The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	437	60490	4272433	transposase,integrase	Escherichia_phage(50.0%)	55	6172:6231	19436:19873
WP_004152392.1|437_3467_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|3576_5292_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6172:6231	attL	TTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGA	NA	NA	NA	NA
WP_001300294.1|7934_8603_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|8638_8875_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|8871_9234_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|9251_10946_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|10997_11420_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|11455_11581_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|12312_13023_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|13096_13513_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|13509_13740_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072202616.1|13696_14158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|14301_14652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|14702_15446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|15442_16219_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|16276_16534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|16662_16767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|17301_18168_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	31.1	1.0e-27
WP_000339857.1|18524_18794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173647157.1|18969_19131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|19121_19826_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|19947_20712_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
19436:19873	attR	TCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAACGCTGCCTCATCGCTAACTTTGCAACA	NA	NA	NA	NA
WP_001067855.1|23970_24675_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040211370.1|27004_27709_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_004896925.1|28593_29136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|29471_30104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|30132_31536_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000155092.1|31777_32662_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|32717_34193_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|34591_35776_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|35824_36010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|36229_36511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|36491_37265_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_040211370.1|37541_38246_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_001067855.1|40575_41280_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072094655.1|41628_43032_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|43065_44280_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|44540_45305_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|45426_46131_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201232.1|47223_47910_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|48047_48785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|49304_50774_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001067855.1|51244_51949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039463.1|52700_53087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|53095_53287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|54298_55054_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001067855.1|55318_56023_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001087807.1|56133_56370_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|56366_56732_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|56749_58435_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|58473_58899_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_145930932.1|58926_59202_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|59217_59583_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|59654_60110_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|60247_60490_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	605705	614549	4272433		Caulobacter_phage(50.0%)	9	NA	NA
WP_017628546.1|605705_606851_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
WP_004250201.1|607243_607828_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628547.1|607828_608965_+	TerD family protein	NA	NA	NA	NA	NA
WP_004245607.1|608989_609445_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004245605.1|609479_610505_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|610572_611151_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|611227_611803_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_012368337.1|611899_612580_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245601.1|612980_614549_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 3
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	1066257	1118170	4272433	capsid,tRNA,terminase,plate,lysis,portal,protease,holin,integrase,head,tail	Salmonella_phage(30.56%)	63	1075477:1075499	1105860:1105882
WP_004248524.1|1066257_1067244_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_026090407.1|1067504_1067780_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004244035.1|1068087_1068495_+	protein YgfX	NA	NA	NA	NA	NA
WP_004244033.1|1068595_1069114_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244032.1|1069221_1070163_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244030.1|1070196_1070904_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244029.1|1070913_1072647_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_096043105.1|1072818_1073916_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244024.1|1073925_1075440_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
1075477:1075499	attL	CCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_012368215.1|1075608_1076592_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.5	2.8e-98
WP_036907608.1|1076658_1076958_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	68.7	8.2e-33
WP_036907611.1|1077061_1077337_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	49.4	2.0e-17
