The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	373208	445076	3794139	tRNA,coat,protease,transposase	Bacillus_phage(22.22%)	54	NA	NA
WP_002581975.1|373208_374792_-|transposase	IS1182-like element ISClbu1 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
WP_002582780.1|375074_376424_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003429873.1|376429_376876_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_003429871.1|377094_379512_+	triple tyrosine motif-containing protein	NA	NA	NA	NA	NA
WP_058141692.1|379566_380394_+	lytic transglycosylase domain-containing protein	NA	A0A0H4TGB4	Bacillus_phage	41.1	6.6e-24
WP_024038780.1|380635_381352_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_058141693.1|381945_385299_+	intein-containing ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	26.1	3.4e-87
WP_058141694.1|385474_387466_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.9	9.5e-85
WP_024038777.1|387470_387743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410901.1|388053_388344_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_058141695.1|388365_389823_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002582790.1|389842_391273_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002582791.1|391327_391630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024038775.1|391833_393321_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058141696.1|393376_395119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141697.1|395213_396191_+	AIR synthase	NA	NA	NA	NA	NA
WP_058141698.1|396262_396877_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.1	4.2e-07
WP_002582796.1|396899_397385_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002582797.1|399317_400187_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002582798.1|400383_401271_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058141699.1|401283_402171_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_058141700.1|402181_404341_+	1,3-beta-galactosyl-N-acetylhexosamine phosphorylase	NA	NA	NA	NA	NA
WP_058141701.1|404599_405946_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035764899.1|406009_406966_+	ATPase	NA	NA	NA	NA	NA
WP_058141702.1|407000_408140_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002582805.1|408443_408920_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_002582806.1|408951_409722_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002582807.1|409711_410557_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002582808.1|410692_411439_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058141703.1|411540_412701_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002582810.1|412719_413151_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582811.1|413196_414051_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_002582812.1|415987_418033_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.8	1.7e-84
WP_002582338.1|423562_424510_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_002582337.1|424813_425299_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002582336.1|425303_426137_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_002582335.1|426527_427907_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_043853366.1|427909_429253_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_002582333.1|429342_430134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033127208.1|430256_431216_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_002582331.1|431255_431819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035764760.1|431836_432469_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002582329.1|432838_433858_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.6	2.5e-65
WP_043853365.1|433866_434871_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002582327.1|434985_436212_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	2.0e-21
WP_003412645.1|436347_436665_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582325.1|436744_437104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043853364.1|437225_438368_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002582323.1|438437_439562_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035764142.1|439709_440726_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_080630488.1|440697_441474_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003429682.1|441653_442688_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582319.1|442847_443969_-	glycosyltransferase family 4 protein	NA	A0A2K9VGK0	Pontimonas_phage	40.3	5.0e-06
WP_002582318.1|444077_445076_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	1200405	1210496	3794139		Prochlorococcus_phage(42.86%)	7	NA	NA
WP_058141824.1|1200405_1204152_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.2e-32
WP_002579500.1|1204408_1204888_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	1.3e-27
WP_002579501.1|1204887_1205595_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	44.8	2.1e-47
WP_002579502.1|1205702_1207115_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.8	1.1e-55
WP_035762527.1|1207206_1208211_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.4	1.5e-67
WP_058141825.1|1208198_1208807_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	37.5	3.7e-24
WP_002579505.1|1208987_1210496_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	1.8e-35
>prophage 3
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	2601328	2608681	3794139	integrase	Brevibacillus_phage(14.29%)	10	2590871:2590886	2612151:2612166
2590871:2590886	attL	AATAATTTGTAAAAAT	NA	NA	NA	NA
WP_058142182.1|2601328_2602045_-	hypothetical protein	NA	S5MP04	Brevibacillus_phage	42.1	6.8e-25
WP_002580419.1|2602066_2602306_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	44.6	1.8e-11
WP_058146877.1|2602360_2603008_-	AAA family ATPase	NA	Q0H276	Geobacillus_phage	40.7	3.6e-33
WP_058142183.1|2603036_2604149_-	DnaD domain protein	NA	V5UQV4	Oenococcus_phage	43.4	8.3e-22
