The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	1313	64234	5428937	terminase,tail,capsid,portal,integrase,transposase,head,holin	Enterobacteria_phage(34.48%)	55	7040:7055	71055:71070
WP_000683056.1|1313_1709_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000974984.1|1705_2239_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|2254_2608_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|2600_2984_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|3035_4064_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|4121_4469_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253920.1|4505_6011_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000831797.1|6000_7593_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
7040:7055	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|7589_7796_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001418004.1|7779_9708_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|9679_10189_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|10590_10776_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|10912_11050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|11736_11922_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_032140280.1|12143_12230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092850.1|12784_13318_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_000731214.1|13360_14350_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_000411813.1|14354_14561_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000874327.1|14853_16704_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261910.1|17471_18185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000090265.1|19775_20147_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|20136_20508_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265288.1|20520_21570_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.0e-110
WP_010917803.1|21571_21850_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|21919_22180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|22334_23438_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004959.1|23418_24069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|24234_24390_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000101550.1|24761_25721_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001151172.1|26161_26569_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000054513.1|26609_27575_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_000705361.1|27555_28077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476994.1|28060_28288_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|28365_28773_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379559.1|28965_29118_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000559930.1|29231_29747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449169.1|30288_30477_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|30473_30662_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000990641.1|30754_33172_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000094838.1|33230_33434_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533608.1|33433_34459_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_001302302.1|34694_35492_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480501.1|44224_45277_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|45591_46908_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|47009_48464_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|48806_49523_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|51909_52860_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|52961_53879_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986329.1|54335_55271_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|55332_56412_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|56423_57167_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|57163_57709_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001419103.1|59380_61528_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000502860.1|61898_62537_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_085959019.1|63021_64234_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
71055:71070	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 2
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	225406	234852	5428937		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001359338.1|225406_226543_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_013009241.1|226539_228543_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001359339.1|228667_229129_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001295430.1|229170_229641_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|229687_230407_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001359340.1|230403_232089_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_001374188.1|232310_233042_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
WP_001216963.1|233101_233209_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|233189_233921_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|233925_234852_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 3
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	450150	544037	5428937	tail,capsid,portal,integrase,tRNA,protease,lysis,holin	Escherichia_phage(32.91%)	105	471324:471340	541026:541042
WP_001283590.1|450150_450963_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|450962_451976_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|452041_453178_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615820.1|453276_454272_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127738.1|454268_455447_-	MFS transporter	NA	NA	NA	NA	NA
WP_024220099.1|455721_456942_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_064032093.1|457100_459107_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|459227_459506_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|459539_460088_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|460087_460897_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043835.1|460896_461721_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|461724_462810_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|462844_463777_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|463942_464494_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|464664_465507_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|465508_466030_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822671.1|466026_466497_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|466493_466994_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182853.1|467004_467763_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112843.1|467785_470425_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|470506_471070_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
471324:471340	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|471715_472201_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426144.1|472403_474548_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531971.1|474547_475858_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|476037_476322_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|476693_478034_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|478398_479430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|479824_480580_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|480873_481806_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331678.1|482027_490412_-	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000012455.1|490481_491747_-	hypothetical protein	NA	A0A1U9AJC6	Stx1_converting_phage	100.0	2.4e-206
WP_000540394.1|491757_492009_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|492018_492465_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|492467_493124_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|493217_493619_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|493675_493816_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835358.1|494048_494783_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_001301884.1|494873_495491_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|495496_495775_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|495789_497058_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|497054_498680_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001426815.1|498974_499163_-	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001023473.1|499304_499574_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_064032095.1|499575_501471_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_064032097.1|501467_502118_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	1.3e-120
WP_000829200.1|502117_502681_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001482112.1|502664_503126_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	1.3e-74