WP_058336106.1|1077345_1077540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157849310.1|1077536_1077686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220105.1|1077694_1078090_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_006536692.1|1078107_1078365_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012368208.1|1078357_1078579_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_058336107.1|1078580_1079408_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	48.2	1.8e-61
WP_036908532.1|1079407_1079731_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_058336108.1|1079730_1082109_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.5	2.9e-165
WP_058336110.1|1082315_1082999_+	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	32.2	1.0e-14
WP_058336111.1|1083000_1083342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336112.1|1083477_1083969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336113.1|1084013_1084397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336114.1|1084983_1086012_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.8	1.4e-135
WP_058336115.1|1086011_1087766_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.0	8.8e-260
WP_058336116.1|1087938_1088748_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.4	8.9e-66
WP_058336117.1|1088763_1089909_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	1.2e-127
WP_058336118.1|1089908_1090577_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	47.1	1.1e-45
WP_036908515.1|1090654_1091110_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	6.4e-29
WP_058336119.1|1091109_1091316_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_081041683.1|1091335_1091650_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_058336121.1|1091642_1092047_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	58.1	2.7e-39
WP_058336122.1|1092043_1092547_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.9e-05
WP_012368191.1|1092521_1092959_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	50.0	8.3e-34
WP_058336123.1|1092948_1093584_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	36.3	9.0e-29
WP_012368189.1|1093649_1094276_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	57.0	4.5e-57
WP_012368188.1|1094272_1094611_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_012368187.1|1094612_1095521_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	67.2	1.9e-109
WP_012368186.1|1095513_1096125_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	5.5e-76
WP_058336124.1|1097758_1098178_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_058336125.1|1098270_1099443_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.4	6.5e-166
WP_058336126.1|1099446_1099962_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.3	7.7e-55
WP_058336127.1|1099981_1100329_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.3e-18
WP_071891011.1|1100289_1100448_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.9	2.1e-08
WP_058336128.1|1100455_1103290_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	40.9	3.0e-116
WP_036907694.1|1103289_1103754_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_058336129.1|1103753_1104851_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.8	1.7e-112
WP_058336130.1|1104903_1105122_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.8	2.4e-18
WP_004244007.1|1106419_1106629_-	hypothetical protein	NA	NA	NA	NA	NA
1105860:1105882	attR	CCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_004244005.1|1106936_1107146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|1107645_1108194_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244003.1|1108656_1109109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627941.1|1109114_1111730_+	sugar transporter	NA	NA	NA	NA	NA
WP_017627942.1|1111787_1112648_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_004244000.1|1112714_1113551_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004243999.1|1114638_1115325_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_012368174.1|1115399_1115960_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004248514.1|1115937_1116285_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012368173.1|1116469_1116715_+	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248513.1|1116827_1117067_-	YecH family protein	NA	NA	NA	NA	NA
WP_004243991.1|1117211_1117427_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004243990.1|1117678_1118170_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	1165456	1199305	4272433	capsid,terminase,lysis,portal,protease,integrase,head,tail	Proteus_phage(19.35%)	54	1164298:1164313	1172978:1172993
1164298:1164313	attL	AGAGAAAATGATTTTT	NA	NA	NA	NA
WP_058336071.1|1165456_1166638_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	69.4	8.3e-153
WP_058336070.1|1166592_1166805_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	61.8	3.1e-18
WP_058336069.1|1166791_1167115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336068.1|1167101_1167500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336067.1|1167486_1167738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336065.1|1167969_1168503_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	34.3	4.9e-20
WP_058336064.1|1168502_1169255_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	61.7	1.6e-85
WP_058336063.1|1169264_1169750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109395586.1|1169746_1169956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336061.1|1169939_1170293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336060.1|1170367_1170790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336059.1|1170786_1171086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336058.1|1171085_1171484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157849309.1|1171476_1171650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336056.1|1171633_1171840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336055.1|1171842_1172049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336054.1|1172050_1172515_-	helix-turn-helix transcriptional regulator	NA	A0A059VK24	Pseudomonas_phage	36.2	6.6e-05
WP_133177090.1|1172687_1173251_-	hypothetical protein	NA	NA	NA	NA	NA
1172978:1172993	attR	AAAAATCATTTTCTCT	NA	NA	NA	NA
WP_058336053.1|1173222_1174371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656506.1|1174650_1175349_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	44.6	5.0e-49
WP_058336052.1|1175474_1175732_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.5	1.0e-15
WP_081041682.1|1175724_1175973_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	1.8e-17