WP_081256853.1|2604318_2604483_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058142184.1|2604514_2604724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058142185.1|2604742_2604970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058142186.1|2605129_2605804_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	38.3	1.0e-06
WP_058142187.1|2605868_2607047_+|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	27.3	9.8e-21
WP_081256854.1|2607073_2608681_-	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	23.1	3.9e-12
2612151:2612166	attR	ATTTTTACAAATTATT	NA	NA	NA	NA
>prophage 4
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	2692609	2759863	3794139	integrase,terminase,portal,protease,transposase,tRNA,holin,tail,capsid	Clostridium_phage(24.39%)	86	2713053:2713069	2765383:2765399
WP_035761361.1|2692609_2694283_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	23.8	3.0e-07
WP_002580912.1|2694470_2695760_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.2	1.0e-143
WP_002580913.1|2695802_2696408_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.7	2.2e-53
WP_002580914.1|2696568_2697852_-	trigger factor	NA	NA	NA	NA	NA
WP_002580915.1|2697938_2698754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580916.1|2698849_2699044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064062197.1|2699450_2700626_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A0F7LAY0	uncultured_marine_virus	25.2	1.0e-25
WP_002580918.1|2700823_2701150_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_002580919.1|2701183_2701513_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_002580920.1|2701541_2702303_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_002580921.1|2702352_2703069_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_002580922.1|2703065_2703686_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_002580923.1|2703713_2704301_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_002580924.1|2704323_2705361_-	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	24.1	9.8e-17
WP_003425009.1|2705347_2706646_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_002580926.1|2706826_2707456_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003407320.1|2707500_2708634_-	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1V0SLE3	Klosneuvirus	25.8	1.1e-16
WP_002580928.1|2708985_2709624_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_002580929.1|2709658_2710816_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003425005.1|2710815_2711964_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.1	6.6e-30
WP_058142210.1|2712203_2713064_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	24.6	5.1e-19
2713053:2713069	attL	TATTTTTTTCATTATTA	NA	NA	NA	NA
WP_002580932.1|2713079_2714174_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_002580933.1|2714442_2715240_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_058142211.1|2715327_2716272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003426559.1|2716506_2717709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002580935.1|2718079_2719027_-	N-acetylmuramoyl-L-alanine amidase	NA	Q24LG3	Clostridium_phage	37.8	3.4e-16
WP_002580936.1|2719081_2719330_-|holin	holin	holin	A0A0A7RW97	Clostridium_phage	51.9	3.2e-14
WP_002580937.1|2719331_2719616_-	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	54.9	2.0e-20
WP_058142212.1|2719678_2720683_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	27.9	5.2e-15
WP_058142213.1|2720938_2721976_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_058142214.1|2722076_2724440_-	hypothetical protein	NA	M1I7I9	Paramecium_bursaria_Chlorella_virus	38.7	2.4e-18
WP_002580942.1|2724453_2724666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580943.1|2724658_2724976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580944.1|2724989_2726387_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	56.6	5.2e-45
WP_002580945.1|2726379_2727225_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	34.2	1.4e-24
WP_125390900.1|2727224_2728373_-	hypothetical protein	NA	A0A059WFM2	Vibrio_phage	31.8	6.8e-51
WP_002580947.1|2728368_2728686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580948.1|2728691_2729249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580949.1|2729248_2729491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125390901.1|2729490_2730399_-	hypothetical protein	NA	H7BVZ1	unidentified_phage	30.4	1.3e-28
WP_064062198.1|2730407_2730641_-	hypothetical protein	NA	A0A2K9V2S8	Faecalibacterium_phage	43.8	1.9e-08
WP_058142215.1|2730612_2732811_-	hypothetical protein	NA	A0A218KCH0	Bacillus_phage	46.5	4.5e-43
WP_002580953.1|2732976_2733315_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002580954.1|2733372_2733903_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	35.3	6.3e-20
WP_058142216.1|2733903_2735340_-	hypothetical protein	NA	H7BVZ4	unidentified_phage	36.4	2.9e-75
WP_002580956.1|2735352_2735871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058142217.1|2735872_2736451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580958.1|2736450_2736765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035778953.1|2736751_2737015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146399.1|2736990_2738037_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	41.7	1.6e-78
WP_058146400.1|2738059_2738413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146402.1|2738412_2739624_-|protease	Clp protease ClpP	protease	A0A0E3Y6E9	Fusobacterium_phage	30.5	3.1e-30
WP_058146404.1|2739583_2741134_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	59.3	2.2e-169
WP_002580964.1|2741144_2741378_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	48.0	5.1e-14
WP_058146406.1|2741426_2743253_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	50.3	2.7e-171
WP_058146409.1|2743224_2743806_-	hypothetical protein	NA	A0A2K9V441	Faecalibacterium_phage	30.7	1.3e-13
WP_058146411.1|2743883_2744621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580968.1|2744805_2745375_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.5	4.4e-43
