265404_1265971_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1265945_1266557_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1266553_1267219_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1267215_1267839_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1268091_1268835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1268920_1269088_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000284517.1|1271497_1271713_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1271717_1272062_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1272418_1272799_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1272795_1273143_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303014.1|1273192_1273759_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_001023396.1|1273760_1274030_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1274190_1274613_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1274742_1275801_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1275879_1276530_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1276712_1277303_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1277804_1278053_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1278898_1279381_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1280252:1280266	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	1556770	1617444	5831209	capsid,integrase,tail,protease,holin,lysis,portal	Escherichia_phage(27.03%)	74	1561126:1561149	1616413:1616436
WP_001005794.1|1556770_1557301_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1557300_1557768_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1557754_1558435_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1558444_1559581_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1559755_1560913_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1561126:1561149	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1561344_1562514_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1562497_1562680_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1562740_1562992_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000763383.1|1564385_1564607_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1564705_1564987_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1564997_1565189_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_064032105.1|1565161_1565344_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	2.0e-26
WP_000186844.1|1565340_1566021_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_016241376.1|1566017_1566803_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|1566808_1567105_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1567180_1567324_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1567292_1567457_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167595.1|1567648_1568119_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024231298.1|1568122_1568455_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	97.3	4.6e-53
WP_032250460.1|1568808_1569213_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	9.6e-69
WP_000028392.1|1569209_1569842_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1569948_1570164_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1570283_1570577_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_044782519.1|1570609_1571548_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.7	8.2e-172
WP_064234920.1|1571544_1572246_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1572242_1572533_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1572603_1572882_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1573014_1573230_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1573240_1573477_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1573433_1573880_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153270.1|1573876_1574404_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1574400_1574583_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001502725.1|1575086_1576859_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001108081.1|1577440_1578007_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_064032103.1|1577981_1578593_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_000144764.1|1578589_1578784_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1578776_1579211_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_064234922.1|1579717_1580665_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	7.0e-171
WP_000752026.1|1580674_1580944_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064032101.1|1581447_1583388_+	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000143458.1|1583524_1583704_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1583744_1584017_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1584093_1584309_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1584313_1584847_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1585161_1585704_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1585703_1585853_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_064032098.1|1585860_1586298_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	96.6	1.2e-69
WP_000839224.1|1586500_1586998_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1586994_1587252_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001086076.1|1587655_1588462_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1588442_1590149_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1590148_1592293_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1592450_1593458_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1593481_1594696_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1594751_1595141_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1595190_1595652_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1595635_1596199_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_064032097.1|1596198_1596849_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	1.3e-120
WP_064234923.1|1596845_1598741_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1598742_1599012_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1599154_1599343_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1599637_1601263_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1601259_1602528_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1602542_1602821_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1602826_1603444_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1603534_1604269_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1604501_1604642_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1604698_1605100_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1605193_1605850_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1605852_1606299_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1606308_1606560_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_064234925.1|1606570_1607836_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	99.8	3.1e-206
WP_000331678.1|1607905_1616290_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000368131.1|1616511_1617444_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1616413:1616436	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 4
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	1861821	1938706	5831209	capsid,integrase,tRNA,tail,holin,terminase,head,lysis,portal	Stx2-converting_phage(42.67%)	86	1864296:1864316	1914124:1914144
WP_000569336.1|1861821_1862748_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1862752_1863484_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1863464_1863572_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1863631_1864333_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1864296:1864316	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1864353_1865640_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1865673_1865928_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1865946_1866081_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1866084_1866327_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1866414_1866777_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1866773_1867130_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1867463_1867640_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1867641_1868589_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1868585_1868807_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1868905_1869187_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1869197_1869389_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1869361_1869544_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1869543_1870221_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1870217_1871003_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1871008_1871305_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1871380_1871671_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1872174_1873782_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1873888_1874581_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1874944_1875484_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1875570_1876500_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1876496_1877198_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1877194_1877479_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1877706_1877904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1877947_1878229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1878319_1878421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1878417_1878873_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1878872_1879043_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1879035_1879326_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1879322_1879685_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1879681_1879822_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1879907_1880342_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000691354.1|1880848_1881796_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1881805_1882075_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064234927.1|1882574_1884512_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000143464.1|1884648_1884828_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|1884868_1885141_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1885217_1885433_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|1885432_1885930_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1885926_1886364_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1886566_1887064_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1887060_1887318_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1887780_1888008_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|1888049_1888415_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|1888706_1889270_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|1889266_1890928_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1890991_1892929_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1892973_1893195_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_077882900.1|1893140_1895882_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	94.0	0.0e+00
