The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	131063	166187	5509528	transposase	Escherichia_phage(30.77%)	38	NA	NA
WP_000998051.1|131063_132602_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|132651_132999_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|132995_133376_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001274561.1|133659_134505_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772032.1|134589_134787_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_053920163.1|134806_135295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|135291_135669_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|135715_136093_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|136255_136477_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|136539_137016_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|137031_137505_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|137846_138665_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|138819_138978_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820574.1|139048_141895_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|142267_143140_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|143238_144111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387788.1|146698_147301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|147395_147674_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|149264_149834_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|149999_150383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|150936_151641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|151677_152334_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|152330_152840_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1B2IBQ4	Erwinia_phage	35.0	6.5e-14
WP_064234909.1|152935_153640_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001300294.1|155029_155698_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|155733_155970_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|155966_156329_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|156346_158041_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|158092_158515_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|158550_158826_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|158839_159190_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|159261_159696_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|160698_160941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|160972_161623_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|161728_162928_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_065897011.1|162959_163871_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067855.1|164656_165361_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|165482_166187_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	1257960	1280194	5509528	holin,transposase,integrase,tail	Stx2-converting_phage(42.86%)	26	1249606:1249620	1281065:1281079
1249606:1249620	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1257960_1259166_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1259167_1260481_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1260477_1262109_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1262109_1262508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1262605_1263019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064234917.1|1263414_1264701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1264776_1265079_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1265114_1265870_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1266217_1266784_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1266758_1267370_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1267366_1268032_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1268028_1268652_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1268904_1269648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1269733_1269901_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000284517.1|1272310_1272526_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1272530_1272875_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1273231_1273612_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1273608_1273956_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303014.1|1274005_1274572_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_001023396.1|1274573_1274843_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1275003_1275426_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1275555_1276614_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1276692_1277343_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1277525_1278116_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1278617_1278866_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1279711_1280194_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1281065:1281079	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	1557583	1618257	5509528	lysis,integrase,protease,holin,tail,portal,capsid	Escherichia_phage(27.03%)	74	1561939:1561962	1617226:1617249
WP_001005794.1|1557583_1558114_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1558113_1558581_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1558567_1559248_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1559257_1560394_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1560568_1561726_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1561939:1561962	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1562157_1563327_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1563310_1563493_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1563553_1563805_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000763383.1|1565198_1565420_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1565518_1565800_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1565810_1566002_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_064032105.1|1565974_1566157_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	2.0e-26
WP_000186844.1|1566153_1566834_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_016241376.1|1566830_1567616_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|1567621_1567918_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1567993_1568137_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1568105_1568270_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167595.1|1568461_1568932_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024231298.1|1568935_1569268_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	97.3	4.6e-53
WP_032250460.1|1569621_1570026_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	9.6e-69
WP_000028392.1|1570022_1570655_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1570761_1570977_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1571096_1571390_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_044782519.1|1571422_1572361_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.7	8.2e-172
WP_064234920.1|1572357_1573059_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1573055_1573346_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1573416_1573695_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1573827_1574043_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1574053_1574290_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1574246_1574693_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153270.1|1574689_1575217_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1575213_1575396_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001502725.1|1575899_1577672_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001108081.1|1578253_1578820_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_064032103.1|1578794_1579406_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_000144764.1|1579402_1579597_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1579589_1580024_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_064234922.1|1580530_1581478_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	7.0e-171
WP_000752026.1|1581487_1581757_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064032101.1|1582260_1584201_+	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000143458.1|1584337_1584517_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1584557_1584830_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1584906_1585122_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1585126_1585660_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1585974_1586517_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1586516_1586666_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_064032098.1|1586673_1587111_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	96.6	1.2e-69
WP_000839224.1|1587313_1587811_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1587807_1588065_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001086076.1|1588468_1589275_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1589255_1590962_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1590961_1593106_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1593263_1594271_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1594294_1595509_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1595564_1595954_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1596003_1596465_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1596448_1597012_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_064032097.1|1597011_1597662_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	1.3e-120
WP_064234923.1|1597658_1599554_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1599555_1599825_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1599967_1600156_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1600450_1602076_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1602072_1603341_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1603355_1603634_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1603639_1604257_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1604347_1605082_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1605314_1605455_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1605511_1605913_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1606006_1606663_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1606665_1607112_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1607121_1607373_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_064234925.1|1607383_1608649_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	99.8	3.1e-206
WP_000331678.1|1608718_1617103_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000368131.1|1617324_1618257_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1617226:1617249	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 4