WP_058146878.1|2745371_2745596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580970.1|2745627_2746026_-	hypothetical protein	NA	M9Q1J7	Clostridium_phage	37.9	1.6e-12
WP_002580971.1|2746199_2746529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580972.1|2746648_2746882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580973.1|2746919_2747336_-	hypothetical protein	NA	A0A141DZP9	Streptococcus_phage	39.0	1.8e-09
WP_002580974.1|2747449_2747692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146879.1|2747917_2748223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146413.1|2748348_2748639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146415.1|2748943_2749126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146417.1|2749125_2749380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580979.1|2749446_2749578_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_002580980.1|2749595_2749784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580981.1|2749893_2750082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058146420.1|2750096_2750252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580983.1|2750244_2750580_-	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	37.6	5.2e-12
WP_002580984.1|2750566_2751415_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	52.5	3.4e-60
WP_058146421.1|2751431_2752559_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_002580986.1|2752543_2753299_-	ParA family protein	NA	H7BUL8	unidentified_phage	31.0	1.7e-26
WP_002580988.1|2753510_2753696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580989.1|2753706_2753883_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	66.7	3.8e-14
WP_002580990.1|2753901_2754336_-	helix-turn-helix transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	49.0	3.2e-30
WP_002580991.1|2754473_2754671_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	52.5	7.1e-09
WP_002580992.1|2754822_2755167_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	62.3	8.8e-31
WP_002580993.1|2755516_2756086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580994.1|2756376_2757411_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	26.4	4.1e-15
WP_002580995.1|2757361_2757964_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	39.5	4.3e-33
WP_002580996.1|2758198_2758696_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2BY64	Clostridium_phage	47.9	2.0e-36
WP_058146424.1|2758813_2759863_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	67.2	6.4e-141
2765383:2765399	attR	TATTTTTTTCATTATTA	NA	NA	NA	NA
>prophage 6
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	3641548	3654020	3794139	integrase	Erysipelothrix_phage(66.67%)	7	3640362:3640388	3653382:3653408
3640362:3640388	attL	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
WP_058141620.1|3641548_3644497_-	DEAD/DEAH box helicase	NA	A0A2K5B256	Erysipelothrix_phage	47.2	1.3e-234
WP_081256859.1|3644509_3646084_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	43.6	2.5e-96
WP_058141625.1|3646714_3647473_-	DUF4391 domain-containing protein	NA	A0A2K5B2C0	Erysipelothrix_phage	23.2	1.2e-06
WP_058146856.1|3647482_3650740_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	50.9	7.3e-300
WP_058141627.1|3651904_3652084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141629.1|3652253_3653210_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.6	7.1e-38
WP_058141631.1|3653570_3654020_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	3.3e-09
3653382:3653408	attR	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
>prophage 7
NZ_CP014704	Clostridium butyricum strain TOA chromosome 1, complete sequence	3794139	3766044	3772680	3794139	protease,transposase	Faustovirus(16.67%)	7	NA	NA
WP_058141651.1|3766044_3767196_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.9	8.4e-17
WP_002582832.1|3767252_3767828_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	36.0	1.2e-19
WP_002581275.1|3768062_3769394_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.2	2.8e-24
WP_002582831.1|3769493_3770015_-	DUF4446 family protein	NA	NA	NA	NA	NA
WP_002582830.1|3770054_3770918_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.7	6.5e-14
WP_002582829.1|3770931_3771693_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.3	1.4e-20
WP_058141652.1|3771900_3772680_-	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	40.4	4.3e-17
>prophage 1
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	0	12499	795002		Clostridium_phage(100.0%)	7	NA	NA
WP_058372205.1|497_1646_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_043853784.1|1738_3247_-	xylulokinase	NA	NA	NA	NA	NA
WP_046058532.1|3420_4365_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_043853786.1|4675_5689_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_058372206.1|5758_7204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581799.1|7332_7809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372207.1|8080_12499_-	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	34.0	8.2e-28
>prophage 2
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	15842	16772	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_003430571.1|15842_16772_-	exonuclease family	NA	G3MBN3	Bacillus_virus	25.6	1.4e-14
>prophage 3
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	20374	32154	795002		Bacillus_phage(50.0%)	10	NA	NA
WP_058372211.1|20374_21793_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	1.5e-23
WP_002581791.1|21789_22479_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	2.3e-46
WP_058372212.1|22619_24566_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035765281.1|24776_25448_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.1	1.1e-40
WP_035765284.1|25450_26872_+	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	26.9	7.2e-18
WP_058372213.1|26971_27649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035764616.1|27755_28589_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	2.3e-61
