The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015641	Pseudomonas stutzeri strain 273, complete genome	5030940	1961215	2013899	5030940	protease,plate,tRNA	uncultured_Mediterranean_phage(25.0%)	46	NA	NA
WP_064481249.1|1961215_1961653_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_064481250.1|1961674_1962094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481251.1|1962195_1962903_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_064481252.1|1962899_1963703_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	1.3e-29
WP_045422528.1|1963699_1964089_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_045422526.1|1964095_1964326_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_045422524.1|1964350_1964683_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_045422522.1|1964675_1965071_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_046163545.1|1965120_1966731_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.0	1.5e-32
WP_045422519.1|1966727_1967351_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_045422518.1|1967350_1968121_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_045422516.1|1968403_1968778_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_064481253.1|1968831_1970178_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.0	2.2e-45
WP_045431382.1|1970206_1970743_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_064481254.1|1970948_1971410_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_064481255.1|1971408_1971849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481256.1|1971878_1973312_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_046163551.1|1973308_1974391_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.3	4.8e-06
WP_064481257.1|1974558_1975191_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_064481258.1|1975187_1975715_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_045422502.1|1975899_1977306_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_064481259.1|1977652_1979107_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_045422498.1|1979275_1981096_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_045422494.1|1981724_1982888_-	catalase family protein	NA	NA	NA	NA	NA
WP_064481261.1|1982915_1984787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155737928.1|1985249_1985687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481262.1|1985679_1988013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481263.1|1988063_1990112_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.5	4.8e-39
WP_064482731.1|1990132_1991110_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	29.9	2.6e-11
WP_064481264.1|1991118_1991856_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_064481265.1|1991855_1995395_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_046163588.1|1995410_1996283_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_064481266.1|1996288_1997620_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_064481267.1|1997623_1998103_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_064481268.1|1998108_1999302_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_045422479.1|1999322_1999457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064482732.1|2000054_2001596_-	lipase family protein	NA	NA	NA	NA	NA
WP_045422477.1|2002226_2002976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081262859.1|2003006_2003300_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_045422475.1|2003351_2004197_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_064481269.1|2004193_2006269_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.1	2.0e-37
WP_045422471.1|2006284_2007793_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_064481270.1|2007803_2010407_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.7	4.9e-89
WP_045422468.1|2010418_2011426_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045422466.1|2011389_2013180_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_045422464.1|2013494_2013899_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP015641	Pseudomonas stutzeri strain 273, complete genome	5030940	2204439	2256673	5030940	integrase,transposase	Burkholderia_phage(33.33%)	45	2221563:2221576	2259118:2259131
WP_085987873.1|2204439_2205417_-|transposase	IS5-like element ISPsp6 family transposase	transposase	E5E3P6	Burkholderia_phage	58.9	8.2e-98
WP_045428515.1|2206614_2208054_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_008928738.1|2208348_2209107_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_064481342.1|2209252_2210149_-	cation transporter	NA	NA	NA	NA	NA
WP_008175821.1|2210247_2210682_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023294894.1|2211318_2211690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041109317.1|2211906_2214009_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003291638.1|2214533_2215964_+|transposase	IS1182-like element ISPmo1 family transposase	transposase	NA	NA	NA	NA