WP_001140442.1|503175_503565_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|503620_504835_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|504858_505866_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787520.1|506023_508168_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143991.1|508167_509874_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_001086076.1|509854_510661_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_001283921.1|511064_511322_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|511318_511816_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_064032098.1|512018_512456_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	96.6	1.2e-69
WP_000455406.1|512463_512613_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001369534.1|512612_513155_-	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_001080433.1|513469_514003_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_000284510.1|514007_514223_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290231.1|514299_514572_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|514612_514792_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064032101.1|514928_516869_-	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000752026.1|517372_517642_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|517651_518599_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|519105_519540_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|519532_519727_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_064032103.1|519723_520335_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_001108081.1|520309_520876_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001502725.1|521451_523224_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001254228.1|523727_523910_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|523906_524434_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000814576.1|524430_524877_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|524833_525070_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|525080_525296_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|525428_525707_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|525777_526068_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|526064_526766_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|526762_527701_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|527733_528030_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|528168_528396_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|528474_529182_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|529242_529584_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|529651_530113_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|530106_531153_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|531155_531320_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|531808_532192_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000065377.1|532870_533239_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|533311_533476_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|533444_533588_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|533663_533960_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_016241376.1|533965_534751_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000186844.1|534747_535428_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_064032105.1|535424_535607_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	2.0e-26
WP_000548531.1|535579_535771_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|535847_536063_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|536161_536383_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000497812.1|537776_538028_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000405131.1|538088_538271_+	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_001218301.1|538254_539424_-|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000958698.1|539855_541013_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	99.7	1.4e-221
WP_000257010.1|541187_542324_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
541026:541042	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|542333_543014_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403518.1|543000_543468_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000950857.1|543467_544037_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 4
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	729795	806432	5428937	terminase,tail,capsid,plate,tRNA,holin	Salmonella_phage(46.81%)	81	NA	NA
WP_000940018.1|729795_730533_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|730651_731455_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001301747.1|731599_732454_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000982994.1|732644_733925_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244203.1|733916_735056_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423257.1|735215_736106_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000211172.1|736241_737603_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_001276062.1|737599_738118_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_001080102.1|738117_738438_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001281372.1|738434_739247_+	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
WP_000660772.1|739256_740459_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_001087250.1|740555_740978_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000158561.1|741025_741898_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|741909_743004_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001276664.1|743036_744035_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493510.1|744059_745571_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.1e-13
WP_001124894.1|745593_746577_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001358959.1|746673_749955_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001200779.1|750072_751266_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919165.1|751328_752582_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883120.1|752909_754100_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|754144_754483_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|754543_755878_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|755867_756581_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001301750.1|756745_758173_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_000970087.1|758748_762636_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_000734212.1|762892_764449_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298403.1|764445_764982_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190651.1|765006_765642_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|765850_766699_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288816.1|767337_767985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904993.1|768057_768606_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	2.8e-87
WP_077626228.1|768632_769034_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_000376430.1|769037_769457_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.7	7.2e-35
WP_001030527.1|769428_770031_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	4.3e-97
WP_001096936.1|770030_770876_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.0	5.7e-47
WP_000049950.1|770875_771556_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197088.1|771552_772752_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	1.4e-184
WP_001270630.1|772751_773105_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.5e-54
WP_001007932.1|773104_773857_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.0e-88
WP_000213604.1|773919_774090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044735.1|774093_774648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832850.1|774655_775003_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	6.0e-27
WP_000081725.1|775005_776070_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.4	3.2e-156
WP_000155119.1|776072_776375_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001298404.1|776374_776962_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990892.1|776961_778950_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	2.5e-271
WP_000393952.1|779127_779580_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	71.3	5.2e-55
WP_000109253.1|779583_780024_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	9.2e-57
WP_000046937.1|780034_781180_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	6.1e-161
WP_000503648.1|781183_781747_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.7e-79
WP_001142480.1|781721_782111_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_000008731.1|782097_782652_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	8.0e-66
WP_000042171.1|782648_783056_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	9.7e-69
WP_001040696.1|783021_783390_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	87.7	8.8e-53
WP_000627481.1|783430_784372_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	6.3e-156
WP_001066731.1|784383_784890_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.7e-70
WP_000873179.1|784893_786114_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	87.8	1.9e-200
WP_000184962.1|786128_786863_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.6	2.3e-97
WP_064032111.1|786753_788220_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.4	3.0e-261