WP_000125988.1|1895884_1896211_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1896220_1896571_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1896567_1897014_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1897010_1897355_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1897420_1898137_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1898151_1898526_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1898621_1898831_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1898878_1902121_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1902113_1902455_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1902454_1903153_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1903169_1903490_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1903597_1903771_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1903841_1904765_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1904818_1905556_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1905501_1906134_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|1906393_1909873_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|1909939_1910539_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268876.1|1910603_1911917_+	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|1911918_1912188_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_072142879.1|1912348_1912765_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1912846_1913488_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1913649_1913898_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1914412_1916098_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1914124:1914144	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1916094_1916814_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1916860_1917331_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1917372_1917834_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1917958_1919962_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1919958_1921095_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1921087_1921819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1921837_1923367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053920124.1|1923377_1924466_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1925706_1926024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1926085_1929715_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1936672_1938706_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	1964325	2002392	5831209	capsid,integrase,tRNA,tail,holin,terminase,head,lysis,portal,plate	Escherichia_phage(62.22%)	50	1966106:1966133	1998066:1998093
WP_000807362.1|1964325_1965225_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1965630_1965948_+	hypothetical protein	NA	NA	NA	NA	NA
1966106:1966133	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1966212_1967226_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1967341_1967641_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1967762_1968038_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1968048_1968219_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1968215_1968716_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1968779_1969004_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1969003_1969303_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1969305_1969530_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1969526_1969802_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1969791_1972074_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1972163_1973387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1973433_1973886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1973885_1975853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1976170_1977205_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1977204_1978977_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1979150_1980005_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1980063_1981137_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1981140_1981884_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1981983_1982493_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1982492_1982696_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1982699_1982981_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1982980_1983478_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1983492_1983918_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1983905_1984331_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1984302_1984476_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1984438_1984906_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1984898_1985351_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1985417_1986053_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1986049_1986397_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1986401_1987310_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1987302_1987914_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217053.1|1987910_1989110_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001008233.1|1989130_1989574_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1989545_1990148_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1990147_1990681_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1990708_1991302_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001684736.1|1991361_1992552_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.0e-223
WP_001251408.1|1992564_1993083_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1993139_1993415_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1993447_1993567_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1993559_1996007_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1996021_1996501_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1996500_1997664_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1997745_1997964_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1998237_1999599_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1998066:1998093	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1999746_2000079_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|2000269_2000992_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|2000988_2002392_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	2085616	2161937	5831209	capsid,integrase,transposase,tail,protease,holin,terminase,head,lysis,portal	Stx2-converting_phage(56.98%)	99	2076567:2076581	2091990:2092004
2076567:2076581	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|2085616_2086795_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2086775_2086967_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2087044_2087389_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2087576_2087927_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2087923_2088280_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289930.1|2088793_2089741_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2089737_2089959_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2090057_2090339_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2090349_2090541_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2090513_2090696_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2090692_2091373_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|2091369_2092155_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2091990:2092004	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2092160_2092457_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2092531_2092675_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2092643_2092808_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_114139127.1|2092880_2093051_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.4e-13
WP_162829202.1|2093034_2094248_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_064234934.1|2094253_2094562_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	3.6e-44
WP_000394299.1|2094744_2094996_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2095054_2095327_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2095304_2095487_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2096055_2096577_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_162829202.1|2096661_2097874_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302016.1|2098391_2099087_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2099161_2099377_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2099518_2099815_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2099847_2100009_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2099995_2100817_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2100813_2102190_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|2102268_2102880_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001442362.1|2103343_2103676_+	hypothetical protein	NA	A0A0P0ZCZ1	Stx2-converting_phage	100.0	5.7e-59
WP_000814616.1|2103672_2104083_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
WP_001254240.1|2104079_2104271_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	2.9e-31
WP_000211415.1|2104536_2104872_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	96.4	3.0e-52
WP_000178725.1|2105133_2105808_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	95.1	1.8e-120
WP_001004033.1|2105882_2106605_+	phage antirepressor protein	NA	Q4A1A3	Enterobacteria_phage	98.8	1.7e-129
WP_001108004.1|2106604_2107210_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2107206_2107878_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2107868_2108357_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2109006_2109966_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2109977_2110247_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2110543_2110867_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143111.1|2111110_2113048_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2113184_2113364_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2113404_2113677_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2113753_2113969_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|2113968_2114466_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|2114462_2114900_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|2115102_2115600_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2115596_2115854_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2116316_2116544_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|2116585_2116951_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|2117241_2117805_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|2117801_2119463_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2119526_2121464_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2121508_2121730_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_077882900.1|2121675_2124417_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	94.0	0.0e+00
WP_000125988.1|2124419_2124746_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2124755_2125106_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000133388.1|2125546_2125891_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_114139330.1|2126449_2126722_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	83.8	2.2e-24
WP_001007905.1|2127125_2127476_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2127472_2127919_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2127915_2128260_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2128325_2129042_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2129056_2129431_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2129526_2129736_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2129783_2133026_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2133018_2133360_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|2133359_2134058_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|2134074_2134395_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2134502_2134676_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2134746_2135670_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2135723_2136461_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2136406_2137039_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|2137298_2140778_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|2140844_2141444_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234935.1|2141508_2142822_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	2.4e-76