WP_058336209.1|1176233_1177799_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	69.7	6.1e-220
WP_058336208.1|1177795_1178770_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	54.9	1.0e-103
WP_058336207.1|1178769_1179153_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	72.0	2.7e-49
WP_041701226.1|1179466_1179679_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.5e-25
WP_058336191.1|1180103_1180526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336192.1|1180675_1181230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336193.1|1181251_1181554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1181739_1182009_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_058336194.1|1182008_1182479_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.5	2.2e-48
WP_058336195.1|1182621_1183086_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.3	1.2e-46
WP_058336196.1|1183139_1183646_+	HNH endonuclease	NA	A0A1B1W266	Salmonella_phage	48.4	6.9e-32
WP_155115349.1|1184406_1184562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001967215.1|1184645_1184984_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|1184986_1185199_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_063693226.1|1185322_1185790_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	3.2e-44
WP_063693229.1|1185743_1187486_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.1	5.0e-146
WP_063693233.1|1187486_1188818_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	77.0	7.0e-201
WP_058336090.1|1188814_1189666_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.6	5.4e-130
WP_058336091.1|1189677_1190892_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.4	1.9e-200
WP_058336092.1|1190937_1191150_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	81.0	6.2e-11
WP_058336093.1|1191149_1191476_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
WP_058336094.1|1191484_1191814_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	38.7	2.5e-11
WP_004251585.1|1191803_1192277_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251583.1|1192282_1192624_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_058336095.1|1192633_1193299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336096.1|1193363_1193780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173647158.1|1193824_1194052_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_058336098.1|1194092_1197380_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	47.0	4.2e-53
WP_049217140.1|1197380_1197977_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	7.1e-52
WP_006537803.1|1197976_1198558_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_004251562.1|1198569_1198875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049217138.1|1198906_1199305_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	7.1e-32
>prophage 5
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	1424227	1496844	4272433	tRNA,plate,lysis,holin,integrase,tail	Proteus_phage(13.79%)	98	1419804:1419819	1461583:1461598
1419804:1419819	attL	AAATTAGAGTCTGATG	NA	NA	NA	NA
WP_063693239.1|1424227_1425385_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.4	6.1e-177
WP_063693242.1|1425897_1426443_-	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	62.3	1.0e-57
WP_063693245.1|1426432_1426756_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	74.3	1.0e-33
WP_063693248.1|1426748_1426961_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	75.0	3.8e-24
WP_063693252.1|1427127_1427373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693255.1|1427365_1427620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693259.1|1427612_1427816_-	hypothetical protein	NA	A0A1W6JP56	Morganella_phage	53.1	3.0e-10
WP_063108484.1|1427825_1428005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036932464.1|1428034_1428361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153274246.1|1428400_1428562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693261.1|1428594_1429053_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	67.1	1.7e-50
WP_049216795.1|1429042_1429849_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	6.7e-146
WP_063693264.1|1429841_1430660_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	98.9	7.4e-161
WP_063693267.1|1430656_1430911_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	5.0e-39
WP_063693270.1|1430907_1431183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693272.1|1431403_1431595_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_155641739.1|1431659_1431824_-	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	64.7	3.6e-14
WP_060961232.1|1431858_1432449_-	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	31.3	1.8e-15
WP_004247469.1|1432824_1433010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|1433006_1433159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693275.1|1433174_1433486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049264714.1|1434124_1434502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693278.1|1434798_1435497_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.6	5.4e-43
WP_063693282.1|1435604_1435832_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	66.7	2.2e-22
WP_063693284.1|1435975_1436356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164484703.1|1436447_1436624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693285.1|1436616_1437450_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	56.2	4.7e-78
WP_145930936.1|1437453_1438821_+	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.0	4.3e-161
WP_063693295.1|1439089_1439395_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_058336236.1|1439804_1440248_+	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	61.7	9.9e-43
WP_058336239.1|1440796_1441009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336240.1|1441005_1441668_+	metallophosphoesterase	NA	K7P721	Enterobacteria_phage	62.3	1.6e-73
WP_058336241.1|1441779_1442400_+	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	54.1	1.2e-46
WP_058336243.1|1442599_1443214_+	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.1	5.6e-44
WP_058336244.1|1443683_1443899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336245.1|1443902_1444145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916901.1|1444274_1444664_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_004918415.1|1444660_1444954_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036976899.1|1444940_1445273_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_058336246.1|1445274_1445652_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	31.7	1.4e-05