WP_001130776.1|788219_789842_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|789844_790417_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|790478_791003_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001157004.1|790986_791463_-	glycoside hydrolase family 104 protein	NA	Q8SBE0	Shigella_phage	94.9	5.0e-85
WP_000781777.1|791466_791808_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	7.3e-54
WP_001174014.1|792253_792595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244505.1|792626_793049_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	64.2	5.2e-41
WP_001284072.1|793333_795520_-	replication protein	NA	B6SCY1	Bacteriophage	72.4	3.2e-174
WP_000170998.1|795523_795736_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|795856_796480_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000801676.1|797113_797263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051352.1|797259_798162_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113505.1|798164_799466_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	3.0e-132
WP_000769005.1|799481_800030_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_000551014.1|800082_800712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065474.1|800758_802822_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	5.7e-274
WP_130234667.1|802907_803417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177149.1|803422_803974_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000638863.1|804016_804286_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	63.5	5.1e-26
WP_001101052.1|804291_805002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627622.1|805040_806432_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	2.2e-213
>prophage 5
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	1259040	1266441	5428937	transposase	Shigella_phage(16.67%)	9	NA	NA
WP_085959019.1|1259040_1260253_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001323397.1|1260374_1260533_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234731.1|1260687_1261506_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.3e-45
WP_000213700.1|1261596_1262082_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.4e-13
WP_001186192.1|1262096_1262573_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1262635_1262857_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|1262930_1263299_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_013009286.1|1264138_1265680_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	8.3e-129
WP_001016257.1|1265694_1266441_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 6
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	2641188	2727379	5428937	integrase,transposase,tRNA,protease	Escherichia_phage(16.67%)	57	2658409:2658424	2709295:2709310
WP_024229417.1|2641188_2642211_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.5	5.6e-198
WP_064032151.1|2642210_2642990_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	4.9e-138
WP_000624720.1|2644389_2644740_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_024230501.1|2644736_2645162_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_032320727.1|2645771_2646413_-	T3SS effector NleG family protein	NA	NA	NA	NA	NA
WP_001557795.1|2647430_2648456_-|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_064032153.1|2649726_2650200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064032155.1|2650171_2650507_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	46.2	6.6e-07
WP_024230120.1|2651577_2651757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001435885.1|2652455_2652758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024230489.1|2656475_2660570_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	42.1	8.3e-293
2658409:2658424	attL	ATGGTTCCGTTAACCT	NA	NA	NA	NA
WP_001569458.1|2660663_2661134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001569459.1|2661648_2662290_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	39.1	1.5e-39
WP_064032158.1|2662456_2663044_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_024229977.1|2664778_2665093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064032161.1|2667817_2677483_+	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_024229417.1|2678353_2679376_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.5	5.6e-198
WP_001254932.1|2680041_2681193_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_024230467.1|2682287_2685803_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_064032168.1|2686253_2687516_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001419277.1|2687895_2688471_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068930.1|2688507_2690205_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|2690180_2690519_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|2690634_2691936_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|2692053_2693490_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267445.1|2693826_2694303_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015852.1|2694318_2695575_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|2695850_2696144_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2696187_2697834_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2697971_2698325_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000940500.1|2699265_2700294_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|2700335_2700902_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2700953_2701079_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2701189_2701336_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2701511_2701829_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|2701825_2702359_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001359668.1|2702446_2703580_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|2703642_2704002_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2704012_2704408_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|2704418_2705153_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192993.1|2705145_2706954_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|2707278_2708256_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001300174.1|2708474_2709977_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
2709295:2709310	attR	ATGGTTCCGTTAACCT	NA	NA	NA	NA
WP_001236835.1|2710127_2713451_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|2713472_2714441_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|2714537_2715590_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001302216.1|2715684_2716230_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2716972_2717026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294212.1|2717008_2718148_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001303763.1|2718146_2719694_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2719665_2720127_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990298.1|2720145_2721483_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122476.1|2721492_2723340_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_001280339.1|2723332_2724283_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2724368_2724677_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2724753_2726034_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2726119_2727379_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 7
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	3158727	3235143	5428937	protease,transposase,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_001295561.1|3158727_3160080_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3160109_3162542_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_064032184.1|3162663_3163149_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|3163152_3164178_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3164282_3164738_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3164741_3165530_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139681.1|3165529_3166678_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|3166674_3167271_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294782.1|3167307_3170790_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3170802_3171762_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|3171860_3174002_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3174058_3174448_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176547.1|3174512_3175808_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3175860_3176121_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3176107_3176308_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185305.1|3176473_3177019_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3177015_3177438_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|3177451_3178162_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001359023.1|3178361_3179186_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|3179238_3180957_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|3181067_3181775_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|3181771_3182176_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|3182293_3183109_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|3183148_3183802_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3183794_3184826