WP_001023353.1|2142823_2143093_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_000491542.1|2143233_2144109_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2144333_2144984_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2146308_2147475_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2147593_2148067_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2148265_2149324_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2149495_2149825_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2149925_2150108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2150594_2150708_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2150720_2150915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2151373_2151742_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2151815_2152037_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2152099_2152576_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2152590_2153070_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2153151_2153973_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2154193_2154604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2154619_2155303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2155438_2156509_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2156505_2157411_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2157407_2158205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2160398_2161937_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 7
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	2181967	2229275	5831209	integrase,transposase,tail,holin,terminase,head,portal	Escherichia_phage(37.21%)	54	2166593:2166607	2192096:2192110
2166593:2166607	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2181967_2183181_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2186938_2187736_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2187971_2188994_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2188993_2189197_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064234937.1|2189255_2191727_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2191822_2192011_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2192007_2192196_-	cell division inhibitor	NA	NA	NA	NA	NA
2192096:2192110	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2192676_2192829_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2193103_2193748_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2193845_2194073_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2194069_2194495_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2194563_2195601_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2195512_2196055_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2196089_2196788_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2196809_2197034_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2197030_2197387_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2197419_2197572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2197568_2197880_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2198006_2198570_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2198679_2198784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2198970_2199183_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2199350_2199629_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2199630_2200680_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2200692_2201052_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2201048_2201738_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2203277_2205128_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2205209_2206423_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2206733_2206949_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|2206953_2207298_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992126.1|2207348_2207882_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2208037_2208220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2208232_2208364_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2208591_2208777_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2209311_2209626_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2209707_2209932_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2210326_2210836_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2212721_2212928_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2212924_2214517_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2214506_2216012_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2216048_2216396_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2216453_2216720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2216701_2217442_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2217455_2217887_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2217913_2218327_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2218307_2220170_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_134790849.1|2220121_2220886_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|2220882_2221212_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060722696.1|2221211_2221910_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000194760.1|2221920_2222664_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_077775224.1|2222609_2223239_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_064234939.1|2223479_2226959_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|2227026_2227626_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064234941.1|2227690_2229004_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001023445.1|2229005_2229275_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
>prophage 8
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	2606261	2739108	5831209	capsid,integrase,tRNA,transposase,tail,protease,holin,terminase,head,lysis,portal	Enterobacteria_phage(36.36%)	158	2614512:2614527	2701435:2701450
WP_001260835.1|2606261_2607083_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2607182_2607266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2607358_2607694_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2608090_2609344_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2609450_2610344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2610478_2611699_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2611823_2612519_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2612471_2613764_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2613921_2614536_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
2614512:2614527	attL	TATCTTGCTGTGAAAA	NA	NA	NA	NA
WP_000526515.1|2614578_2615433_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2615434_2616052_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2616062_2618486_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2618546_2620973_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2621171_2621477_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2621584_2622295_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2622297_2622858_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2622892_2623234_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2623368_2623695_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2623867_2623993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005552.1|2624683_2624935_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2625007_2627479_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2627571_2627763_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2627759_2627948_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2628348_2628513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2628516_2628735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072143447.1|2628806_2629106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2629458_2629737_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2629738_2629930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2629950_2630322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2630419_2630722_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2630718_2631144_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2631166_2632129_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2632135_2632876_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2633686_2634082_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2634138_2634723_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2634838_2634943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2635131_2635344_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2635511_2635790_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2635791_2636841_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2636853_2637213_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2637209_2637899_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2638536_2638965_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_064234946.1|2639443_2641294_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024180155.1|2641733_2641949_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2641953_2642298_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2642348_2642882_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2643152_2643722_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2643721_2643868_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2644095_2644281_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2644705_2644933_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2644974_2645340_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2645630_2646194_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2646190_2647852_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2647915_2649853_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2649897_2650119_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106378527.1|2650064_2652404_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2652483_2652810_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2652819_2653170_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2653166_2653613_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2653609_2653954_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2654012_2654729_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2654734_2655109_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2655204_2655414_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_077882908.1|2655466_2657521_+	tape measure protein	NA	A0A0P0ZDY0	Stx2-converting_phage	98.9	1.5e-263