WP_080591808.1|1445539_1445794_+	peptidase	NA	Q8SBD8	Shigella_phage	46.9	2.0e-11
WP_058336247.1|1446783_1446990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173647159.1|1446986_1447145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336162.1|1447927_1449415_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.3	2.6e-265
WP_058336163.1|1449414_1450785_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	6.9e-119
WP_004247498.1|1450781_1451903_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	6.1e-105
WP_004247499.1|1451972_1452218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247502.1|1454827_1455178_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_004247503.1|1455179_1455761_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	3.0e-47
WP_004247504.1|1455757_1456159_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1456204_1456861_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_049197577.1|1456912_1457218_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	54.5	1.1e-21
WP_049197578.1|1457232_1457523_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	4.1e-13
WP_049197579.1|1457614_1457986_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	64.7	1.3e-35
WP_004247510.1|1457999_1458182_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_158513325.1|1458617_1458776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197581.1|1458750_1459248_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_049195354.1|1459507_1460344_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049195353.1|1460508_1460898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058336165.1|1461050_1461452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336171.1|1461564_1461753_+	hypothetical protein	NA	A0A0H5AWA7	Pseudomonas_phage	79.0	7.7e-05
1461583:1461598	attR	AAATTAGAGTCTGATG	NA	NA	NA	NA
WP_058336166.1|1461823_1462477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693299.1|1462536_1465476_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.3	3.6e-141
WP_004247512.1|1465498_1465711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|1465750_1466041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334562.1|1466060_1466261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|1466404_1466746_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_058336168.1|1466742_1467486_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	2.5e-86
WP_046334563.1|1467482_1468193_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_058336169.1|1468189_1468777_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.4	3.8e-58
WP_058336180.1|1468828_1472272_+|tail	phage tail protein	tail	A0A1P8DTI4	Proteus_phage	57.7	0.0e+00
WP_058336181.1|1472265_1472634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336182.1|1472635_1473250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693302.1|1473302_1474715_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	52.3	9.7e-108
WP_063693305.1|1474754_1474985_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.7	2.4e-32
WP_004243643.1|1475939_1476959_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004243642.1|1477058_1477796_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.6e-56
WP_004243640.1|1478041_1478857_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004248367.1|1479237_1479537_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_017628006.1|1479539_1479944_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_017628007.1|1479940_1480390_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004248364.1|1480426_1480939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|1480947_1482435_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368088.1|1482445_1482898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|1482957_1483416_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_017628009.1|1483498_1485802_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004250719.1|1485804_1486293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|1486305_1486626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|1486594_1487407_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|1487409_1488102_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|1488098_1488443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628010.1|1488435_1489623_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_017628011.1|1489619_1490276_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628013.1|1491590_1491770_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243612.1|1492338_1492881_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243611.1|1492996_1493773_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|1493776_1494394_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_114078405.1|1494405_1496844_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.3	1.4e-260
>prophage 6
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	2020062	2030054	4272433		Escherichia_phage(66.67%)	8	NA	NA
WP_017628118.1|2020062_2022507_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
WP_004242892.1|2022518_2023136_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628119.1|2023137_2023998_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242890.1|2024137_2024749_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242888.1|2024801_2025263_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242887.1|2025262_2025949_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242886.1|2026284_2027985_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017628120.1|2027996_2030054_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
>prophage 7
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	2288694	2325819	4272433	capsid,terminase,lysis,portal,protease,integrase,head,tail	Proteus_phage(20.0%)	48	2319118:2319132	2332843:2332857
WP_063693325.1|2288694_2290083_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	52.4	4.3e-108
WP_058336219.1|2290127_2291168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336218.1|2291170_2294110_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.4	1.6e-200
