The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	605186	667019	3329120	tRNA,integrase	Clostridium_phage(30.0%)	44	660489:660514	669144:669169
WP_063743192.1|605186_607823_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	1.1e-91
WP_063743194.1|608091_609195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063743196.1|609318_610167_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_063743198.1|610282_611032_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063743200.1|611034_611802_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_063743202.1|612020_613025_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	33.1	4.6e-27
WP_063743204.1|613867_614926_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	32.9	1.0e-37
WP_063743206.1|614968_615568_-	metallopeptidase	NA	NA	NA	NA	NA
WP_063743208.1|615957_616641_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_063743209.1|616630_617572_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_063743210.1|617584_619180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063743211.1|619306_620935_-	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_060383012.1|620941_621940_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_060383878.1|622111_622594_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_060383013.1|622669_623860_-	type IX secretion system outer membrane channel protein PorV	NA	NA	NA	NA	NA
WP_063743212.1|623898_627720_-	type IX secretion system sortase PorU	NA	NA	NA	NA	NA
WP_060383015.1|627918_629646_+	gliding motility lipoprotein GldJ	NA	A0A075BSL8	Microcystis_phage	33.3	5.3e-07
WP_060383016.1|629711_630995_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_060383017.1|631318_632014_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_060383018.1|632032_632758_+	PorT family protein	NA	NA	NA	NA	NA
WP_063743213.1|632898_634812_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_063743214.1|634824_644484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145915566.1|644485_645019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743216.1|645059_645413_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	36.4	1.4e-07
WP_063743217.1|645579_647898_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_063743218.1|648036_648912_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.8	4.7e-12
WP_081248734.1|648898_649756_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063743219.1|650717_651512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145915566.1|651513_652047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743216.1|652087_652441_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	36.4	1.4e-07
WP_063743217.1|652607_654926_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_063743218.1|655064_655940_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.8	4.7e-12
WP_081248734.1|655926_656784_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063743220.1|657745_658588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123907311.1|658722_658971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158447602.1|659027_659201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060383022.1|659395_660286_+	hypothetical protein	NA	NA	NA	NA	NA
660489:660514	attL	AACAAAGCCCTCAAATGAGGGCTTTG	NA	NA	NA	NA
WP_060383023.1|660791_661763_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_060383024.1|661773_662100_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_060383025.1|662138_662465_-	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	37.3	3.8e-07
WP_063743221.1|662629_663430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743222.1|663450_664938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743223.1|665214_666132_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.5	4.8e-15
WP_060383027.1|666128_667019_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
669144:669169	attR	AACAAAGCCCTCAAATGAGGGCTTTG	NA	NA	NA	NA
>prophage 2
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	1478761	1493605	3329120	integrase	Leptospira_phage(42.86%)	17	1487339:1487356	1493896:1493913
WP_060383627.1|1478761_1479589_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.7	4.6e-17
WP_060383626.1|1479588_1480407_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145902579.1|1481468_1481924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383629.1|1481934_1482216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383628.1|1482372_1482738_-	helix-turn-helix transcriptional regulator	NA	A0A0N9HJE7	Vibrio_phage	31.2	8.5e-08
WP_063743523.1|1482872_1484813_+	toprim domain-containing protein	NA	A0A2R3UAP7	Myoviridae_environmental_samples	41.3	9.5e-05
WP_063743524.1|1484911_1485241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383627.1|1485361_1486189_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.7	4.6e-17
WP_060383626.1|1486188_1487007_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1487339:1487356	attL	AAAAAGCCTTTTTTTACT	NA	NA	NA	NA
WP_145902579.1|1488068_1488524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383629.1|1488534_1488816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383628.1|1488972_1489338_-	helix-turn-helix transcriptional regulator	NA	A0A0N9HJE7	Vibrio_phage	31.2	8.5e-08
WP_081248746.1|1489472_1490501_+	toprim domain-containing protein	NA	A0A2R3UAP7	Myoviridae_environmental_samples	41.3	5.0e-05
WP_063743525.1|1490559_1490901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743526.1|1490957_1491839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383627.1|1491959_1492787_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.7	4.6e-17
WP_060383626.1|1492786_1493605_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1493896:1493913	attR	AGTAAAAAAAGGCTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	1582645	1665018	3329120	tRNA,integrase	Brevibacillus_phage(37.5%)	58	1644803:1644832	1675364:1675393
WP_060383556.1|1582645_1583917_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	35.3	5.3e-65
WP_081078450.1|1583993_1585835_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060383555.1|1585918_1586230_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_060383553.1|1586930_1587710_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_060383552.1|1587699_1589052_+	magnesium transporter	NA	NA	NA	NA	NA
WP_063743559.1|1589540_1592864_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_063743560.1|1592967_1593744_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_060383549.1|1593816_1594788_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_162492333.1|1595116_1595887_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_060383547.1|1595891_1596815_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_060383546.1|1596886_1598524_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_063743561.1|1598701_1601449_+	TonB-dependent receptor plug domain-containing protein	NA	A0A218MME2	uncultured_virus	35.9	2.6e-101