WP_000967271.1|2657574_2658312_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2658257_2658494_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2658506_2658596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2658615_2660964_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2661554_2664956_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2667059_2667185_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2667264_2667540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2667600_2668962_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2669325_2670189_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2670172_2671309_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2671558_2672785_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2672833_2673955_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|2674203_2675433_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2675797_2675986_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2676035_2676362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2676486_2676660_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2676790_2676988_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2676980_2677193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2677182_2677647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2677639_2677873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2677878_2678178_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|2678174_2679575_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|2679775_2680027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2680023_2680434_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2680444_2680717_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2680843_2681068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2681319_2681526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2681525_2682581_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2682593_2682929_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|2682941_2683355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2683560_2684103_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2684358_2684640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2685241_2686702_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2686701_2687373_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2687539_2688910_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2688913_2689555_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2689590_2690697_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2690750_2691212_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2691221_2691875_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2692046_2693297_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2693410_2694553_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2694542_2694779_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2695703_2696405_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2696401_2696704_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2696771_2697104_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2697168_2697291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2697348_2698875_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2699376_2699832_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2699831_2700002_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2699994_2700285_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2700281_2700644_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2700640_2700781_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2700777_2701467_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
2701435:2701450	attR	TTTTCACAGCAAGATA	NA	NA	NA	NA
WP_000544528.1|2701788_2702094_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2702080_2702557_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2702773_2702956_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2703046_2703340_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2703631_2704042_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2704327_2704534_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2704698_2704893_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2705281_2705827_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2705801_2707727_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2707723_2707930_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2707926_2709528_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2709508_2710828_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2710837_2711170_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2711225_2712251_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2712292_2712691_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2712702_2713056_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000683120.1|2713641_2714037_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001143002.1|2714044_2714785_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2714800_2715223_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2715204_2715639_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2715631_2718181_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_064234969.1|2718177_2718507_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.6e-58
WP_001152612.1|2718506_2719205_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2719210_2719954_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2719890_2720523_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2720583_2723982_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2724048_2724648_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2724712_2727628_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2727627_2728209_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2728328_2729219_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2729237_2729744_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2729780_2730281_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2730359_2730542_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2731039_2731708_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2731764_2732013_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|2732088_2732469_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2732465_2732813_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2732862_2734401_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2734703_2736188_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2736374_2737328_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_162829202.1|2737894_2739108_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 9
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	2836664	2934488	5831209	capsid,integrase,transposase,tail,holin,terminase,head,portal	Escherichia_phage(30.48%)	128	2829390:2829403	2846211:2846224
2829390:2829403	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2836664_2837795_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2837772_2838021_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2838085_2840557_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2840649_2840841_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2840837_2841026_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2841423_2841591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2841584_2841818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2841795_2842203_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2842225_2842444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2842516_2842816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2843079_2843487_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2843563_2843791_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2843774_2844326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2844297_2845338_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2845249_2845792_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2845978_2846560_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2846211:2846224	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2846556_2846721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2847419_2848178_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2848456_2848669_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2848889_2849147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2849216_2849495_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2849496_2850543_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2850555_2850915_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2850923_2851454_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2851695_2851893_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2852043_2853102_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2853898_2855752_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2855901_2856117_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2856121_2856466_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2856516_2857050_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2857320_2857890_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2857889_2858036_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2858263_2858449_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2858873_2859101_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2859142_2859508_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2859798_2860362_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2860358_2862020_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2862083_2864021_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2864065_2864287_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106378527.1|2864232_2866572_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2866651_2866978_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2866987_2867338_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2867334_2867781_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2867777_2868122_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2868180_2868897_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2868902_2869277_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2869372_2869582_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234971.1|2869634_2872877_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2872869_2873211_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2873210_2873909_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2873925_2874180_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2874289_2874400_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2874702_2875581_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2875634_2876372_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2876317_2876554_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2876566_2876656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2876675_2879024_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001023362.1|2879217_2879487_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2880663_2881314_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2881896_2883435_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2883484_2883832_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2883828_2884209_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2885171_2885486_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2886124_2887369_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2887461_2887650_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2887646_2887835_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2888399_2888609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2888609_2889248_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2889259_2889412_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2889704_2890043_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2890434_2890677_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2890660_2891086_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2891154_2892198_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2892190_2892652_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2892685_2893402_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2893434_2893716_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2893712_2893940_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2893932_2894244_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2894371_2894590_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2894591_2895149_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2895382_2895595_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2895714_2896059_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2896180_2896453_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2896454_2897504_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2897516_2897822_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2897884_2898439_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2898663_2898861_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2898996_2899710_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2900160_2900592_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2901069_2902920_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2903359_2903575_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2903579_2903924_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2903974_2904508_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2904778_2905348_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2905347_2905494_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2905716_2905902_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