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	1862634	1939519	5509528	terminase,lysis,integrase,head,tRNA,holin,tail,portal,capsid	Stx2-converting_phage(42.67%)	86	1865109:1865129	1914937:1914957
WP_000569336.1|1862634_1863561_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1863565_1864297_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1864277_1864385_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1864444_1865146_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1865109:1865129	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1865166_1866453_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1866486_1866741_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1866759_1866894_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1866897_1867140_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1867227_1867590_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1867586_1867943_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1868276_1868453_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1868454_1869402_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1869398_1869620_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1869718_1870000_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1870010_1870202_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1870174_1870357_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1870356_1871034_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1871030_1871816_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1871821_1872118_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1872193_1872484_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1872987_1874595_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1874701_1875394_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1875757_1876297_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1876383_1877313_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1877309_1878011_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1878007_1878292_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1878519_1878717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1878760_1879042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1879132_1879234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1879230_1879686_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1879685_1879856_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1879848_1880139_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1880135_1880498_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1880494_1880635_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1880720_1881155_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000691354.1|1881661_1882609_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1882618_1882888_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064234927.1|1883387_1885325_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000143464.1|1885461_1885641_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|1885681_1885954_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1886030_1886246_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|1886245_1886743_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1886739_1887177_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1887379_1887877_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1887873_1888131_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1888593_1888821_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|1888862_1889228_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|1889519_1890083_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|1890079_1891741_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1891804_1893742_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1893786_1894008_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_077882900.1|1893953_1896695_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	94.0	0.0e+00
WP_000125988.1|1896697_1897024_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1897033_1897384_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1897380_1897827_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1897823_1898168_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1898233_1898950_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1898964_1899339_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1899434_1899644_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1899691_1902934_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1902926_1903268_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1903267_1903966_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1903982_1904303_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1904410_1904584_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1904654_1905578_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1905631_1906369_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1906314_1906947_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|1907206_1910686_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|1910752_1911352_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268876.1|1911416_1912730_+	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|1912731_1913001_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_072142879.1|1913161_1913578_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1913659_1914301_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1914462_1914711_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1915225_1916911_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1914937:1914957	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1916907_1917627_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1917673_1918144_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1918185_1918647_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1918771_1920775_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1920771_1921908_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1921900_1922632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1922650_1924180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053920124.1|1924190_1925279_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1926519_1926837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1926898_1930528_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1937485_1939519_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	1965138	2003205	5509528	terminase,lysis,integrase,head,tRNA,holin,plate,tail,portal,capsid	Escherichia_phage(62.22%)	50	1966919:1966946	1998879:1998906
WP_000807362.1|1965138_1966038_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1966443_1966761_+	hypothetical protein	NA	NA	NA	NA	NA
1966919:1966946	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1967025_1968039_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1968154_1968454_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1968575_1968851_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1968861_1969032_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1969028_1969529_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1969592_1969817_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1969816_1970116_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1970118_1970343_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1970339_1970615_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1970604_1972887_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1972976_1974200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1974246_1974699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064234932.1|1974698_1976666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1976983_1978018_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1978017_1979790_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1979963_1980818_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1980876_1981950_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1981953_1982697_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1982796_1983306_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1983305_1983509_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1983512_1983794_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1983793_1984291_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1984305_1984731_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1984718_1985144_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1985115_1985289_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1985251_1985719_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1985711_1986164_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1986230_1986866_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1986862_1987210_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1987214_1988123_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1988115_1988727_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217053.1|1988723_1989923_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001008233.1|1989943_1990387_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1990358_1990961_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1990960_1991494_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1991521_1992115_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001684736.1|1992174_1993365_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.0e-223
WP_001251408.1|1993377_1993896_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1993952_1994228_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1994260_1994380_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1994372_1996820_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1996834_1997314_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1997313_1998477_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1998558_1998777_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1999050_2000412_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1998879:1998906	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|2000559_2000892_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|2001082_2001805_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|2001801_2003205_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	2086429	2160382	5509528	terminase,lysis,integrase,head,protease,holin,transposase,tail,portal,capsid	Stx2-converting_phage(54.88%)	95	2077380:2077394	2092803:2092817