WP_049219720.1|2294109_2294508_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_049219722.1|2294586_2294922_-	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_017628351.1|2294938_2295520_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_017628352.1|2295519_2296116_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628353.1|2296116_2299392_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_004242485.1|2299518_2299710_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628354.1|2299734_2300013_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017628355.1|2300009_2300426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336217.1|2300490_2301156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336216.1|2301165_2301507_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_058336215.1|2301512_2301986_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.1	1.9e-12
WP_058336214.1|2301975_2302305_-|head	phage head closure protein	head	A0A0R6PHN1	Moraxella_phage	31.8	1.6e-05
WP_058336093.1|2302313_2302640_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
WP_063693328.1|2302639_2302894_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	77.8	2.6e-11
WP_058336212.1|2302939_2304154_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.9	3.8e-201
WP_058336211.1|2304165_2305017_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.3	2.1e-129
WP_058336210.1|2305013_2306345_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	77.2	4.1e-201
WP_058336197.1|2306345_2308088_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.8	1.6e-144
WP_063693331.1|2308041_2308509_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	3.2e-44
WP_036905782.1|2308632_2308845_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_001967215.1|2308847_2309186_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_155115349.1|2309269_2309425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336196.1|2310185_2310692_-	HNH endonuclease	NA	A0A1B1W266	Salmonella_phage	48.4	6.9e-32
WP_058336195.1|2310745_2311210_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.3	1.2e-46
WP_058336194.1|2311352_2311823_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.5	2.2e-48
WP_046334538.1|2311822_2312092_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_058336193.1|2312277_2312580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336192.1|2312601_2313156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336191.1|2313305_2313728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041701226.1|2314152_2314365_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.5e-25
WP_004247136.1|2314709_2315108_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247135.1|2315135_2316161_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247134.1|2316160_2316868_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_058336190.1|2317039_2318158_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	56.6	5.2e-48
WP_058336189.1|2318167_2318347_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	4.0e-11
WP_058336188.1|2318336_2318546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900998.1|2318633_2319092_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_058336187.1|2319107_2319770_-	hypothetical protein	NA	NA	NA	NA	NA
2319118:2319132	attL	AGCCATTGGCAAAAA	NA	NA	NA	NA
WP_049210565.1|2319826_2320042_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	45.1	2.9e-08
WP_058336186.1|2320139_2320829_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	58.5	3.0e-70
WP_049217223.1|2321524_2322427_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	59.6	1.3e-97
WP_058336184.1|2322499_2323030_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.0	9.7e-53
WP_036894694.1|2323094_2323337_+	excisionase	NA	NA	NA	NA	NA
WP_049217409.1|2323317_2324445_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.6	2.8e-126
WP_004247120.1|2324565_2325819_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
2332843:2332857	attR	AGCCATTGGCAAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	2432978	2546671	4272433	capsid,tRNA,plate,lysis,protease,holin,integrase,transposase,tail	Morganella_phage(32.2%)	136	2466455:2466470	2479718:2479733
WP_036935929.1|2432978_2433545_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_063109165.1|2433481_2434201_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.0	4.0e-110
WP_049199072.1|2434204_2434903_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	1.8e-115
WP_063109161.1|2434899_2435229_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	72.5	7.3e-43
WP_036908263.1|2435374_2435584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908264.1|2435573_2435798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693346.1|2435813_2438963_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	52.8	5.7e-100
WP_063693349.1|2439034_2439442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587804.1|2439564_2440317_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	41.6	5.4e-41
WP_145930933.1|2440436_2441006_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	39.9	7.7e-32
WP_158513326.1|2441074_2441245_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_063693357.1|2441344_2441701_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_017628790.1|2441966_2442857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090520.1|2442819_2443011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247510.1|2443467_2443650_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_004247509.1|2443663_2444035_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_063693359.1|2444077_2444770_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.2	2.4e-88
WP_063073751.1|2444819_2445575_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.2e-107
WP_063693362.1|2445639_2446011_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
WP_063693365.1|2446007_2446376_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_049206412.1|2446378_2446720_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	3.1e-52
WP_017628798.1|2446721_2447099_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_063693368.1|2447141_2448092_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.8	6.0e-154
WP_036919950.1|2448097_2448784_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_063693371.1|2448858_2449923_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	50.8	5.1e-101
WP_063693374.1|2449931_2451308_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	1.6e-211
WP_036895049.1|2451309_2452794_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	3.6e-270