_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3185013_3185589_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|3191345_3192149_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|3192145_3193060_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3193300_3194101_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211697.1|3194178_3194949_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|3194996_3196355_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|3196426_3197182_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|3197215_3197938_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3197934_3198402_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|3198466_3199198_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|3199734_3200535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|3201012_3201462_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000002702.1|3201464_3202361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284959.1|3202381_3202861_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|3202826_3204236_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|3204246_3207681_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|3207789_3209202_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|3209206_3209950_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614383.1|3209946_3212724_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.9	5.6e-83
WP_000343294.1|3212732_3213494_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_064032186.1|3213498_3214830_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|3214832_3215357_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348794.1|3216657_3217740_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_063085377.1|3217703_3219554_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|3219557_3219971_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000123970.1|3221503_3221728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|3221762_3222263_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001412568.1|3222959_3223478_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103342.1|3223687_3225829_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_000509136.1|3225904_3230137_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_071529145.1|3230342_3230993_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001419315.1|3232751_3233261_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|3234006_3235143_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	3257600	3311847	5428937	terminase,tail,capsid,lysis,portal,integrase,head,protease,holin	Enterobacteria_phage(40.62%)	68	3273008:3273021	3314098:3314111
WP_000749881.1|3257600_3258656_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3258943_3260047_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893281.1|3260058_3261312_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
WP_064032187.1|3261516_3262665_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	98.4	4.8e-222
WP_001281200.1|3262978_3263323_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000103020.1|3263423_3264188_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001289865.1|3264184_3264691_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000763359.1|3264687_3264909_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_000188870.1|3265007_3265223_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|3265299_3265491_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000149546.1|3265463_3265646_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_000186844.1|3265642_3266323_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001418384.1|3266319_3267105_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995449.1|3267110_3267407_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|3267480_3267624_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|3267592_3267757_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213973.1|3267980_3268181_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_000281856.1|3268447_3268930_+	superinfection exclusion B family protein	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|3268930_3269254_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000618044.1|3269605_3270010_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000028392.1|3270006_3270639_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|3270742_3270958_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|3271077_3271371_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185433.1|3271403_3272303_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788868.1|3272299_3273001_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|3272997_3273288_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
3273008:3273021	attL	AAGAAGCAATTATT	NA	NA	NA	NA
WP_000736913.1|3273361_3273802_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153282.1|3273798_3274326_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254239.1|3274322_3274505_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000566862.1|3274501_3274672_+	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001107957.1|3274664_3275270_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_001028867.1|3275266_3275938_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_000512794.1|3275928_3276447_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	6.5e-94
WP_001419325.1|3276948_3277080_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000026511.1|3277376_3279218_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_024164617.1|3279655_3279871_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075122.1|3279870_3280368_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_072020783.1|3280584_3280767_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_001302690.1|3281293_3281608_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013009113.1|3281688_3281913_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_000235440.1|3282314_3282824_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_024201835.1|3282795_3284724_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.2e-262
WP_000258995.1|3284707_3284914_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	56.9	4.6e-11
WP_000831800.1|3284910_3286503_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	2.9e-185
WP_001253897.1|3286492_3287998_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	6.1e-100
WP_000256840.1|3288034_3288382_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|3288439_3289468_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|3289519_3289894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204539.1|3289886_3290240_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000155463.1|3290251_3290785_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_000683050.1|3290781_3291177_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_024201836.1|3291184_3291925_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	95.9	4.4e-128
WP_000479164.1|3291940_3292363_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459458.1|3292344_3292779_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840217.1|3292771_3295321_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.0	0.0e+00
WP_000847332.1|3295317_3295647_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_001152620.1|3295646_3296345_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_013009116.1|3296350_3297094_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_071813424.1|3297030_3297663_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	3.2e-95
WP_000515634.1|3297723_3301137_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233141.1|3301207_3301807_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741872.1|3301866_3303183_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001024023.1|3303184_3303454_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_001117988.1|3303565_3304138_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001144082.1|3304877_3305504_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001132163.1|3305686_3306277_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_000950786.1|3307276_3308257_+	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001130496.1|3310665_3311847_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
3314098:3314111	attR	AAGAAGCAATTATT	NA	NA	NA	NA
>prophage 9
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	3645930	3714029	5428937	terminase,tail,capsid,portal,integrase,transposase,head,tRNA,protease,lysis	Enterobacteria_phage(53.57%)	79	3656091:3656137	3705506:3705552
WP_000912351.1|3645930_3647316_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|3647351_3647873_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3647980_3648193_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|3648194_3649061_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3649540_3650083_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988382.1|3650302_3650995_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001419152.1|3651025_3653635_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691070.1|3653647_3654655_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255114.1|3654665_3655181_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001359679.1|3655183_3655816_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3656091:3656137	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|3656150_3657314_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488399.1|3657512_3657791_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	2.1e-46