2077380:2077394	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|2086429_2087608_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2087588_2087780_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2087857_2088202_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2088389_2088740_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2088736_2089093_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289930.1|2089606_2090554_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2090550_2090772_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2090870_2091152_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2091162_2091354_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2091326_2091509_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2091505_2092186_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|2092182_2092968_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2092803:2092817	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2092973_2093270_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2093344_2093488_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2093456_2093621_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_114139127.1|2093693_2093864_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.4e-13
WP_162829202.1|2093847_2095061_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_064234934.1|2095066_2095375_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	3.6e-44
WP_000394299.1|2095557_2095809_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2095867_2096140_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2096117_2096300_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2096868_2097390_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_162829202.1|2097474_2098687_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302016.1|2099204_2099900_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2099974_2100190_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2100331_2100628_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2100660_2100822_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2100808_2101630_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2101626_2103003_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|2103081_2103693_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001442362.1|2104156_2104489_+	hypothetical protein	NA	A0A0P0ZCZ1	Stx2-converting_phage	100.0	5.7e-59
WP_000814616.1|2104485_2104896_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
WP_001254240.1|2104892_2105084_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	2.9e-31
WP_000211415.1|2105349_2105685_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	96.4	3.0e-52
WP_000178725.1|2105946_2106621_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	95.1	1.8e-120
WP_001004033.1|2106695_2107418_+	phage antirepressor protein	NA	Q4A1A3	Enterobacteria_phage	98.8	1.7e-129
WP_001108004.1|2107417_2108023_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2108019_2108691_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2108681_2109170_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2109819_2110779_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2110790_2111060_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2111356_2111680_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143111.1|2111923_2113861_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2113997_2114177_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2114217_2114490_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2114566_2114782_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|2114781_2115279_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|2115275_2115713_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|2115915_2116413_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2116409_2116667_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2117129_2117357_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|2117398_2117764_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|2118055_2118619_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|2118615_2120277_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2120340_2122278_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2122322_2122544_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_077882900.1|2122489_2125231_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	94.0	0.0e+00
WP_000125988.1|2125233_2125560_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2125569_2125920_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2125916_2126363_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2126359_2126704_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000710952.1|2127501_2127876_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2127971_2128181_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2128228_2131471_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2131463_2131805_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|2131804_2132503_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|2132519_2132840_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2132947_2133121_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2133191_2134115_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2134168_2134906_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2134851_2135484_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|2135743_2139223_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|2139289_2139889_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234935.1|2139953_2141267_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	2.4e-76
WP_001023353.1|2141268_2141538_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_000491542.1|2141678_2142554_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2142778_2143429_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2144753_2145920_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2146038_2146512_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2146710_2147769_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2147940_2148270_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2148370_2148553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2149039_2149153_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2149165_2149360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2149818_2150187_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2150260_2150482_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2150544_2151021_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2151035_2151515_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2151596_2152418_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2152638_2153049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2153064_2153748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2153883_2154954_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2154950_2155856_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2155852_2156650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2158843_2160382_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 7
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	2180412	2227720	5509528	terminase,integrase,head,portal,holin,transposase,tail	Escherichia_phage(37.21%)	54	2165038:2165052	2190541:2190555
2165038:2165052	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2180412_2181626_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2185383_2186181_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2186416_2187439_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2187438_2187642_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064234937.1|2187700_2190172_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2190267_2190456_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2190452_2190641_-	cell division inhibitor	NA	NA	NA	NA	NA
2190541:2190555	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2191121_2191274_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2191548_2192193_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2192290_2192518_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2192514_2192940_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2193008_2194046_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2193957_2194500_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2194534_2195233_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2195254_2195479_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2195475_2195832_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2195864_2196017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2196013_2196325_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2196451_2197015_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2197124_2197229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2197415_2197628_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2197795_2198074_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2198075_2199125_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2199137_2199497_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2199493_2200183_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2201722_2203573_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2203654_2204868_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2205178_2205394_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|2205398_2205743_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992126.1|2205793_2206327_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2206482_2206665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2206677_2206809_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2207036_2207222_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2207756_2208071_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2208152_2208377_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2208771_2209281_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2211166_2211373_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2211369_2212962_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2212951_2214457_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2214493_2214841_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2214898_2215165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2215146_2215887_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2215900_2216332_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2216358_2216772_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2216752_2218615_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_134790849.1|2218566_2219331_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|2219327_2219657_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060722696.1|2219656_2220355_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000194760.1|2220365_2221109_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_077775224.1|2221054_2221684_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_064234939.1|2221924_2225404_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|2225471_2226071_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064234941.1|2226135_2227449_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001023445.1|2227450_2227720_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