WP_003411650.1|28599_29280_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_058372214.1|29347_30202_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035764587.1|30420_32154_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.2	4.3e-09
>prophage 4
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	35794	37378	795002	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_002581975.1|35794_37378_-|transposase	IS1182-like element ISClbu1 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
>prophage 5
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	47118	47319	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_002581771.1|47118_47319_-	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	42.6	7.4e-06
>prophage 6
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	54103	61162	795002		Orpheovirus(20.0%)	8	NA	NA
WP_002581765.1|54103_54967_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	28.5	3.2e-21
WP_043853805.1|55027_55573_-	glutathione peroxidase	NA	A0A0M5HSM9	Turkeypox_virus	31.2	7.0e-14
WP_002581763.1|55628_56105_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	42.7	1.8e-29
WP_002581762.1|56723_57038_-	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002581761.1|57039_57786_-	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_058372218.1|58355_59198_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	6.1e-17
WP_033128234.1|59207_59978_-	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_003430651.1|60238_61162_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	1.6e-23
>prophage 7
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	68957	69932	795002		Clostridium_phage(100.0%)	1	NA	NA
WP_003430828.1|68957_69932_-	AAA family ATPase	NA	J9QE36	Clostridium_phage	26.9	1.6e-13
>prophage 8
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	75730	77641	795002	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_002581748.1|75730_77641_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.3	2.8e-150
>prophage 9
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	81287	82988	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_002581743.1|81287_82988_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	1.1e-12
>prophage 10
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	93462	95481	795002		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_058371953.1|93462_95481_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.0	8.2e-68
>prophage 11
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	102801	114896	795002		Bacillus_phage(33.33%)	9	NA	NA
WP_002581731.1|102801_103596_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	9.2e-15
WP_002581730.1|103592_104870_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	26.1	2.1e-13
WP_002581729.1|104903_105704_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058371955.1|105813_107541_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	7.6e-38
WP_058371956.1|107545_109387_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	5.8e-44
WP_043853818.1|109482_110376_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043853819.1|110484_111645_+	MFS transporter	NA	NA	NA	NA	NA
WP_085950977.1|111979_113275_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.4	1.8e-68
WP_058371957.1|113549_114896_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	25.0	1.2e-30
>prophage 12
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	121783	124885	795002		Leptospira_phage(100.0%)	1	NA	NA
WP_058371959.1|121783_124885_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.3	6.9e-90
>prophage 13
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	131752	135611	795002		Mycobacterium_phage(33.33%)	3	NA	NA
WP_002581708.1|131752_133729_+	serine hydrolase	NA	R4JG75	Mycobacterium_phage	27.8	1.8e-06
WP_002581707.1|133747_134527_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.3e-41
WP_002581706.1|134519_135611_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.6	2.0e-15
>prophage 14
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	143262	147458	795002		Bacillus_virus(33.33%)	4	NA	NA
WP_002581697.1|143262_144771_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	2.5e-13
WP_024041319.1|144791_145724_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_058371961.1|145850_146759_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	26.5	5.6e-08
WP_003431006.1|146810_147458_+	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.7	5.5e-50
>prophage 15
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	150867	157088	795002		Escherichia_phage(33.33%)	4	NA	NA
WP_002581691.1|150867_151365_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	L7TIP4	Escherichia_phage	45.4	1.0e-35
WP_002581690.1|151499_153617_-	anaerobic ribonucleoside-triphosphate reductase	NA	K4F9T2	Cronobacter_phage	39.8	1.3e-129
WP_045145227.1|153915_154857_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003431019.1|155012_157088_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	1.8e-17
>prophage 16
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	160461	164351	795002		Staphylococcus_phage(50.0%)	3	NA	NA
WP_058371965.1|160461_161235_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	3.3e-25
WP_058371966.1|161243_162869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081044145.1|163094_164351_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	24.5	5.5e-22
>prophage 17
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	168894	175439	795002		Bacillus_phage(66.67%)	4	NA	NA
WP_058371970.1|168894_170724_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.8	1.0e-16
WP_058371971.1|170915_171770_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058371972.1|171899_173654_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	5.5e-52
WP_058371973.1|173654_175439_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.6e-51
>prophage 18
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	182012	182888	795002		Burkholderia_virus(100.0%)	1	NA	NA
WP_058371977.1|182012_182888_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.5	9.5e-05