WP_000763385.1|3657838_3658057_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|3658155_3658437_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_013009139.1|3658447_3658639_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	8.0e-26
WP_000149544.1|3658611_3658794_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_064032191.1|3658790_3659471_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.5e-130
WP_000100847.1|3659467_3660253_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|3660258_3660555_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|3660630_3660837_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|3661317_3661695_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380250.1|3661672_3662734_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	41.7	1.9e-63
WP_000858974.1|3662814_3663504_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|3663608_3663839_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|3663908_3664448_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|3664444_3665464_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_000788810.1|3665460_3666162_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|3666158_3666461_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|3666528_3666861_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|3666952_3667060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|3667117_3668644_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|3669108_3669660_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|3669669_3670467_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|3670583_3670685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054343.1|3670681_3671137_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_000224916.1|3671136_3671307_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|3671299_3671590_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|3671586_3671949_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|3671945_3672086_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|3672171_3672555_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737275.1|3672743_3673826_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|3674415_3674631_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|3674630_3675128_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|3675344_3675527_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|3675617_3675911_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|3676272_3676467_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453618.1|3676855_3677401_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
WP_001027276.1|3677375_3679301_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|3679297_3679504_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001676384.1|3679500_3681102_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
WP_000123270.1|3681082_3682402_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.6e-232
WP_001338090.1|3682411_3682744_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000063237.1|3682799_3683825_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	6.6e-191
WP_000158927.1|3683866_3684262_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.6e-55
WP_000752967.1|3684273_3684627_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	8.4e-61
WP_000975093.1|3684638_3685217_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.3e-79
WP_000683117.1|3685213_3685609_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_024201838.1|3685616_3686357_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_000479189.1|3686372_3686795_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_000459456.1|3686776_3687211_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840280.1|3687203_3689783_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.9	0.0e+00
WP_000847379.1|3689779_3690109_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152569.1|3690108_3690807_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	1.3e-129
WP_000140754.1|3690812_3691556_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_000090854.1|3691492_3692095_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000515282.1|3692155_3695569_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.2	0.0e+00
WP_001230375.1|3695638_3696238_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_064032193.1|3696302_3699131_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	3.2e-54
WP_000885575.1|3699130_3699715_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-101
WP_000239876.1|3699769_3700438_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|3700983_3702468_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201842.1|3702654_3703608_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|3704106_3704691_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001298108.1|3704715_3705153_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001177464.1|3705595_3706357_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3705506:3705552	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224578.1|3706539_3707430_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001301880.1|3707430_3710403_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383932.1|3710389_3712627_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_064032196.1|3712892_3714029_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	3939658	3985192	5428937	terminase,tail,lysis,portal,integrase,protease,holin	Enterobacteria_phage(43.64%)	64	3930188:3930202	3944625:3944639
3930188:3930202	attL	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000533643.1|3939658_3940729_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|3940706_3940925_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|3940964_3941132_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120060.1|3941374_3941977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763358.1|3942187_3942409_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000188870.1|3942507_3942723_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|3942799_3942991_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|3942963_3943146_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|3943142_3943823_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001418384.1|3943819_3944605_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995449.1|3944610_3944907_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
3944625:3944639	attR	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000372937.1|3944980_3945124_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|3945092_3945257_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065351.1|3945329_3945698_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000392419.1|3945893_3946343_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	3.3e-70
WP_000088205.1|3946627_3946900_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000478871.1|3947332_3947617_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000854876.1|3947628_3947925_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_096246228.1|3948097_3948793_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|3948867_3949083_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438491.1|3949224_3949524_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000185506.1|3949556_3950456_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000788868.1|3950452_3951154_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|3951150_3951441_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000736913.1|3951514_3951955_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|3951951_3952134_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|3952130_3952301_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001108059.1|3952293_3952914_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_001028854.1|3952910_3953576_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750160.1|3953787_3954747_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|3955085_3955208_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|3955222_3955912_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|3956097_3956841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3956926_3957085_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|3957165_3957564_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|3957706_3957922_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|3957921_3958419_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092264.1|3958415_3958883_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_001139679.1|3958870_3959023_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|3959697_3960189_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934091.1|3960188_3962291_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|3962287_3962500_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985949.1|3962499_3964008_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001097050.1|3966066_3966390_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|3966382_3966658_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677100.1|3966669_3967248_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001079422.1|3967244_3967646_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|3967656_3968400_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|3968460_3968847_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|3968855_3969185_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371992.1|3969156_3972222_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447257.1|3972221_3972551_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.5e-59