>prophage 8
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	2285299	2305285	5509528	integrase,transposase,tail	Enterobacteria_phage(75.0%)	28	2298421:2298434	2308427:2308440
WP_032161583.1|2285299_2286436_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2286386_2286710_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2286867_2288052_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2288051_2288564_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2288618_2288984_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2288992_2289148_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2291950_2292439_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2292595_2293168_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2293211_2293742_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2294833_2295148_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2295152_2296112_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2296188_2299011_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2298421:2298434	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2299017_2299383_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2299379_2299997_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2300008_2300308_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2300304_2300571_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2300567_2300771_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2300794_2301211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2301303_2301417_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2301413_2301656_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2301667_2301946_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2301956_2302307_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2302328_2302532_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2302603_2302741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2302830_2303235_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2303250_2303901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2303930_2304278_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2304283_2305285_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2308427:2308440	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	2625829	2739931	5509528	terminase,head,protease,holin,transposase,tail,portal,capsid	Stx2-converting_phage(28.18%)	141	NA	NA
WP_001260835.1|2625829_2626651_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2626750_2626834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2626926_2627262_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2627658_2628912_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2629018_2629912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2630046_2631267_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2631391_2632087_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2632039_2633332_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2633489_2634104_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2634146_2635001_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2635002_2635620_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2635630_2638054_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2638114_2640541_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2640739_2641045_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2641152_2641863_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2641865_2642426_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2642460_2642802_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2642936_2643263_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2643435_2643561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005552.1|2644251_2644503_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2644575_2647047_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2647139_2647331_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2647327_2647516_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2647916_2648081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2648084_2648303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072143447.1|2648374_2648674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2649026_2649305_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2649306_2649498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2649518_2649890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2649987_2650290_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2650286_2650712_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2650734_2651697_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2651703_2652444_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2653254_2653650_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2653706_2654291_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2654406_2654511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2654699_2654912_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2655079_2655358_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2655359_2656409_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2656421_2656781_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2656777_2657467_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2658103_2658532_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_064234946.1|2659010_2660861_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024180155.1|2661300_2661516_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2661520_2661865_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2661915_2662449_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2662719_2663289_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2663288_2663435_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2663662_2663848_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2664272_2664500_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2664541_2664907_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2665197_2665761_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2665757_2667419_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2667482_2669420_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2669464_2669686_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106378527.1|2669631_2671971_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2672050_2672377_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2672386_2672737_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2672733_2673180_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2673176_2673521_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2673579_2674296_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2674301_2674676_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2674771_2674981_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|2675033_2678276_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807956.1|2678268_2678610_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	1.5e-62
WP_001179509.1|2678609_2679047_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_064234950.1|2679234_2682495_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2682497_2682713_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2682780_2683380_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234952.1|2683444_2684659_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.5	3.9e-81
WP_001023362.1|2684660_2684930_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2686106_2686757_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2687339_2688878_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2688927_2689275_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2689271_2689652_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2690614_2690929_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2691567_2692812_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2692904_2693093_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2693089_2693278_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2693842_2694052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2694052_2694691_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2694702_2694855_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2695147_2695486_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2695877_2696120_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2696103_2696529_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2696597_2697641_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2697633_2698095_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2698128_2698845_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2698877_2699159_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2699155_2699383_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2699375_2699687_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2699814_2700033_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2700034_2700592_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2700825_2701038_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2701157_2701502_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2701623_2701896_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2701897_2702947_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2702959_2703265_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2703327_2703882_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2704106_2704304_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2704439_2705153_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2705603_2706035_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2706512_2708363_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2708802_2709018_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2709022_2709367_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2709417_2709951_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2710221_2710791_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2710790_2710937_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2711159_2711345_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2711870_2712185_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2712266_2712491_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2712877_2713423_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2713397_2715323_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2715319_2715526_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2715522_2717124_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2717104_2718424_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2718433_2718766_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2718821_2719847_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2719888_2720287_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2720298_2720652_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2720666_2721200_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2721196_2721592_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2721599_2722352_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2722365_2722788_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2722814_2723228_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2723208_2725821_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2725817_2726147_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|2726146_2726845_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|2726855_2727599_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_071601640.1|2727544_2728174_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_064234939.1|2728414_2731894_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|2731961_2732561_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_046671432.1|2732625_2733939_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2733940_2734210_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2734323_2734899_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2734971_2735601_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2735682_2736324_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2736485_2736800_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2736859_2738143_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2738231_2739692_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2739727_2739931_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3009221	