WP_004247495.1|2452796_2453399_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_165439127.1|2453432_2453591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693377.1|2453587_2454007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173647160.1|2453996_2454560_-	Rha family transcriptional regulator	NA	A0A1X9SFL9	Acinetobacter_phage	52.2	6.7e-20
WP_063693380.1|2454981_2455401_-	hypothetical protein	NA	Q716E1	Shigella_phage	46.8	1.4e-25
WP_081251376.1|2455397_2455847_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	80.3	9.1e-52
WP_036976899.1|2455848_2456181_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|2456167_2456461_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014656499.1|2456457_2456847_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_063693384.1|2457306_2458062_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	46.6	9.9e-51
WP_063693385.1|2458058_2458250_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.0e-28
WP_063693388.1|2458249_2458870_-	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	54.1	9.3e-47
WP_158513327.1|2458832_2458985_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	76.7	3.1e-12
WP_063693391.1|2458981_2459644_-	metallophosphoesterase	NA	K7P721	Enterobacteria_phage	62.3	7.3e-74
WP_155120990.1|2459640_2459784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693394.1|2459786_2460230_-	recombination protein NinB	NA	K7P7B8	Enterobacteria_phage	53.9	3.1e-36
WP_063693397.1|2460231_2460441_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	96.8	9.1e-31
WP_071891002.1|2460433_2460616_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_063693399.1|2460709_2460958_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_063693402.1|2460944_2461166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693405.1|2461456_2462413_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	55.0	2.0e-101
WP_063693408.1|2462375_2464013_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	67.7	5.2e-206
WP_063693411.1|2464015_2464465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080633834.1|2464707_2465067_-	hypothetical protein	NA	A0A088C4S1	Shewanella_sp._phage	41.8	4.2e-07
WP_063693414.1|2465154_2465502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693416.1|2465704_2465932_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	68.0	4.9e-22
WP_063693419.1|2466040_2466739_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.6	7.0e-43
2466455:2466470	attL	ATGATCACTGTAAAAG	NA	NA	NA	NA
WP_145930934.1|2466814_2467279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693425.1|2467271_2467844_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_158513328.1|2468233_2468734_+	HNH endonuclease	NA	C4ML07	Xanthomonas_virus	39.3	7.1e-21
WP_145930935.1|2468749_2469238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063108491.1|2469430_2469778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108490.1|2469780_2470101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367608.1|2470211_2470439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693433.1|2470694_2470970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693436.1|2470966_2471152_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.4	3.4e-21
WP_063693439.1|2471148_2472033_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.5	1.5e-95
WP_081251378.1|2472029_2472728_+	YqaJ viral recombinase family protein	NA	A0A2L1IV73	Escherichia_phage	57.0	2.0e-74
WP_063693441.1|2472717_2473176_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	67.8	1.1e-49
WP_153274246.1|2473208_2473370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693443.1|2473442_2473712_+	hypothetical protein	NA	A0A248SL63	Klebsiella_phage	66.7	3.5e-19
WP_063108484.1|2473708_2473888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693259.1|2473897_2474101_+	hypothetical protein	NA	A0A1W6JP56	Morganella_phage	53.1	3.0e-10
WP_063693255.1|2474093_2474348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693252.1|2474340_2474586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173647161.1|2474743_2474917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693446.1|2474909_2475257_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	68.5	3.6e-32
WP_063693449.1|2475246_2475792_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	62.6	1.6e-58
WP_063693452.1|2476080_2476287_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_063693505.1|2476290_2477475_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.8	6.8e-115
WP_004244693.1|2477908_2478238_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004244692.1|2478240_2478525_-	acylphosphatase	NA	NA	NA	NA	NA
WP_004244691.1|2478724_2479045_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_017628408.1|2479109_2479523_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_004244689.1|2479662_2480121_+	methylglyoxal synthase	NA	NA	NA	NA	NA
2479718:2479733	attR	ATGATCACTGTAAAAG	NA	NA	NA	NA
WP_017628409.1|2480125_2482177_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	2.3e-17
WP_017628410.1|2482292_2484467_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_004244685.1|2484596_2485211_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_004247687.1|2485436_2485991_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_004247686.1|2486339_2487428_+	porin OmpA	NA	NA	NA	NA	NA
WP_026090481.1|2487613_2488060_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_017628411.1|2488424_2490167_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004244680.1|2490250_2490769_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_004244679.1|2491084_2491255_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004244678.1|2491743_2492148_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_017628412.1|2492235_2492808_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004244676.1|2492807_2494460_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_004244675.1|2494452_2495757_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_004244674.1|2495834_2497766_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
WP_004247681.1|2497772_2499887_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_049194712.1|2499996_2501139_+	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_012367736.1|2501405_2501957_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004251935.1|2502171_2503182_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004247678.1|2503538_2504570_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_049198948.1|2504731_2507347_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