>prophage 19
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	189684	190977	795002		Streptococcus_phage(100.0%)	1	NA	NA
WP_002581646.1|189684_190977_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	63.0	3.9e-148
>prophage 20
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	193982	195032	795002		Bacillus_phage(100.0%)	1	NA	NA
WP_002581641.1|193982_195032_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.2	1.5e-12
>prophage 21
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	211583	213047	795002		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002581624.1|211583_213047_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.9	2.5e-26
>prophage 22
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	220561	222925	795002		Klebsiella_phage(100.0%)	1	NA	NA
WP_002581613.1|220561_222925_+	glycyl radical protein	NA	A0A0K1Y4R2	Klebsiella_phage	47.2	6.8e-05
>prophage 23
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	226151	227813	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_058371991.1|226151_227813_+	FAD-binding protein	NA	G3MA85	Bacillus_virus	38.3	7.7e-56
>prophage 24
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	240601	240952	795002		Leptospira_phage(100.0%)	1	NA	NA
WP_058372002.1|240601_240952_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.1	3.4e-14
>prophage 25
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	253758	254439	795002		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_027634782.1|253758_254439_+	fructose-6-phosphate aldolase	NA	R9S7J6	Prochlorococcus_phage	34.6	1.9e-32
>prophage 26
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	262802	265185	795002		Clostridium_phage(50.0%)	2	NA	NA
WP_003413094.1|262802_263177_+	transcriptional regulator	NA	X5JAW5	Clostridium_phage	42.1	3.8e-19
WP_058372008.1|263343_265185_+	peptidase M56	NA	A0A1X9I9K5	Staphylococcus_phage	27.3	4.3e-07
>prophage 27
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	277412	284024	795002		Tetraselmis_virus(66.67%)	4	NA	NA
WP_003413287.1|277412_279665_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	2.1e-173
WP_002581580.1|279630_280425_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	31.1	2.2e-24
WP_058372011.1|280649_282881_-	flotillin family protein	NA	NA	NA	NA	NA
WP_058372012.1|283085_284024_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.8	1.6e-26
>prophage 28
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	292601	293753	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_051119377.1|292601_293753_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	7.5e-26
>prophage 29
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	312573	313113	795002		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_024041209.1|312573_313113_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	39.6	1.1e-22
>prophage 30
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	318016	318820	795002		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_024041201.1|318016_318820_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	3.0e-13
>prophage 31
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	332931	333972	795002		Enterobacteria_phage(100.0%)	1	NA	NA
WP_058372023.1|332931_333972_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.2	1.3e-13
>prophage 32
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	339040	342804	795002		Tupanvirus(50.0%)	3	NA	NA
WP_035765101.1|339040_340219_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	38.4	4.2e-56
WP_035765001.1|340524_341787_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_080646840.1|341964_342804_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	1.8e-32
>prophage 33
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	358178	358991	795002		Bacillus_virus(100.0%)	1	NA	NA
WP_035761238.1|358178_358991_-	exonuclease domain-containing protein	NA	G3MBN3	Bacillus_virus	28.9	1.2e-14
>prophage 34
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	363300	367742	795002		Hokovirus(50.0%)	4	NA	NA
WP_058372026.1|363300_365265_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-19
WP_003431833.1|365459_366077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372027.1|366323_366992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058372028.1|367022_367742_+	protein kinase	NA	A0A1V0SDQ4	Indivirus	31.6	8.6e-12
>prophage 35
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	376213	392624	795002	transposase	uncultured_virus(12.5%)	15	NA	NA
WP_033127508.1|376213_377452_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.9	3.0e-52
WP_058877166.1|377535_379062_-	DUF4317 family protein	NA	NA	NA	NA	NA
WP_002581495.1|379209_379836_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_058372032.1|380003_380507_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	32.9	2.1e-17
WP_058372033.1|380710_381376_+	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	26.9	4.8e-09
WP_003407561.1|381473_381968_-	CYTH domain-containing protein	NA	J7I4X5	Stenotrophomonas_phage	28.2	7.5e-07
WP_058372034.1|382109_383822_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.6	2.5e-17
WP_002581490.1|384143_384998_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002581489.1|385155_385959_+	gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.1e-20
WP_002581488.1|386131_386770_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_058372035.1|386866_387325_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_002581487.1|387554_387983_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058372036.1|388220_389399_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	23.6	9.5e-16
WP_003431988.1|390125_391286_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002581484.1|391442_392624_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.0	3.2e-40
>prophage 36
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	405399	411739	795002		Bacillus_phage(50.0%)	5	NA	NA
WP_002581475.1|405399_407136_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.6e-41