3069936	5509528	terminase,integrase,protease,portal,holin,tail	Escherichia_phage(34.62%)	74	3056897:3056910	3070995:3071008
WP_000422055.1|3009221_3010271_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3010490_3011249_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3011245_3011836_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3011875_3012748_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3012960_3014544_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3014571_3015192_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3015188_3016070_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3016207_3016252_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3016343_3017906_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3017905_3019501_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001417165.1|3019504_3020863_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|3020874_3022068_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3022067_3022874_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3023254_3023434_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3023519_3024020_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3024065_3024572_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|3025061_3025232_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_064234959.1|3025609_3026200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101703.1|3027333_3027603_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_064234961.1|3027604_3028918_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230409.1|3028982_3029582_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	3.0e-111
WP_064234962.1|3029648_3033047_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	87.1	0.0e+00
WP_122996286.1|3033293_3033926_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3033871_3034615_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3034620_3035319_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3035318_3035648_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_064234964.1|3035644_3038290_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000533448.1|3038333_3038642_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	3.9e-54
WP_000479046.1|3038668_3039091_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3039104_3039857_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3039864_3040263_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3040275_3040899_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281347.1|3040901_3041183_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|3041175_3041502_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3041589_3043614_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974568.1|3043558_3045061_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3045060_3045273_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3045269_3047393_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|3047389_3047866_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3048341_3048527_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|3049045_3049579_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|3049615_3050173_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|3050176_3050392_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3050469_3050715_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3050755_3050935_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142977.1|3051069_3053016_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
WP_000483509.1|3053610_3054669_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|3054819_3055017_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|3055243_3056065_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|3056061_3056436_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|3056448_3057498_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
3056897:3056910	attL	TCACGGTATACGGA	NA	NA	NA	NA
WP_012779355.1|3057499_3057778_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001217394.1|3057847_3058105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|3058325_3058538_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3058726_3058831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|3058946_3059309_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|3059305_3059677_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|3059712_3059925_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|3059973_3060330_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|3060386_3060782_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|3060797_3061568_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_157837342.1|3061602_3062145_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020570.1|3062056_3063097_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|3063068_3063620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3063603_3063831_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3063908_3064316_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|3064505_3064661_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|3064820_3065039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|3065042_3065207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3065604_3065793_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3065789_3065978_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|3066070_3068515_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|3068579_3068828_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|3068805_3069936_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
3070995:3071008	attR	TCCGTATACCGTGA	NA	NA	NA	NA
>prophage 11
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3116632	3174834	5509528	tail,transposase,protease,tRNA	Escherichia_phage(23.08%)	55	NA	NA
WP_001299679.1|3116632_3117889_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3118102_3118726_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3118725_3119577_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3119727_3120675_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3120799_3122479_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3122533_3122812_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3123089_3123674_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3123790_3124882_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3125725_3128611_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001205408.1|3128710_3130639_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3130857_3131928_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3131938_3132571_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_064234967.1|3132581_3134000_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001417816.1|3134303_3134582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|3134546_3136004_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|3136031_3136232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3136339_3137362_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3137361_3138342_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3138338_3139097_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|3139106_3139751_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576838.1|3139915_3140770_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3140795_3142766_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3142815_3143070_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3143270_3143867_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_162829200.1|3143918_3145131_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3145319_3145931_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3146030_3146945_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3147040_3148777_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3148879_3148969_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_162829348.1|3148934_3150148_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3150485_3151556_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3151565_3152864_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3153226_3154759_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3154810_3155530_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3155751_3157293_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3157438_3157969_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3158014_3159283_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3159282_3159702_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000807626.1|3161191_3161653_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3161729_3162389_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3162460_3162754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|3162765_3162924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3162994_3163396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3163498_3163867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3164386_3165082_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3165105_3165918_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3165921_3166188_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_071782024.1|3166559_3167453_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|3167490_3168703_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001201843.1|3169270_3170224_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3170410_3171895_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3172197_3173736_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3173785_3174133_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3174129_3174510_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3174585_3174834_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 12