2906427_2906742_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2906823_2907048_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2907434_2907980_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2907954_2909880_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2909876_2910083_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2910079_2911681_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2911661_2912981_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2912990_2913323_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2913378_2914404_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2914445_2914844_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2914855_2915209_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2915223_2915757_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2915753_2916149_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2916156_2916909_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2916922_2917345_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2917371_2917785_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2917765_2920378_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2920374_2920704_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|2920703_2921402_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|2921412_2922156_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_071601640.1|2922101_2922731_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_064234939.1|2922971_2926451_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|2926518_2927118_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_046671432.1|2927182_2928496_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2928497_2928767_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2928880_2929456_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2929528_2930158_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2930239_2930881_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2931042_2931357_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2931416_2932700_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2932788_2934249_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2934284_2934488_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3203778	3317209	5831209	capsid,integrase,transposase,tail,protease,holin,terminase,head,lysis,portal	Enterobacteria_phage(30.53%)	129	3246881:3246940	3306338:3306400
WP_000422055.1|3203778_3204828_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3205047_3205806_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3205802_3206393_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3206432_3207305_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3207517_3209101_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3209128_3209749_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3209745_3210627_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3210764_3210809_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3210900_3212463_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3212462_3214058_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001417165.1|3214061_3215420_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|3215431_3216625_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3216624_3217431_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3217811_3217991_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3218076_3218577_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3218622_3219129_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|3219618_3219789_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_064234959.1|3220166_3220757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101703.1|3221890_3222160_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_064234961.1|3222161_3223475_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230409.1|3223539_3224139_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	3.0e-111
WP_064234962.1|3224205_3227604_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	87.1	0.0e+00
WP_122996286.1|3227850_3228483_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3228428_3229172_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3229177_3229876_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3229875_3230205_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_064234964.1|3230201_3232847_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000533448.1|3232890_3233199_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	3.9e-54
WP_000479046.1|3233225_3233648_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3233661_3234414_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3234421_3234820_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3234832_3235456_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281347.1|3235458_3235740_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|3235732_3236059_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3236146_3238171_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974568.1|3238115_3239618_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3239617_3239830_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3239826_3241950_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|3241946_3242423_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_029786607.1|3242842_3243067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255338.1|3243090_3243558_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.9	2.8e-64
WP_062871796.1|3243554_3244088_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	96.6	2.1e-100
WP_001072901.1|3244092_3244308_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3244385_3244631_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|3244671_3244851_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_064236384.1|3244986_3246933_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.9	0.0e+00
3246881:3246940	attL	GCAAGGTCTGACGGCGACGCCGCCCTGACAACATCATAATGTTTAAATGTCATTATTCCT	NA	NA	NA	NA
WP_000483509.1|3247527_3248586_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|3248736_3248934_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|3249160_3249982_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|3249978_3250353_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|3250365_3251415_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_012779355.1|3251416_3251695_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001217394.1|3251764_3252022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|3252242_3252455_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3252643_3252748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|3252863_3253226_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|3253222_3253594_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|3253629_3253842_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|3253890_3254247_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|3254303_3254699_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|3254714_3255485_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_157837342.1|3255519_3256062_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020570.1|3255973_3257014_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|3256985_3257537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3257520_3257748_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3257825_3258233_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|3258422_3258578_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|3258737_3258956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|3258959_3259124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3259521_3259710_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3259706_3259895_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|3259987_3262432_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|3262496_3262745_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|3262722_3263853_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000147167.1|3264340_3264559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|3267309_3267900_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3268083_3268731_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3268867_3269014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3269441_3269720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|3270059_3270440_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3270436_3270784_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3270833_3272372_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3273337_3273907_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3273972_3274884_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3274990_3275113_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3276710_3278036_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3279063_3279333_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3279334_3280648_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3280799_3281399_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3281466_3283812_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3283763_3284939_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3285281_3285914_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3285859_3286603_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001152184.1|3286613_3287312_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|3287311_3287653_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_162780255.1|3291420_3291603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133388.1|3292157_3292502_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3292498_3292945_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3292941_3293292_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3293301_3293628_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|3296002_3296224_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3296268_3298206_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3298269_3299931_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3299927_3300491_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3300780_3301146_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3301187_3301415_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3301839_3302025_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3302252_3302399_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3302398_3302968_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3303238_3303772_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3303822_3304167_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3304171_3304387_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3304536_3306390_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3307186_3308245_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
3306338:3306400	attR	GCAAGGTCTGACGGCGACGCCGCCCTGACAACATCATAATGTTTAAATGTCATTATTCCTCCC	NA	NA	NA	NA
WP_000917750.1|3308395_3308593_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3308834_3309365_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3309373_3309733_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3309745_3310792_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3310793_3311072_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3311141_3311399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3311619_3311832_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3312110_3312869_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3313567_3313732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3313728_3314310_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3314496_3315039_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3314950_3315991_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3315962_3316514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3316497_3316725_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3316801_3317209_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