WP_002581474.1|407122_409024_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	5.4e-45
WP_002581473.1|409100_409970_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.5	6.1e-12
WP_002581472.1|410171_410759_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003432008.1|410899_411739_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.0	3.3e-15
>prophage 37
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	420879	422211	795002	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_002581275.1|420879_422211_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.2	2.8e-24
>prophage 38
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	426693	427638	795002		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_058372044.1|426693_427638_+	hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	33.6	9.5e-35
>prophage 39
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	431090	438280	795002		Gordonia_phage(33.33%)	6	NA	NA
WP_002581454.1|431090_432062_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	31.4	9.5e-14
WP_002581452.1|432942_433509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002581451.1|433614_433995_-	VOC family protein	NA	NA	NA	NA	NA
WP_002581450.1|434024_434519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043853637.1|434953_436963_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.0	3.6e-07
WP_043853639.1|437107_438280_-	toxic anion resistance protein	NA	A0A1L2CV51	Pectobacterium_phage	26.4	3.5e-18
>prophage 40
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	454891	458965	795002		Bacillus_phage(66.67%)	4	NA	NA
WP_043853645.1|454891_456193_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	27.8	7.7e-19
WP_002581426.1|456189_456870_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.2e-39
WP_003412512.1|456862_457420_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002581423.1|457645_458965_-	purine permease	NA	Q9KX94	Enterobacteria_phage	31.2	7.3e-33
>prophage 41
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	470974	471400	795002		Streptococcus_phage(100.0%)	1	NA	NA
WP_003432085.1|470974_471400_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	36.6	9.2e-22
>prophage 42
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	480858	481761	795002		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_058372059.1|480858_481761_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0P0YMS6	Yellowstone_lake_phycodnavirus	24.0	1.7e-09
>prophage 43
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	487131	491050	795002		Salicola_phage(50.0%)	2	NA	NA
WP_058372061.1|487131_489858_-	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	33.8	4.1e-54
WP_057088033.1|490138_491050_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.8	8.7e-09
>prophage 44
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	498128	502925	795002		Clostridioides_phage(50.0%)	4	NA	NA
WP_035762124.1|498128_498797_-	serine/threonine protein phosphatase	NA	A0A2R2ZH50	Clostridioides_phage	44.5	8.2e-49
WP_002581383.1|499084_499549_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003432588.1|499637_500915_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002581381.1|500927_502925_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.9	2.0e-05
>prophage 45
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	507493	508330	795002		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002581374.1|507493_508330_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.3	1.5e-39
>prophage 46
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	522579	524118	795002		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002581359.1|522579_524118_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	7.0e-19
>prophage 47
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	535200	535884	795002		Hokovirus(100.0%)	1	NA	NA
WP_002581343.1|535200_535884_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	30.3	2.0e-05
>prophage 48
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	540976	546900	795002		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002581337.1|540976_542755_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	5.3e-10
WP_043853709.1|542930_543791_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003432645.1|543918_544668_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.5e-30
WP_002581334.1|544827_545505_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_043853711.1|545485_546151_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002581332.1|546390_546900_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	41.7	2.9e-30
>prophage 49
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	551595	572078	795002		Acinetobacter_phage(44.44%)	15	NA	NA
WP_058372073.1|551595_552642_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SBM3	Catovirus	30.6	6.7e-13
WP_002581326.1|552796_553846_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	5.6e-28
WP_002581325.1|553997_554309_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002581324.1|554339_555680_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002581323.1|555710_556013_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_058372075.1|556072_557512_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	4.2e-50
WP_002581321.1|557564_558464_-	ROK family protein	NA	NA	NA	NA	NA
WP_058372076.1|558781_562537_-	family 16 glycosylhydrolase	NA	M1HYC6	Paramecium_bursaria_Chlorella_virus	35.7	2.2e-34
WP_035763056.1|562658_563684_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.6	7.9e-27
WP_058372077.1|564127_564349_+	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_058372078.1|564551_565496_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_058372079.1|565698_568506_-	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	27.0	7.9e-53
WP_002581314.1|568622_569486_-	hypothetical protein	NA	A0A0P0IVM8	Acinetobacter_phage	33.1	3.7e-25
WP_003432658.1|569479_569956_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.6	9.1e-18