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3178389	3225074	5509528	terminase,lysis,integrase,head,tRNA,portal,holin,tail,capsid	Enterobacteria_phage(58.14%)	55	3195641:3195656	3223895:3223910
WP_000885630.1|3178389_3178971_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3178970_3181886_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3181950_3182550_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3182616_3186015_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3186075_3186708_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3186644_3187388_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3187393_3188092_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_064234969.1|3188091_3188421_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.6e-58
WP_000840323.1|3188417_3190967_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3190959_3191394_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3191375_3191798_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3191813_3192554_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683120.1|3192561_3192957_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000752995.1|3193542_3193896_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3193907_3194306_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3194347_3195373_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3195428_3195761_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3195641:3195656	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3195770_3197090_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3197070_3198672_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3198668_3198875_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3198871_3200797_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3200771_3201317_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3201705_3201900_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3202064_3202271_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3202556_3202967_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3203258_3203552_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3203642_3203825_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3204041_3204518_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3204504_3204810_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3205131_3205821_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3205817_3205958_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3205954_3206317_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3206313_3206604_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3206596_3206767_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3206766_3207222_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3207723_3209250_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3209307_3209430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3209494_3209827_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3209894_3210197_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3210193_3210895_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3211819_3212056_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3212045_3213188_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3213301_3214552_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3214723_3215377_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3215386_3215848_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3215901_3217008_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3217043_3217685_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3217688_3219059_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3219227_3219899_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3219898_3221359_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3221959_3222241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3222496_3223039_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3223244_3223658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3223670_3224006_-|head	head decoration protein	head	NA	NA	NA	NA
3223895:3223910	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3224018_3225074_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 13
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3231166	3288340	5509528	terminase,integrase,head,portal,holin,tail,capsid	Stx2-converting_phage(26.32%)	72	3273907:3273927	3294997:3295017
WP_000085256.1|3231166_3232396_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3232644_3233766_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3233814_3235041_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3235290_3236427_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3236410_3237274_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3237637_3238999_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3239059_3239335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3239414_3239540_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3241643_3245045_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3245635_3247984_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3248003_3248093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3248105_3248342_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3248287_3249025_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3249078_3249957_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3250259_3250370_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3250479_3250734_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3250750_3251449_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3251448_3251790_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234971.1|3251782_3255025_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3255077_3255287_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3255382_3255757_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3255762_3256479_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3256537_3256882_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3256878_3257325_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3257321_3257672_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3257681_3258008_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_106378527.1|3258087_3260427_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_001063099.1|3260372_3260594_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3260638_3262576_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3262639_3264301_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3264297_3264861_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3265151_3265517_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_032173704.1|3265558_3265744_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000347013.1|3265873_3266014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3266370_3266595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3266659_3266866_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3267093_3267240_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3267239_3267809_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3268079_3268613_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3268663_3269008_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3269012_3269228_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3269303_3269573_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3269610_3269793_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3269940_3271878_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3272192_3272360_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3272956_3273778_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3273774_3274149_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3273907:3273927	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3274161_3275211_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3275212_3275491_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3275658_3275871_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3276059_3276164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3276279_3276867_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3276869_3277061_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3277062_3277500_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3277486_3277804_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3277757_3278075_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3278064_3278367_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3278363_3278645_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3278677_3279394_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3279427_3279970_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3279881_3280919_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3280987_3281413_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3281396_3281720_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3281844_3282321_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3282636_3282789_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3282903_3283419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3283551_3283941_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3284002_3284272_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3284240_3285359_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3285525_3286320_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3286316_3287363_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3287518_3288340_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3294997:3295017	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3393827	3450796	5509528	transposase,protease	Escherichia_phage(26.32%)	58	NA	NA
WP_165438806.1|3393827_3395040_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.4e-168