WP_045431009.1|2216182_2216803_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	42.9	4.7e-06
WP_045432266.1|2217008_2217440_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_045431008.1|2217453_2218914_+	YncE family protein	NA	NA	NA	NA	NA
WP_045431005.1|2219095_2219431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045431003.1|2220110_2221058_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045430999.1|2221157_2222156_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
2221563:2221576	attL	CTGGCGACCGAAGC	NA	NA	NA	NA
WP_045430997.1|2222432_2223446_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_045430994.1|2223445_2224093_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_045430988.1|2225271_2225784_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_045430986.1|2225944_2226352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081262955.1|2226469_2226691_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_045432263.1|2226950_2228213_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144399317.1|2228616_2230221_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_052649222.1|2232176_2233013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045430974.1|2233113_2233557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045430973.1|2233598_2233844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052649221.1|2234265_2235828_-	hypothetical protein	NA	H2DE57	Erwinia_phage	41.8	3.3e-93
WP_081262869.1|2236058_2237651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085987873.1|2237691_2238669_+|transposase	IS5-like element ISPsp6 family transposase	transposase	E5E3P6	Burkholderia_phage	58.9	8.2e-98
WP_045430968.1|2239288_2239987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081262870.1|2240282_2240618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045430965.1|2240646_2241606_+	30S ribosomal protein S6 modification protein RimK	NA	S5VKI3	Leptospira_phage	36.7	4.0e-49
WP_045430964.1|2241593_2242256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057380861.1|2244057_2245593_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.6	3.5e-119
WP_041013622.1|2245654_2245990_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041015591.1|2245986_2246304_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_155737968.1|2246523_2247345_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_052649220.1|2247572_2248079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399294.1|2248563_2248854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045430960.1|2248979_2249426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045430958.1|2249511_2249793_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045430956.1|2250133_2251141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045430953.1|2251226_2251580_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_045430948.1|2251822_2252452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081262871.1|2252494_2252938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399293.1|2252921_2254871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399292.1|2254963_2256673_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2259118:2259131	attR	GCTTCGGTCGCCAG	NA	NA	NA	NA
>prophage 3
NZ_CP015641	Pseudomonas stutzeri strain 273, complete genome	5030940	2811285	2859576	5030940	head,terminase,integrase	Pseudomonas_phage(56.6%)	67	2817187:2817216	2861618:2861647
WP_042926692.1|2811285_2814045_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.1	8.2e-119
WP_081262961.1|2814525_2815056_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081262886.1|2815108_2815348_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_042926690.1|2815807_2817013_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	48.2	5.5e-104
2817187:2817216	attL	TGGTGGAGCCGGGGGGATTTGAACCCCCGT	NA	NA	NA	NA
WP_064481560.1|2817279_2817615_-	hypothetical protein	NA	A0A0A7RZ35	Escherichia_virus	48.4	1.1e-06
WP_064481561.1|2817589_2818783_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	56.0	9.0e-123
WP_064481562.1|2818944_2819124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481563.1|2819120_2819402_-	hypothetical protein	NA	A0A0H5BBP9	Pseudomonas_phage	52.2	1.0e-13
WP_064481564.1|2819426_2819798_-	hypothetical protein	NA	Q8W6R0	Burkholderia_virus	45.1	5.1e-24
WP_064481566.1|2821158_2821608_-	hypothetical protein	NA	A0A0H5AU93	Pseudomonas_phage	67.1	8.5e-58
WP_064481567.1|2821604_2821973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481568.1|2822021_2822477_-	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	66.2	1.1e-49
WP_064481569.1|2822473_2823106_-	YqaJ viral recombinase family protein	NA	A0A0H5ARG7	Pseudomonas_phage	75.8	2.2e-83
WP_064481570.1|2823089_2824019_-	DNA recombinase	NA	H9C0R8	Aeromonas_phage	59.5	4.9e-68
WP_064481571.1|2824027_2825095_-	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	67.4	4.7e-38
WP_155737930.1|2825141_2825297_-	hypothetical protein	NA	A0A0H5AUB4	Pseudomonas_phage	64.0	1.0e-10
WP_155737931.1|2825293_2825806_-	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	37.3	2.6e-18