WP_058372080.1|569948_572078_-	xanthine dehydrogenase family protein	NA	A0A0P0I429	Acinetobacter_phage	29.0	5.8e-72
>prophage 50
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	582464	588040	795002		Bacillus_phage(33.33%)	4	NA	NA
WP_058372084.1|582464_584186_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	2.7e-51
WP_035763069.1|584199_585924_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.6	5.6e-17
WP_058372085.1|586100_586901_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002581300.1|586927_588040_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.2e-25
>prophage 51
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	605826	607410	795002		Mycobacterium_phage(100.0%)	1	NA	NA
WP_058372097.1|605826_607410_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	21.7	9.1e-14
>prophage 52
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	636719	731394	795002	protease,tail,plate,transposase,portal,capsid,integrase	Clostridium_phage(31.37%)	109	688985:689002	730819:730836
WP_125390909.1|636719_637743_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058372112.1|637853_638153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064062221.1|638314_639133_-	EcsC family protein	NA	NA	NA	NA	NA
WP_058372113.1|639839_640817_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_058372114.1|640925_642236_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	30.4	1.5e-17
WP_002581243.1|642247_642958_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	37.5	3.7e-31
WP_058372115.1|643129_645724_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003413325.1|645723_646410_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.0e-33
WP_043665323.1|646493_647483_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_043665328.1|647469_648156_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058372116.1|648662_649688_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_043853920.1|650100_651099_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_125390910.1|651107_651293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043853744.1|651411_653475_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_058372117.1|653648_655193_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058372118.1|655429_656968_-	DUF3502 domain-containing protein	NA	NA	NA	NA	NA
WP_035764313.1|657165_658056_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081044150.1|658171_659152_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058372119.1|659387_660929_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.9	4.0e-06
WP_136954475.1|660831_662700_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.4	5.3e-21
WP_003413637.1|662755_663445_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_058372120.1|663651_664095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372121.1|664294_664846_-	hemerythrin	NA	NA	NA	NA	NA
WP_058372123.1|666286_666604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372124.1|666600_666837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372125.1|666931_667135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372126.1|667119_667992_-	ParM/StbA family protein	NA	Q0SPH6	Clostridium_phage	29.7	4.5e-23
WP_125390915.1|668124_668295_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J765	uncultured_Caudovirales_phage	64.3	1.3e-11
WP_058372128.1|668421_668946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003432416.1|669341_669542_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	42.2	2.8e-05
WP_125390911.1|669712_670432_-	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	35.8	1.5e-24
WP_058372130.1|670431_670794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372131.1|670744_671812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414383.1|672117_672297_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	75.0	3.6e-12
WP_058372132.1|672756_674379_-	hypothetical protein	NA	I3VYU6	Thermoanaerobacterium_phage	33.1	7.4e-19
WP_058372133.1|674429_674753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035763532.1|674770_674983_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_058372134.1|675276_675576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372136.1|676597_677215_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	40.2	4.4e-41
WP_064062222.1|677215_679108_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	57.9	1.5e-26
WP_058372137.1|679108_680236_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	36.2	2.1e-52
WP_045144373.1|680242_680680_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	43.4	2.3e-23
WP_058372138.1|680672_681017_-	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	42.7	2.6e-14
WP_058372223.1|681006_681984_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	47.4	6.3e-74
WP_058372139.1|682032_682599_-	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	37.6	9.1e-33
WP_081044151.1|682692_682854_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058372140.1|682863_683346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372141.1|683716_684556_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058877159.1|684593_688358_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	33.2	1.2e-85
WP_058372143.1|688561_689056_-	XkdN	NA	A0A2H4J883	uncultured_Caudovirales_phage	39.7	1.7e-19
688985:689002	attL	TTCTTCATTTAATTTTTT	NA	NA	NA	NA
WP_003432463.1|689088_689508_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.8	1.2e-42
WP_058372144.1|689525_690965_-|tail	phage tail sheath protein	tail	B6SBT7	Clostridium_virus	46.0	1.8e-109
WP_027635367.1|690964_691198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372145.1|691213_692035_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	53.1	2.1e-83
WP_002581889.1|692038_692464_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	44.8	1.5e-24
WP_058372146.1|692468_692852_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	51.6	4.0e-32
WP_003432470.1|692851_693172_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	56.4	4.7e-26