WP_001287881.1|3395634_3395826_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3395878_3396112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3396207_3396831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3396919_3397429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3397886_3398345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3399698_3400823_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3401552_3401750_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3401815_3402031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053921109.1|3402314_3402623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3402606_3403820_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001299815.1|3403988_3404168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3404219_3404414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3405194_3405530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3406162_3406381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3407833_3409924_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3410437_3410824_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3411246_3411822_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3411890_3412469_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3412517_3413558_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3413580_3414036_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3414058_3415216_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3415215_3415797_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3416119_3417178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3417187_3418330_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3418322_3419096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3419097_3420177_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3420176_3421133_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3421143_3422352_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3422369_3422837_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3423097_3423427_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3423413_3423755_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3424697_3426311_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3426341_3426692_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3426688_3427114_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3429451_3430123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3430994_3431135_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3431436_3431700_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3432911_3433529_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3433540_3434215_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3434215_3434680_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3434689_3436393_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3436385_3436706_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3436714_3437017_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3437107_3437806_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3438186_3438462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3438686_3440306_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3440398_3440758_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3441443_3441734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3441757_3442009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3442116_3443330_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_064759902.1|3443381_3443975_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_032210650.1|3444021_3444876_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_001171540.1|3445366_3445747_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3445743_3446091_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3446140_3447679_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000136079.1|3448097_3448274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3448435_3450796_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
>prophage 15
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3551421	3606905	5509528	terminase,integrase,head,protease,portal,holin,transposase,tail	Enterobacteria_phage(28.26%)	66	3553356:3553371	3608670:3608685
WP_000003653.1|3551421_3552009_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3552005_3552713_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3552731_3554525_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3553356:3553371	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3554521_3555640_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3557772_3558042_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3558043_3559357_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230508.1|3559421_3560021_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_149025607.1|3560088_3562434_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_072618954.1|3562385_3563561_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_000649829.1|3563694_3564222_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_162779756.1|3564412_3565045_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.9e-101
WP_054191786.1|3564990_3565734_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_001151105.1|3565744_3566443_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3566442_3566772_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032106087.1|3566768_3569348_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000533402.1|3569328_3569742_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3569768_3570200_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3570213_3570954_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3570935_3571202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3571259_3571607_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3571643_3573149_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3573138_3574731_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3574727_3574934_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3574917_3576846_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3576817_3577060_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3577109_3578648_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3578697_3579045_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3579041_3579422_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3579497_3579773_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3580523_3580730_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3580985_3581258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3581417_3581951_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3582171_3582285_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3582506_3582692_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3583219_3583534_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3583738_3584952_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3585127_3586978_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3587745_3588459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3588553_3588793_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3589079_3589898_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3590049_3590421_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3590410_3590782_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3590794_3591844_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3591845_3592124_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3592291_3592504_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3592548_3592686_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3593051_3593825_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3594176_3594590_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3594605_3595376_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3595397_3596144_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3596150_3597242_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3597320_3597776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3597982_3598408_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3598391_3598664_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3598772_3599174_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3599201_3599393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3599392_3599680_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3599957_3600113_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3600254_3600644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3600830_3601016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3601589_3601778_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3601774_3601966_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3602059_3604531_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3604598_3604841_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3604818_3605838_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3606245_3606905_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3608670:3608685	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 16
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	3897153	3939193	5509528	terminase,lysis,integrase,protease,portal,holin,transposase,tail	Enterobacteria_phage(50.0%)	51	3896738:3896752	3939267:3939281
3896738:3896752	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3897153_3897852_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3898082_3898964_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3899132_3899294_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3899790_3900810_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3900843_3901824_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3902000_3902270_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_162829202.1|3903077_3904290_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001233141.1|3904960_3905560_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3905630_3909044_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3909104_3909713_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3909649_3910393_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3910398_3911097_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3911106_3911436_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001417032.1|3911435_3912317_-|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	94.9	1.2e-137