>prophage 11
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3370095	3428225	5831209	tRNA,transposase,tail,protease	Escherichia_phage(25.0%)	53	NA	NA
WP_001299679.1|3370095_3371352_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3371565_3372189_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3372188_3373040_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3373190_3374138_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3374262_3375942_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3375996_3376275_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3376552_3377137_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3377253_3378345_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3379188_3382074_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001205408.1|3382173_3384102_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3384320_3385391_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3385401_3386034_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_064234967.1|3386044_3387463_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001417816.1|3387766_3388045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3389802_3390825_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3390824_3391805_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3391801_3392560_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|3392569_3393214_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576838.1|3393378_3394233_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3394258_3396229_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3396278_3396533_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3396733_3397330_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_162829200.1|3397381_3398594_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3398782_3399394_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3399493_3400408_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3400503_3402240_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3402342_3402432_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_162829348.1|3402397_3403611_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_162780258.1|3409204_3409399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114139320.1|3409483_3409603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114139321.1|3409608_3409845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114139322.1|3409831_3410125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162780259.1|3410121_3410247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162780260.1|3410252_3410609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162780261.1|3410578_3410695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000897378.1|3412673_3413093_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000807626.1|3414582_3415044_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3415120_3415780_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3415851_3416145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|3416156_3416315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3416385_3416787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3416889_3417258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3417777_3418473_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3418496_3419309_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3419312_3419579_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_071782024.1|3419950_3420844_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|3420881_3422094_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001201843.1|3422661_3423615_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3423801_3425286_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3425588_3427127_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3427176_3427524_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3427520_3427901_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3427976_3428225_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 12
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3431780	3478465	5831209	capsid,integrase,tRNA,tail,holin,terminase,head,lysis,portal	Enterobacteria_phage(58.14%)	55	3449032:3449047	3477286:3477301
WP_000885630.1|3431780_3432362_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3432361_3435277_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3435341_3435941_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3436007_3439406_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3439466_3440099_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3440035_3440779_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3440784_3441483_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_064234969.1|3441482_3441812_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.6e-58
WP_000840323.1|3441808_3444358_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3444350_3444785_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3444766_3445189_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3445204_3445945_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683120.1|3445952_3446348_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000752995.1|3446933_3447287_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3447298_3447697_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3447738_3448764_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3448819_3449152_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3449032:3449047	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3449161_3450481_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3450461_3452063_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3452059_3452266_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3452262_3454188_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3454162_3454708_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3455096_3455291_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3455455_3455662_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3455947_3456358_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3456649_3456943_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3457033_3457216_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3457432_3457909_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3457895_3458201_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3458522_3459212_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3459208_3459349_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3459345_3459708_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3459704_3459995_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3459987_3460158_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3460157_3460613_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3461114_3462641_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3462698_3462821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3462885_3463218_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3463285_3463588_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3463584_3464286_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3465210_3465447_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3465436_3466579_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3466692_3467943_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3468114_3468768_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3468777_3469239_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3469292_3470399_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3470434_3471076_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3471079_3472450_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3472618_3473290_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3473289_3474750_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3475350_3475632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3475887_3476430_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3476635_3477049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3477061_3477397_-|head	head decoration protein	head	NA	NA	NA	NA
3477286:3477301	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3477409_3478465_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 13
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3484557	3541465	5831209	capsid,integrase,tail,holin,terminase,head,portal	Enterobacteria_phage(24.49%)	60	3527032:3527052	3548122:3548142
WP_000085256.1|3484557_3485787_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3486035_3487157_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3487205_3488432_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3488681_3489818_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3489801_3490665_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001301834.1|3492808_3492934_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_162780262.1|3501137_3501305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780256.1|3503603_3503816_-	hypothetical protein	NA	A0A0P0ZB28	Stx2-converting_phage	100.0	8.4e-16
WP_001449772.1|3503825_3503966_-	hypothetical protein	NA	A0A0P0ZDA0	Stx2-converting_phage	100.0	7.0e-19
WP_114139329.1|3509312_3509603_-	hypothetical protein	NA	A0A0P0ZD10	Stx2-converting_phage	100.0	6.5e-35
WP_000133388.1|3509662_3510007_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3510003_3510450_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3510446_3510797_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3510806_3511133_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_106378527.1|3511212_3513552_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_001063099.1|3513497_3513719_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3513763_3515701_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3515764_3517426_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3517422_3517986_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3518276_3518642_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_032173704.1|3518683_3518869_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000347013.1|3518998_3519139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3519495_3519720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3519784_3519991_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3520218_3520365_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3520364_3520934_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3521204_3521738_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3521788_3522133_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3522137_3522353_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3522428_3522698_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3522735_3522918_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3523065_3525003_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3525317_3525485_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3526081_3526903_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3526899_3527274_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3527032:3527052	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3527286_3528336_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3528337_3528616_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3528783_3528996_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3529184_3529289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3529404_3529992_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3529994_3530186_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3530187_3530625_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3530611_3530929_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3530882_3531200_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3531189_3531492_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3531488_3531770_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3531802_3532519_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3532552_3533095_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3533006_3534044_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3534112_3534538_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3534521_3534845_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3534969_3535446_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3535761_3535914_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3536028_3536544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3536676_3537066_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3537127_3537397_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3537365_3538484_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3538650_3539445_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3539441_3540488_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3540643_3541465_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3548122:3548142	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3646952	3706461	5831209	transposase,protease	Escherichia_phage(26.32%)	60	NA	NA