WP_058372147.1|693174_693426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372148.1|693482_694538_-|capsid	phage capsid protein	capsid	D9ZND6	Clostridium_phage	49.7	2.0e-86
WP_058372149.1|694554_694959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372150.1|694987_695614_-|capsid	phage capsid protein	capsid	A0A0K2CP96	Brevibacillus_phage	35.0	5.2e-13
WP_058372151.1|695725_695935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081044152.1|695927_696236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432485.1|698706_700251_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	51.7	1.7e-137
WP_058372153.1|701629_702277_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	46.3	2.6e-52
WP_058372155.1|702832_703783_-|portal	phage portal protein	portal	A0A0A7RTY1	Clostridium_phage	40.5	2.3e-44
WP_058372156.1|704078_704267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372157.1|704388_704694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372158.1|705049_705622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372159.1|705677_706199_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	34.3	2.1e-15
WP_058372160.1|706314_706569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372161.1|706552_706885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155594188.1|706881_707052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372162.1|707054_707354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033127229.1|707368_708370_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.9	4.3e-17
WP_058372163.1|708621_708831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372164.1|709666_710278_-	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	39.5	2.0e-33
WP_058372165.1|710301_710571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372166.1|710593_711313_-	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	36.3	3.2e-30
WP_058372167.1|711356_711545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144349.1|711549_711954_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	40.8	5.3e-19
WP_058372168.1|712042_712348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144347.1|712363_712639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372169.1|712639_713716_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	43.4	4.6e-17
WP_058372170.1|713716_715306_-	hypothetical protein	NA	A0A2H4J8D4	uncultured_Caudovirales_phage	37.5	5.1e-73
WP_058372171.1|715319_715721_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	35.4	3.7e-12
WP_003406460.1|715760_716105_-	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	52.6	1.0e-23
WP_058372172.1|716082_716319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372173.1|716315_716663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372174.1|716678_717485_-	DNA replication protein	NA	A0A1B1P7U2	Bacillus_phage	33.5	4.2e-31
WP_058372175.1|717426_718269_-	DnaD domain protein	NA	C5J987	Streptococcus_phage	39.3	1.4e-29
WP_058372176.1|718422_719136_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	43.9	1.1e-51
WP_058372177.1|719135_720026_-	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	42.4	6.8e-51
WP_058372178.1|720029_720215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372179.1|720214_722185_-	AAA family ATPase	NA	S0A069	Cellulophaga_phage	33.3	2.3e-75
WP_058372180.1|722658_722874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372181.1|722887_723415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372182.1|723422_723665_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.4	3.8e-20
WP_033127217.1|723681_723882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432559.1|723948_724173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064062225.1|724142_724562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432570.1|725030_725330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372184.1|725333_725618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081044156.1|725619_726402_-	phage antirepressor protein	NA	A0A0A7RW33	Clostridium_phage	52.3	1.7e-66
WP_058372186.1|726429_726645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372187.1|726835_727354_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	53.5	1.2e-34
WP_058372188.1|727374_727860_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	42.6	1.1e-21
WP_058372189.1|727886_728969_+|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	29.8	1.9e-23
WP_002581238.1|730605_731394_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.4	2.4e-15
730819:730836	attR	TTCTTCATTTAATTTTTT	NA	NA	NA	NA
>prophage 53
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	748536	750771	795002		Planktothrix_phage(100.0%)	1	NA	NA
WP_081044153.1|748536_750771_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	3.4e-22
>prophage 54
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	755558	757234	795002		Mycobacterium_phage(50.0%)	2	NA	NA
WP_053359224.1|755558_756374_-	alpha/beta hydrolase	NA	A0A2R4AP45	Mycobacterium_phage	29.0	4.4e-12
WP_053359225.1|756613_757234_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.0	1.2e-38
>prophage 55
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	761022	761748	795002		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_058372193.1|761022_761748_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.3	2.8e-10
>prophage 56
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	765742	769514	795002		Enterococcus_phage(50.0%)	3	NA	NA
WP_058372224.1|765742_766492_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	42.7	1.4e-20
WP_058372196.1|767006_767492_-	flavodoxin	NA	NA	NA	NA	NA
WP_033127314.1|767756_769514_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.1	3.6e-35
>prophage 57
NZ_CP014705	Clostridium butyricum strain TOA chromosome 2, complete sequence	795002	773806	777373	795002		Bacillus_phage(100.0%)	2	NA	NA
WP_058372197.1|773806_775654_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-52
WP_058372198.1|775657_777373_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	5.2e-47