WP_162829202.1|3912300_3913514_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001161009.1|3915785_3916115_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3916123_3916510_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3916570_3917314_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3917324_3917726_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3917722_3918301_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3918312_3918588_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3918580_3918904_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3918990_3921018_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3920962_3921298_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_072187152.1|3921419_3922544_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_001072975.1|3922471_3922684_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3922680_3924783_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3924782_3925274_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3925948_3926101_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3926088_3926556_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3926552_3927050_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3927049_3927265_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3927407_3927806_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3927886_3928045_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3928130_3928874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3929361_3930575_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032160865.1|3931075_3931198_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3931535_3932495_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3932706_3933372_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3933368_3933989_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3933981_3934152_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3934148_3934331_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3935028_3935709_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3935705_3935888_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3935860_3936052_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3936062_3936344_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3936442_3936664_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3936874_3937477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3937719_3937887_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3937926_3938145_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3938122_3939193_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3939267:3939281	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 17
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	4450948	4499759	5509528	holin,transposase,plate	Escherichia_phage(18.18%)	44	NA	NA
WP_000131044.1|4450948_4452982_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|4453110_4453698_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|4453711_4455184_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159114.1|4455197_4456886_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
WP_001356433.1|4457565_4457700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301820.1|4458816_4458954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303994.1|4459045_4459630_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|4460163_4461376_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4461703_4461949_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4463018_4464272_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4464283_4465387_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4465674_4466730_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4466768_4467170_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4467227_4468472_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4468563_4469022_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4469282_4470740_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4470796_4471333_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4471265_4471532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4471838_4472291_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4472300_4472699_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4472701_4472995_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4473046_4474102_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4474172_4474958_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4474902_4476642_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4477459_4478233_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4478418_4478679_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4478697_4478958_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4479113_4479854_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4479824_4480592_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4480696_4481275_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4481514_4483959_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4484001_4484475_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4484628_4485399_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4485516_4486689_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4486769_4486955_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4486869_4487133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053920115.1|4487334_4491558_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4491633_4493775_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4493984_4494503_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4495199_4495700_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4495734_4495959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4496009_4497401_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4497491_4497905_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4497908_4499759_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 18
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	4942124	5001135	5509528	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4942124_4943477_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4943570_4944122_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4944277_4945651_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4945826_4946825_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4946857_4947853_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4947839_4948862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4948875_4950378_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4950517_4951474_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4951783_4952314_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4952393_4952744_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4952737_4952989_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4953200_4953542_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4953544_4957324_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4957320_4959054_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4959259_4959898_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4960220_4961564_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4961642_4961849_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4962173_4962728_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4962790_4963729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4963940_4964681_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4964870_4966814_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4966931_4967312_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4967400_4968261_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4968368_4969334_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4969441_4970104_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4970148_4971561_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4971869_4972490_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4972707_4973346_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4973480_4974689_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4974696_4975128_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4975750_4976545_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4976615_4977065_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4977106_4977334_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4977338_4977653_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4977659_4978055_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4978381_4978657_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4978785_4979472_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4979471_4980326_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4980335_4980986_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4980999_4981464_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4981473_4981779_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4981794_4983192_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4984718_4985474_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569692.1|4985470_4986220_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4986401_4986731_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4986879_4987155_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_053920121.1|4987271_4988897_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4988980_4990144_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4990146_4990785_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4990794_4991193_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4991210_4991870_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4991920_4992619_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4992637_4993039_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4993165_4993897_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4994077_4996519_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4996557_4996983_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4997187_4998486_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4998589_4998787_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4998868_4999873_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4999875_5001135_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 19
NZ_CP015832	Escherichia coli O157 strain 180-PT54 chromosome, complete genome	5509528	5138014	5152679	5509528	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5133855:5133870	5151384:5151399
5133855:5133870	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5138014_5139430_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5139512_5140496_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5140661_5140904_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5141037_5142075_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5142163_5143261_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217542.1|5143322_5143571_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143817.1|5143731_5144373_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_072140863.1|5144454_5145084_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5145156_5145729_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5145840_5146110_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_064234994.1|5146111_5147425_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001230302.1|5147489_5148089_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_000008211.1|5149410_5149947_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5149937_5150288_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5150284_5150569_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5150904_5151102_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5151446_5151728_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5151384:5151399	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5151775_5151949_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5152145_5152679_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