WP_165438806.1|3646952_3648165_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.4e-168
WP_001287881.1|3648759_3648951_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3649003_3649237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3649332_3649956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3650044_3650554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3651011_3651470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3652823_3653948_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3654677_3654875_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3654940_3655156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053921109.1|3655439_3655748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3655731_3656945_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001299815.1|3657113_3657293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3657344_3657539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3658319_3658655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3659287_3659506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3660958_3663049_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3663562_3663949_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3664371_3664947_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3665015_3665594_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3665642_3666683_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3666705_3667161_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3667183_3668341_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3668340_3668922_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3669244_3670303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3670312_3671455_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3671447_3672221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3672222_3673302_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3673301_3674258_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3674268_3675477_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3675494_3675962_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3676222_3676552_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3676538_3676880_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3677822_3679436_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3679466_3679817_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3679813_3680239_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000097913.1|3681383_3681557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000097913.1|3683923_3684097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397129.1|3685116_3685788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3686659_3686800_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3687101_3687365_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3688576_3689194_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3689205_3689880_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3689880_3690345_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3690354_3692058_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3692050_3692371_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3692379_3692682_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3692772_3693471_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3693851_3694127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3694351_3695971_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3696063_3696423_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3697108_3697399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3697422_3697674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3697781_3698995_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_064759902.1|3699046_3699640_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_032210650.1|3699686_3700541_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_001171540.1|3701031_3701412_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3701408_3701756_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3701805_3703344_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000136079.1|3703762_3703939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3704100_3706461_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
>prophage 15
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	3807086	3862570	5831209	integrase,transposase,tail,protease,holin,terminase,head,portal	Enterobacteria_phage(28.26%)	66	3809021:3809036	3864335:3864350
WP_000003653.1|3807086_3807674_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3807670_3808378_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3808396_3810190_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3809021:3809036	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3810186_3811305_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3813437_3813707_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3813708_3815022_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230508.1|3815086_3815686_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_149025607.1|3815753_3818099_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_072618954.1|3818050_3819226_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_000649829.1|3819359_3819887_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_162779756.1|3820077_3820710_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.9e-101
WP_054191786.1|3820655_3821399_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_001151105.1|3821409_3822108_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3822107_3822437_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032106087.1|3822433_3825013_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000533402.1|3824993_3825407_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3825433_3825865_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3825878_3826619_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3826600_3826867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3826924_3827272_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3827308_3828814_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3828803_3830396_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3830392_3830599_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3830582_3832511_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3832482_3832725_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3832774_3834313_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3834362_3834710_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3834706_3835087_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3835162_3835438_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3836188_3836395_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3836650_3836923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3837082_3837616_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3837836_3837950_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3838171_3838357_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3838884_3839199_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3839403_3840617_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3840792_3842643_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3843410_3844124_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3844218_3844458_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3844744_3845563_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3845714_3846086_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3846075_3846447_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3846459_3847509_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3847510_3847789_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3847956_3848169_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3848213_3848351_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3848716_3849490_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3849841_3850255_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3850270_3851041_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3851062_3851809_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3851815_3852907_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3852985_3853441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3853647_3854073_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3854056_3854329_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3854437_3854839_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3854866_3855058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3855057_3855345_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3855622_3855778_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3855919_3856309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3856495_3856681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3857254_3857443_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3857439_3857631_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3857724_3860196_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3860263_3860506_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3860483_3861503_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3861910_3862570_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3864335:3864350	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 16
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	4152818	4194858	5831209	integrase,transposase,tail,protease,holin,terminase,lysis,portal	Enterobacteria_phage(50.0%)	51	4152403:4152417	4194932:4194946
4152403:4152417	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|4152818_4153517_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|4153747_4154629_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|4154797_4154959_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|4155455_4156475_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|4156508_4157489_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|4157665_4157935_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_162829202.1|4158742_4159955_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001233141.1|4160625_4161225_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|4161295_4164709_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|4164769_4165378_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|4165314_4166058_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|4166063_4166762_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|4166771_4167101_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001417032.1|4167100_4167982_-|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	94.9	1.2e-137