WP_145902570.1|1602127_1603468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081078449.1|1603803_1604127_+	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_063743562.1|1604616_1606023_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_063743563.1|1606024_1607950_+	type II and III secretion system protein	NA	A7BJX1	Enterobacteria_phage	24.6	2.4e-16
WP_060383539.1|1607949_1609125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383538.1|1609117_1609639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743564.1|1609625_1610588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383536.1|1610587_1611112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383535.1|1611709_1612615_-	DUF3078 domain-containing protein	NA	NA	NA	NA	NA
WP_060383534.1|1612953_1613286_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_060383533.1|1613351_1614122_-	DUF3050 domain-containing protein	NA	A0A1L7N1A4	Ralstonia_phage	33.2	1.6e-32
WP_063743565.1|1615943_1617065_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_060383530.1|1617054_1617546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060383529.1|1617535_1617877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145902569.1|1617851_1618913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145915584.1|1619049_1619592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060383526.1|1619810_1620317_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_060383525.1|1620303_1620903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743567.1|1620899_1626602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743568.1|1626694_1631578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743569.1|1631577_1632282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743570.1|1632346_1633867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743571.1|1633866_1636911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743572.1|1636886_1643891_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_063743573.1|1643890_1644691_+	hypothetical protein	NA	NA	NA	NA	NA
1644803:1644832	attL	AAACACGCTTACGGGCGTGTTTTTTTGTGG	NA	NA	NA	NA
WP_077225773.1|1645231_1646158_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_123906726.1|1646159_1646564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743576.1|1646621_1646978_-	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	31.3	7.8e-06
WP_063744171.1|1647119_1648709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743577.1|1648769_1649804_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.7	1.5e-12
WP_063743578.1|1649796_1650573_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081248751.1|1651505_1652567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743581.1|1652574_1653261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743582.1|1653424_1653703_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_063743583.1|1653702_1653954_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_063743584.1|1653960_1654299_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063743585.1|1654454_1656038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743586.1|1656056_1657094_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.5	1.2e-11
WP_063743587.1|1657086_1657863_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063743581.1|1659729_1660416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743582.1|1660579_1660858_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_063743583.1|1660857_1661109_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_063743584.1|1661115_1661454_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063743585.1|1661609_1663193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743586.1|1663211_1664249_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.5	1.2e-11
WP_063743587.1|1664241_1665018_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1675364:1675393	attR	AAACACGCTTACGGGCGTGTTTTTTTGTGG	NA	NA	NA	NA
>prophage 4
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	1671028	1718724	3329120	integrase,tRNA	Brevibacillus_phage(30.0%)	44	1675376:1675396	1690093:1690113
WP_081248754.1|1671028_1672063_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.6	9.5e-12
WP_063743594.1|1672055_1672832_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063743596.1|1674819_1675176_+	hypothetical protein	NA	NA	NA	NA	NA
1675376:1675396	attL	GGGCGTGTTTTTTTGTGGGTT	NA	NA	NA	NA
WP_014166054.1|1675500_1675767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383517.1|1676129_1676483_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.8e-08
WP_060383516.1|1676635_1678219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383515.1|1678279_1679326_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	2.3e-13
WP_060383514.1|1679318_1680095_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081248756.1|1681026_1681872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743598.1|1681876_1682059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743599.1|1682063_1682321_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_014166054.1|1682681_1682948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383517.1|1683310_1683664_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.8e-08
WP_060383516.1|1683816_1685400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060383515.1|1685460_1686507_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	2.3e-13
WP_060383514.1|1686499_1687276_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081248757.1|1688207_1689206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158447618.1|1689795_1689957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060383508.1|1690330_1690567_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
1690093:1690113	attR	GGGCGTGTTTTTTTGTGGGTT	NA	NA	NA	NA
WP_060383507.1|1690566_1690890_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_060383506.1|1691971_1693186_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060383505.1|1693191_1693584_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_060383504.1|1693664_1694069_+	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_060383503.1|1694442_1698975_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	34.9	3.5e-175
WP_063743601.1|1699023_1700976_+	T9SS type A sorting domain-containing protein	NA	A0A2K9L5D3	Tupanvirus	27.1	2.3e-14
WP_060383501.1|1701035_1701950_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_063743602.1|1702193_1702871_+	aquaporin Z	NA	NA	NA	NA	NA
WP_060383499.1|1703079_1704165_+	porin	NA	NA	NA	NA	NA