WP_064481573.1|2826013_2826469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481574.1|2826465_2826687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481575.1|2826683_2826902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481576.1|2827009_2827204_-	hypothetical protein	NA	A0A2H4J9M2	uncultured_Caudovirales_phage	48.3	5.0e-07
WP_064481577.1|2827295_2827604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481578.1|2827731_2828142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064482760.1|2828163_2828529_-	helix-turn-helix transcriptional regulator	NA	A0A0H5AUC3	Pseudomonas_phage	74.6	2.3e-45
WP_064481579.1|2828598_2828856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064482761.1|2829236_2830019_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	47.9	3.3e-57
WP_064481580.1|2830134_2830338_+	hypothetical protein	NA	A0A2H4JF66	uncultured_Caudovirales_phage	68.7	4.5e-19
WP_064481581.1|2830521_2831367_+	hypothetical protein	NA	B5WZX9	Pseudomonas_phage	54.4	1.5e-68
WP_064481582.1|2831366_2832020_+	Replication protein P	NA	W6MVG8	Pseudomonas_phage	64.3	1.0e-72
WP_064481583.1|2832016_2832208_+	hypothetical protein	NA	A0A1B0VM38	Pseudomonas_phage	70.2	6.4e-15
WP_155737932.1|2832204_2832381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481584.1|2832377_2832938_+	hypothetical protein	NA	A0A2H4JF55	uncultured_Caudovirales_phage	49.2	1.2e-08
WP_064481585.1|2832934_2833192_+	TraR/DksA family transcriptional regulator	NA	A0A0H5ARI0	Pseudomonas_phage	61.8	3.1e-20
WP_064481586.1|2833184_2833589_+	NinB family protein	NA	A0A059VG13	Pseudomonas_phage	58.7	5.7e-37
WP_031323507.1|2833585_2833888_+	DUF1364 family protein	NA	A0A1J0GVP4	Pseudoalteromonas_phage	45.7	5.0e-14
WP_064481587.1|2833884_2834178_+	hypothetical protein	NA	A0A0B5A6H4	Pseudomonas_phage	71.3	8.9e-32
WP_081262887.1|2834174_2834675_+	hypothetical protein	NA	A0A142IF59	Pseudomonas_phage	33.8	5.8e-15
WP_064481589.1|2834674_2835358_+	hypothetical protein	NA	A0A2D2W3E4	Mycobacterium_phage	65.4	1.5e-45
WP_064481590.1|2835354_2835576_+	hypothetical protein	NA	A0A0H5BBW0	Pseudomonas_phage	75.0	3.8e-19
WP_064481591.1|2835572_2835923_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	82.1	8.1e-48
WP_064481592.1|2835936_2837505_+	hypothetical protein	NA	A0A292GAH2	Xanthomonas_phage	38.6	1.7e-84
WP_064481593.1|2837501_2838047_+	hypothetical protein	NA	A0A0H5AWB8	Pseudomonas_phage	76.7	8.4e-76
WP_064481594.1|2838315_2838675_+	hypothetical protein	NA	A0AR14	Salmonella_phage	63.2	2.0e-33
WP_064481595.1|2838766_2839081_+	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	100.0	6.3e-52
WP_064481596.1|2839077_2839290_+	hypothetical protein	NA	A0A0H5ARQ8	Pseudomonas_phage	92.5	1.5e-28
WP_064481597.1|2839603_2840071_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	57.7	1.4e-50
WP_064481598.1|2840045_2841329_+|terminase	terminase	terminase	A0A2H4IY82	uncultured_Caudovirales_phage	84.2	6.5e-212
WP_064481599.1|2841328_2842783_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	56.5	4.9e-147
WP_064481600.1|2842739_2843807_+|head	phage head morphogenesis protein	head	A0A2H4J3G9	uncultured_Caudovirales_phage	54.4	2.8e-99
WP_064481601.1|2843844_2844573_+	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	52.7	1.5e-40
WP_064481602.1|2844584_2845586_+	hypothetical protein	NA	D2J006	Enterococcus_phage	56.5	4.5e-91
WP_155737933.1|2845626_2845833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481604.1|2845836_2846331_+	hypothetical protein	NA	A0A2H4J970	uncultured_Caudovirales_phage	66.9	2.8e-54
WP_064481605.1|2846332_2846737_+	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	46.3	1.2e-23
WP_064481606.1|2846736_2847132_+	hypothetical protein	NA	S4SIM9	Salmonella_phage	38.4	6.4e-17
WP_064481607.1|2847134_2847551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481608.1|2847611_2848778_+	hypothetical protein	NA	A0A0S0MV10	Pseudomonas_phage	33.4	7.9e-47
WP_155737934.1|2848787_2849180_+	hypothetical protein	NA	A0A1B0Z0C9	Vibrio_phage	46.2	7.0e-24
WP_064481611.1|2849545_2849731_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	54.2	1.1e-08
WP_064481612.1|2849877_2850156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481613.1|2850152_2852537_+	tape measure protein	NA	A0A059VJZ1	Pseudomonas_phage	45.9	1.6e-46
WP_064481614.1|2852533_2853055_+	hypothetical protein	NA	A0A0H5ARL4	Pseudomonas_phage	46.5	2.7e-31
WP_064481615.1|2853051_2853534_+	DUF1833 domain-containing protein	NA	A0A0H5BBZ3	Pseudomonas_phage	63.1	2.5e-55
WP_064481616.1|2853533_2853926_+	hypothetical protein	NA	A0A2H4PI57	Pseudomonas_phage	49.6	9.7e-26
WP_064481617.1|2853922_2856610_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	63.8	0.0e+00
WP_064481618.1|2856685_2859043_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	65.7	1.9e-52
WP_064481619.1|2859099_2859576_+	hypothetical protein	NA	A0A0H5BBZ5	Pseudomonas_phage	67.1	6.2e-51
2861618:2861647	attR	TGGTGGAGCCGGGGGGATTTGAACCCCCGT	NA	NA	NA	NA