WP_001152339.1|3972560_3973259_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_001419734.1|3973264_3974008_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_000090845.1|3973944_3974553_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_000515307.1|3974613_3978027_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_001230272.1|3978096_3978696_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000279047.1|3978760_3980074_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001101707.1|3980075_3980345_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000950813.1|3980521_3981502_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|3981535_3982555_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|3983051_3983213_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|3983381_3984263_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247931.1|3984493_3985192_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 11
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	4533508	4649057	5428937	terminase,tail,capsid,portal,integrase,transposase,head,protease,holin	Enterobacteria_phage(28.42%)	131	4545275:4545297	4599510:4599532
WP_000113678.1|4533508_4534792_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
WP_000113189.1|4534769_4535018_-	excisionase	NA	NA	NA	NA	NA
WP_000048548.1|4535082_4537533_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.5e-57
WP_001090200.1|4537625_4537817_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4537813_4538002_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|4538560_4538794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|4538771_4539179_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|4539201_4539420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|4539492_4539792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|4540056_4540464_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|4540540_4540768_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|4540751_4541303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|4541274_4542315_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|4542226_4542769_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|4542802_4543537_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|4543533_4543698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|4544396_4545155_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
4545275:4545297	attL	CCGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000961821.1|4545433_4545646_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_000975564.1|4545864_4546125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|4546194_4546473_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|4546474_4547530_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|4547530_4547896_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|4547892_4548582_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023143.1|4550100_4551951_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024164617.1|4552388_4552604_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|4552603_4553101_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4553317_4553503_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4554030_4554345_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|4554426_4554651_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001359494.1|4554692_4555223_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_001419048.1|4555338_4555902_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	9.2e-86
WP_001417827.1|4555898_4557560_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173067.1|4557623_4559561_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001063105.1|4559605_4559827_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000125996.1|4562353_4562680_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|4562690_4563041_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573390.1|4563037_4563484_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_064032209.1|4563480_4563774_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	97.9	1.2e-44
WP_001254932.1|4564692_4565844_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001275473.1|4566375_4567092_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	3.3e-128
WP_001030057.1|4567097_4567472_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|4567567_4567777_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212946.1|4567828_4571095_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_000807954.1|4571087_4571429_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001419047.1|4571428_4572127_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.3e-129
WP_014640511.1|4572137_4572881_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	3.8e-148
WP_064761467.1|4572826_4573456_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_000514949.1|4573696_4577173_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_085959019.1|4577254_4578468_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_029783341.1|4578486_4579125_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_064032211.1|4579189_4580503_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.7	9.7e-70
WP_001023357.1|4580504_4580774_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_000767050.1|4580994_4581537_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106423857.1|4581481_4581676_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_106409364.1|4583685_4583808_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|4583914_4584826_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|4584891_4585461_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000113671.1|4587906_4589037_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|4589014_4589263_-	excisionase	NA	NA	NA	NA	NA
WP_064032212.1|4589327_4591772_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	4.9e-176
WP_000092782.1|4591864_4592053_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|4592049_4592238_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000555741.1|4592801_4593107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302871.1|4593093_4593399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380323.1|4593410_4593563_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_000367559.1|4593731_4594121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|4594223_4594499_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|4594482_4594908_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|4594930_4595884_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|4595890_4596631_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_001118161.1|4597445_4597841_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|4597897_4598254_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|4598302_4598515_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|4598550_4598922_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|4598918_4599281_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|4599396_4599501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|4599689_4599902_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
4599510:4599532	attR	CGATATGGGAATTCCCATATCGG	NA	NA	NA	NA
WP_000998188.1|4600180_4600348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|4600413_4600692_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_001302870.1|4600693_4601743_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904137.1|4601755_4602130_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|4602126_4602948_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|4603174_4603372_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|4603522_4604581_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_064032215.1|4605084_4607031_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|4607168_4607348_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290233.1|4607388_4607634_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|4607710_4607926_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064032217.1|4607930_4608464_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	2.8e-100