WP_162829202.1|4167965_4169179_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001161009.1|4171450_4171780_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4171788_4172175_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|4172235_4172979_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|4172989_4173391_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|4173387_4173966_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|4173977_4174253_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4174245_4174569_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|4174655_4176683_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|4176627_4176963_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_072187152.1|4177084_4178209_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_001072975.1|4178136_4178349_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|4178345_4180448_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|4180447_4180939_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|4181613_4181766_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|4181753_4182221_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|4182217_4182715_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|4182714_4182930_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|4183072_4183471_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|4183551_4183710_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4183795_4184539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|4185026_4186240_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032160865.1|4186740_4186863_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|4187200_4188160_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|4188371_4189037_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|4189033_4189654_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|4189646_4189817_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|4189813_4189996_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|4190693_4191374_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|4191370_4191553_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4191525_4191717_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|4191727_4192009_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|4192107_4192329_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|4192539_4193142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|4193384_4193552_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|4193591_4193810_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|4193787_4194858_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
4194932:4194946	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 17
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	4775099	4819587	5831209	integrase,transposase,tail,plate	Escherichia_phage(26.67%)	43	4774670:4774684	4808386:4808400
4774670:4774684	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4775099_4776281_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4777243_4777987_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4778810_4779584_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4779641_4780196_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4780225_4780720_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4780719_4781313_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4781284_4781728_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_162829202.1|4781845_4783058_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4783385_4783631_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4784700_4785954_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4785965_4787069_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4787356_4788412_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4788450_4788852_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4788909_4790154_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4790245_4790704_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4790964_4792422_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4792478_4793015_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4792947_4793214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4793520_4793973_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4793982_4794381_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4794383_4794677_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4794728_4795784_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4795854_4796640_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4796584_4798324_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4799141_4799915_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4800100_4800361_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4800379_4800640_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4800795_4801536_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4801506_4802274_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4802378_4802957_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4803196_4805641_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4805683_4806157_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4806310_4807081_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4807198_4808371_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4808451_4808637_+	protein YncO	NA	NA	NA	NA	NA
4808386:4808400	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4808551_4808815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053920115.1|4809016_4813240_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4813315_4815457_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4815666_4816185_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4816881_4817382_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4817416_4817641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4817691_4819083_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4819173_4819587_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 18
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	5263806	5322817	5831209	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5263806_5265159_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5265252_5265804_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5265959_5267333_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5267508_5268507_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5268539_5269535_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|5269521_5270544_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|5270557_5272060_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|5272199_5273156_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5273465_5273996_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5274075_5274426_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5274419_5274671_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|5274882_5275224_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|5275226_5279006_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5279002_5280736_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5280941_5281580_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5281902_5283246_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5283324_5283531_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|5283855_5284410_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5284472_5285411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5285622_5286363_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|5286552_5288496_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5288613_5288994_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5289082_5289943_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5290050_5291016_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5291123_5291786_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5291830_5293243_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5293551_5294172_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5294389_5295028_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5295162_5296371_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5296378_5296810_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5297432_5298227_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5298297_5298747_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5298788_5299016_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5299020_5299335_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5299341_5299737_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5300063_5300339_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5300467_5301154_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5301153_5302008_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5302017_5302668_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5302681_5303146_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5303155_5303461_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5303476_5304874_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5306400_5307156_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569692.1|5307152_5307902_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5308083_5308413_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5308561_5308837_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_053920121.1|5308953_5310579_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5310662_5311826_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5311828_5312467_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5312476_5312875_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5312892_5313552_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5313602_5314301_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5314319_5314721_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5314847_5315579_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5315759_5318201_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5318239_5318665_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5318869_5320168_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5320271_5320469_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5320550_5321555_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5321557_5322817_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 19
NZ_CP015831	Escherichia coli O157 strain 644-PT8 chromosome, complete genome	5831209	5459696	5474361	5831209	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	19	5455537:5455552	5473066:5473081
5455537:5455552	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5459696_5461112_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5461194_5462178_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5462343_5462586_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5462719_5463757_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5463845_5464943_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217542.1|5465004_5465253_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143817.1|5465413_5466055_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_072140863.1|5466136_5466766_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5466838_5467411_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5467522_5467792_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_064234994.1|5467793_5469107_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001230302.1|5469171_5469771_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_000008211.1|5471092_5471629_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5471619_5471970_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5471966_5472251_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5472586_5472784_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5473128_5473410_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5473066:5473081	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5473457_5473631_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5473827_5474361_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