>prophage 4
NZ_CP015641	Pseudomonas stutzeri strain 273, complete genome	5030940	3141908	3193246	5030940	integrase,transposase	Salmonella_phage(33.33%)	40	3190598:3190612	3199203:3199217
WP_103455382.1|3141908_3143061_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.8	2.2e-49
WP_045633706.1|3143941_3144907_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064481770.1|3145352_3147053_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_064481771.1|3148257_3149295_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_064481772.1|3150389_3151436_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_011005931.1|3151467_3152931_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011005930.1|3152958_3154068_+	Xylene monooxygenase subunit 1	NA	NA	NA	NA	NA
WP_064481773.1|3154221_3155271_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_045633711.1|3155466_3156567_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	24.4	3.4e-07
WP_064481774.1|3156679_3158077_+	aromatic hydrocarbon degradation protein	NA	NA	NA	NA	NA
WP_064481775.1|3158481_3158835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081262894.1|3160498_3160834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064481777.1|3160762_3160978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045633952.1|3161297_3161669_+	raqprd family integrative conjugative element protein	NA	NA	NA	NA	NA
WP_003294214.1|3161665_3161905_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_045633951.1|3161927_3162296_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_045633950.1|3162308_3162719_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_064481778.1|3162715_3163408_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_064481779.1|3163404_3164313_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_064481780.1|3164309_3165740_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003294221.1|3165720_3166155_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_064481781.1|3166154_3169043_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_064481782.1|3169993_3170488_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_064481783.1|3170655_3171105_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_064481784.1|3171101_3172046_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_064481785.1|3172056_3173463_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_064481786.1|3173459_3173813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064481787.1|3173828_3175349_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_064481788.1|3175375_3175744_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_064481789.1|3175967_3176726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014819614.1|3176718_3177639_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_064481790.1|3177845_3179666_+	relaxase	NA	NA	NA	NA	NA
WP_064482771.1|3179972_3180161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155737936.1|3180066_3180837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_064481791.1|3181658_3184625_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.3	0.0e+00
WP_051497089.1|3184628_3185201_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.2e-59
WP_011078029.1|3185426_3187085_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_011078030.1|3187252_3188503_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.2e-47
WP_009397186.1|3189661_3191092_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
3190598:3190612	attL	GCGGTTGCCGCCCGC	NA	NA	NA	NA
WP_064481792.1|3191392_3193246_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	6.5e-104
WP_064481792.1|3191392_3193246_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	6.5e-104
3199203:3199217	attR	GCGGGCGGCAACCGC	NA	NA	NA	NA
>prophage 5
NZ_CP015641	Pseudomonas stutzeri strain 273, complete genome	5030940	4616103	4626183	5030940	tRNA	uncultured_Caudovirales_phage(66.67%)	12	NA	NA
WP_046163639.1|4616103_4617132_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	4.8e-16
WP_064482479.1|4617121_4618129_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	5.8e-22
WP_046163637.1|4618275_4618548_-	DUF1652 domain-containing protein	NA	NA	NA	NA	NA
WP_045426571.1|4619112_4619781_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	77.6	4.9e-86
WP_081262935.1|4619869_4620262_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	73.6	1.3e-49
WP_064482481.1|4620261_4620621_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	8.9e-34
WP_064482482.1|4620620_4620923_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	53.0	5.6e-21
WP_064482483.1|4620919_4621255_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	72.1	9.1e-41
WP_064482484.1|4621251_4622232_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	76.1	4.2e-142
WP_064482485.1|4622316_4623315_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_064482486.1|4623345_4624743_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_064482487.1|4624902_4626183_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	3.9e-100