WP_001056806.1|4608734_4609304_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4609303_4609450_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4609677_4609863_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|4610339_4610816_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|4610812_4612936_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|4612932_4613145_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974563.1|4613144_4614647_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_001369631.1|4614636_4616616_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_001097065.1|4616703_4617030_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|4617022_4617304_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|4617306_4617930_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682708.1|4617942_4618341_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000235090.1|4618348_4619101_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|4619114_4619537_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|4619563_4619872_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_064032219.1|4619915_4622561_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|4622557_4622887_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001365123.1|4622886_4623585_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000194802.1|4623595_4624339_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_063075060.1|4624284_4624914_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_064032221.1|4625154_4628631_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.2	0.0e+00
WP_064032222.1|4628697_4629297_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	4.1e-108
WP_000741894.1|4629356_4630673_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.9	3.1e-76
WP_032312694.1|4630674_4630944_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	96.6	2.7e-43
WP_064032224.1|4632077_4632668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001460318.1|4633070_4633217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079491.1|4633706_4634213_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|4634258_4634759_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4634844_4635024_-	general stress protein	NA	NA	NA	NA	NA
WP_000443044.1|4635404_4636211_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|4636210_4637404_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_077883677.1|4637415_4638777_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|4638777_4640373_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194629.1|4640372_4641935_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4642026_4642071_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|4642208_4643090_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4643086_4643707_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001419072.1|4643734_4645318_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|4645530_4646403_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278896.1|4646442_4647033_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|4647029_4647788_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|4648007_4649057_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 12
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	4921127	4978711	5428937	terminase,tail,capsid,portal,integrase,transposase,head,holin	Enterobacteria_phage(33.33%)	70	4954737:4954752	4986878:4986893
WP_000214712.1|4921127_4921331_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|4921366_4922827_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|4924330_4924573_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000343700.1|4924622_4925831_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001121226.1|4925980_4926631_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001131642.1|4927341_4927917_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023389.1|4928029_4928299_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_000279047.1|4928300_4929614_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230373.1|4929678_4930278_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	3.5e-107
WP_071781836.1|4933784_4934417_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_064032228.1|4934353_4935097_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	95.1	4.6e-141
WP_064032230.1|4935107_4935806_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_000847304.1|4935805_4936135_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_064032241.1|4936131_4938711_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
WP_000533425.1|4938691_4939105_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|4939131_4939563_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235022.1|4939576_4940329_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683056.1|4940336_4940732_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000974984.1|4940728_4941262_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|4941277_4941631_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|4941623_4942007_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|4942058_4943087_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|4943144_4943492_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253920.1|4943528_4945034_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000831797.1|4945023_4946616_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000259002.1|4946612_4946819_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001418004.1|4946802_4948731_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|4948702_4949212_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000105085.1|4949606_4949834_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|4950258_4950444_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|4950671_4950818_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|4950817_4951387_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|4951657_4952191_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731255.1|4952241_4952586_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	5.9e-59
WP_000284518.1|4952590_4952806_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|4952881_4953151_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|4953188_4953371_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|4953518_4955456_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
4954737:4954752	attL	CAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000762928.1|4956534_4957356_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|4957352_4957727_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265028.1|4957739_4958786_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001417850.1|4958787_4959066_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001302544.1|4959006_4959192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|4959233_4959446_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|4959635_4959740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207995.1|4959855_4960725_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_000224233.1|4960735_4960999_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000256993.1|4961000_4961219_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000935420.1|4961251_4961464_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001151255.1|4961890_4962316_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.8e-63
WP_000770544.1|4962356_4963322_-	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_000693859.1|4963346_4963772_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471546.1|4963768_4963984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104592.1|4964033_4964750_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_001414141.1|4965015_4965168_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|4965282_4965798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449178.1|4966346_4966535_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090185.1|4966531_4966735_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048562.1|4966814_4969286_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_000005551.1|4969357_4969609_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206152.1|4969628_4970924_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_001531709.1|4970949_4971054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836042.1|4971111_4972131_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001358608.1|4972142_4973357_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_001358609.1|4973562_4973889_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|4974023_4974365_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4974399_4974960_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|4974962_4975673_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|4975780_4976086_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041706.1|4976284_4978711_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
4986878:4986893	attR	CAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 13
NZ_CP015241	Escherichia coli strain 2013C-4465 chromosome, complete genome	5428937	5362056	5428225	5428937	terminase,tail,capsid,portal,integrase,head,lysis,holin	Enterobacteria_phage(44.12%)	79	5381836:5381857	5427849:5427870
WP_001079074.1|5362056_5362587_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001143784.1|5363613_5364255_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001359536.1|5364336_5364966_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001118092.1|5365038_5365620_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.3	4.6e-48