WP_060383498.1|1704270_1705353_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_063743603.1|1705368_1705587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014166107.1|1705648_1706653_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.2	1.8e-116
WP_060383496.1|1706679_1707069_-	HIT family protein	NA	NA	NA	NA	NA
WP_060383901.1|1707085_1707562_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_063743604.1|1707718_1708144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063743605.1|1708337_1709495_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_063743606.1|1709578_1710742_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_060383492.1|1710916_1711621_-	methyltransferase	NA	NA	NA	NA	NA
WP_060383491.1|1711779_1712307_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_060383490.1|1712323_1712845_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_060383489.1|1713011_1713701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744174.1|1713932_1714883_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014166118.1|1715170_1715488_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.8	4.2e-19
WP_063743607.1|1715563_1716490_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_063743608.1|1716972_1718724_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	25.7	1.5e-17
>prophage 5
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	2207966	2216078	3329120		Escherichia_phage(33.33%)	6	NA	NA
WP_063743750.1|2207966_2210438_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	36.5	1.2e-23
WP_063743751.1|2210439_2211411_+	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	48.6	5.5e-86
WP_063744182.1|2211410_2212685_+	nucleotide sugar dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	26.8	4.3e-22
WP_063743752.1|2212710_2214084_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	34.8	2.4e-63
WP_063743753.1|2214090_2215137_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.9	6.1e-83
WP_063743754.1|2215205_2216078_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	59.0	3.9e-99
>prophage 6
NZ_CP015107	Flavobacterium columnare strain C#2 chromosome, complete genome	3329120	3064106	3134490	3329120	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(36.36%)	55	3067450:3067466	3072584:3072600
WP_063744038.1|3064106_3064979_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	33.2	2.3e-27
WP_060381903.1|3065053_3065914_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	33.7	1.9e-29
WP_127822287.1|3065910_3066165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060381901.1|3067090_3067822_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
3067450:3067466	attL	ATCAAAAGAATTGAGTT	NA	NA	NA	NA
WP_081078390.1|3068494_3068815_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_063744040.1|3070938_3072012_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.0	1.9e-31
WP_145915604.1|3072223_3072880_+	hypothetical protein	NA	NA	NA	NA	NA
3072584:3072600	attR	ATCAAAAGAATTGAGTT	NA	NA	NA	NA
WP_081248777.1|3073053_3073836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744044.1|3074050_3075202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744046.1|3075201_3076974_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_060381895.1|3077274_3077487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060381894.1|3077493_3078288_+	Fic family protein	NA	NA	NA	NA	NA
WP_063744047.1|3078405_3078969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060381892.1|3078970_3079294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744053.1|3080678_3081251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744055.1|3081260_3081572_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_063744057.1|3082150_3082855_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	3.2e-27
WP_060381890.1|3082857_3084441_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	3.9e-25
WP_060381889.1|3084509_3085097_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_060381888.1|3085096_3086098_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_060381887.1|3086540_3087731_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_060381886.1|3087772_3089425_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_081078471.1|3089434_3090262_-	DUF4835 family protein	NA	NA	NA	NA	NA
WP_063744059.1|3090314_3091523_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	27.6	2.1e-26
WP_014165513.1|3091537_3091852_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_060381883.1|3091861_3092656_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_060381882.1|3092766_3093648_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_060381881.1|3093652_3094171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060381880.1|3094272_3095025_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_063744061.1|3095044_3095965_+	metallophosphatase	NA	NA	NA	NA	NA
WP_063744062.1|3096360_3097482_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_063744063.1|3097809_3100815_-	serine hydrolase	NA	NA	NA	NA	NA
WP_060381876.1|3100824_3101307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060381875.1|3101314_3102106_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_060381874.1|3102141_3103476_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_060381873.1|3103505_3104456_-	MCE family protein	NA	NA	NA	NA	NA
WP_063744064.1|3104486_3105677_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	30.7	3.9e-17
WP_063744197.1|3105744_3108474_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_060381871.1|3108591_3108972_+	RidA family protein	NA	NA	NA	NA	NA
WP_060381868.1|3111137_3113027_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.7	3.6e-142
WP_060381867.1|3113509_3114415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063744066.1|3115283_3116192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063744067.1|3116360_3117248_-	EamA family transporter	NA	NA	NA	NA	NA
WP_060381863.1|3117331_3118987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060381862.1|3119071_3119992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060381861.1|3119993_3120539_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_081248778.1|3120585_3120897_+	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
WP_060381859.1|3121044_3122289_-	ornithine--oxo-acid transaminase	NA	NA	NA	NA	NA
WP_063744068.1|3122549_3124001_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_063744069.1|3124181_3125936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060381856.1|3125968_3126505_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_063744070.1|3126651_3130293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744071.1|3131847_3132696_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	29.6	2.7e-28
WP_063744072.1|3132750_3133587_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	28.6	1.3e-27
WP_063744073.1|3133641_3134490_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	35.4	9.2e-29