WP_001131654.1|5365910_5366486_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	81.6	1.2e-80
WP_064032259.1|5366598_5366868_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	95.5	3.0e-42
WP_071941107.1|5366869_5368183_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	5.3e-76
WP_064032263.1|5368247_5368847_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.2e-109
WP_064032265.1|5368913_5372396_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	88.4	0.0e+00
WP_000090901.1|5372456_5373089_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194782.1|5373025_5373769_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_001152612.1|5373774_5374473_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847349.1|5374472_5374802_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_064032267.1|5374798_5377399_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.3	0.0e+00
WP_000533431.1|5377379_5377793_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|5377819_5378251_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|5378264_5379017_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|5379024_5379420_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|5379416_5379992_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|5380006_5380360_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|5380352_5380727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|5380778_5381807_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
5381836:5381857	attL	TCAGGCCACCGCGGTGGCCTGA	NA	NA	NA	NA
WP_000256821.1|5381864_5382212_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_053890224.1|5382248_5383754_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	4.6e-100
WP_023307786.1|5383743_5385336_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	6.5e-185
WP_000258991.1|5385332_5385539_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_024017589.1|5385522_5387451_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|5387422_5387932_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001329960.1|5388326_5388512_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|5388648_5388786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082561.1|5389136_5389604_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_000459345.1|5389605_5389743_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001092861.1|5389902_5390436_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_000731214.1|5390478_5391468_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_000411813.1|5391472_5391679_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_001346898.1|5392254_5392446_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001213059.1|5392483_5392666_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000871291.1|5393934_5394270_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000935529.1|5394860_5395910_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	89.7	1.4e-183
WP_000917767.1|5396060_5396258_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_064032269.1|5396482_5397034_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	2.1e-66
WP_000904119.1|5397042_5397402_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	3.6e-35
WP_024173616.1|5397414_5398464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	4.7e-107
WP_032175188.1|5398465_5398738_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.2e-12
WP_000967411.1|5398905_5399118_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.4e-26
WP_000224233.1|5400016_5400280_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_064032271.1|5400281_5400500_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_001151226.1|5400849_5401272_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.8e-65
WP_001262354.1|5401312_5402383_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	2.7e-62
WP_000693883.1|5402454_5402880_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391946.1|5402863_5403145_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|5403245_5403665_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000379669.1|5403932_5404088_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.5e-06
WP_001171942.1|5404247_5404466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|5405034_5405223_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090194.1|5405219_5405411_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_063183380.1|5405503_5407984_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	61.3	8.6e-59
WP_000096342.1|5408042_5408246_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533628.1|5408245_5409271_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	2.9e-101
WP_000022458.1|5409889_5410543_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_013009221.1|5410867_5411740_+	restriction endonuclease Eco57I	NA	NA	NA	NA	NA
WP_001023389.1|5411865_5412135_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_000279047.1|5412136_5413450_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230272.1|5413514_5414114_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000515116.1|5414181_5417658_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.0	0.0e+00
WP_000649829.1|5417791_5418319_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_139242138.1|5418509_5419142_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	1.0e-96
WP_064032276.1|5419087_5419831_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.7e-143
WP_064032230.1|5419841_5420540_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_000847304.1|5420539_5420869_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_064032241.1|5420865_5423445_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
WP_000533425.1|5423425_5423839_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|5423865_5424297_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235022.1|5424310_5425063_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683056.1|5425070_5425466_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000974984.1|5425462_5425996_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|5426011_5426365_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|5426357_5426741_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000256723.1|5427877_5428225_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
5427849:5427870	attR	TCAGGCCACCGCGGTGGCCTGA	NA	NA	NA	NA
>prophage 1
NZ_CP015242	Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence	66029	0	19354	66029	transposase,integrase	Enterobacteria_phage(37.5%)	20	6417:6430	14791:14804
WP_000107542.1|704_992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275846.1|1016_1223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024835.1|1721_1913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271758.1|1909_2332_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072131700.1|2378_2657_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274489.1|4018_4453_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104880.1|4464_4686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085942.1|4686_5370_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_032325408.1|5446_5752_-	hypothetical protein	NA	NA	NA	NA	NA
6417:6430	attL	GCCTGACTATCGGT	NA	NA	NA	NA
WP_000756329.1|7354_8317_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	1.0e-113
WP_000817637.1|8313_9519_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.7	4.3e-205
WP_001132893.1|9907_10159_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270421.1|10155_10443_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
WP_000361616.1|11495_12473_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	6.7e-100
WP_001066926.1|12756_13497_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001368887.1|14283_14658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526857.1|14860_15040_+	hypothetical protein	NA	NA	NA	NA	NA
14791:14804	attR	GCCTGACTATCGGT	NA	NA	NA	NA
WP_000273581.1|15288_15726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165382802.1|15828_17041_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001025657.1|18028_19354_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.4	3.8e-223
>prophage 2
NZ_CP015242	Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence	66029	22394	28308	66029	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_072141484.1|22394_22835_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	52.5	1.2e-24
WP_000099186.1|22916_24455_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_000612624.1|24503_24851_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_000839179.1|24847_25252_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000124031.1|25329_28308_-|transposase	Tn3-like element TnEc1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	2.4e-297
>prophage 3
NZ_CP015242	Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence	66029	48535	50506	66029		Enterobacteria_phage(100.0%)	1	NA	NA
WP_013009342.1|48535_50506_-	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
>prophage 4
NZ_CP015242	Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence	66029	57575	58322	66029		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000205758.1|57575_58322_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.0	6.0e-08