WP_049198950.1|2507688_2508903_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	9.4e-43
WP_017827340.1|2508917_2509109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628416.1|2509182_2510583_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.6	6.9e-82
WP_121910153.1|2510927_2512028_+	porin	NA	Q1MVN1	Enterobacteria_phage	54.2	3.6e-102
WP_004244662.1|2512380_2513571_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_156868377.1|2513702_2513858_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_049194410.1|2513995_2514958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244657.1|2515851_2516466_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_071587364.1|2516477_2517029_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	63.3	3.2e-14
WP_049195263.1|2517233_2517551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194413.1|2517800_2518718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247666.1|2519119_2519683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080974994.1|2520156_2520726_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_046335376.1|2520791_2521196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000326.1|2521192_2521702_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
WP_049195076.1|2522572_2522983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495335.1|2522982_2523732_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	59.4	1.2e-29
WP_152964539.1|2523942_2524083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195253.1|2524244_2524712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335381.1|2524711_2524975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194460.1|2525781_2526237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894566.1|2527042_2527510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195080.1|2527736_2528348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693455.1|2528375_2533076_-	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
WP_004251951.1|2533140_2533560_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_053828341.1|2533571_2535764_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004246976.1|2535847_2536366_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247653.1|2538263_2538764_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004247652.1|2538784_2540263_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004244624.1|2540268_2540700_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_049194444.1|2542447_2543485_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|2543489_2544758_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|2544759_2545311_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_026164596.1|2545312_2546671_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	2787288	2842723	4272433	tRNA,tail,lysis,integrase	Escherichia_phage(15.91%)	81	2788994:2789012	2842792:2842810
WP_012367653.1|2787288_2788956_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
2788994:2789012	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_004244376.1|2789200_2789341_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	89.1	4.7e-15
WP_004247530.1|2789842_2790388_+	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
WP_004247529.1|2790452_2791178_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004247528.1|2791187_2793722_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_058336178.1|2793731_2794814_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_058336177.1|2794914_2795220_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247524.1|2795923_2796184_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905768.1|2796200_2796467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2796463_2797150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2797149_2797482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556815.1|2801716_2802304_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.4	2.2e-58
WP_046334563.1|2802300_2803011_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_058336168.1|2803007_2803751_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	2.5e-86
WP_004247516.1|2803747_2804089_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_046334562.1|2804232_2804433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|2804452_2804743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247512.1|2804782_2804995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693299.1|2805017_2807957_-|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.3	3.6e-141
WP_058336166.1|2808016_2808670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336171.1|2808740_2808929_-	hypothetical protein	NA	A0A0H5AWA7	Pseudomonas_phage	79.0	7.7e-05
WP_058336165.1|2809041_2809443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195353.1|2809595_2809985_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195354.1|2810149_2810986_+	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049197581.1|2811245_2811743_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_158513325.1|2811717_2811876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247510.1|2812311_2812494_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_049197579.1|2812507_2812879_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	64.7	1.3e-35
WP_049197578.1|2812970_2813261_-	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	4.1e-13
WP_049197577.1|2813275_2813581_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	54.5	1.1e-21
WP_004247505.1|2813632_2814289_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004247504.1|2814334_2814736_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247503.1|2814732_2815314_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	3.0e-47
WP_004247502.1|2815315_2815666_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_004245968.1|2815668_2816148_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_107033975.1|2816187_2816472_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004247501.1|2816474_2817428_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.1e-126
WP_058336164.1|2817441_2818203_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	58.9	5.8e-67
WP_004247499.1|2818299_2818545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247498.1|2818614_2819736_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	6.1e-105
WP_004247497.1|2819732_2821103_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	5.3e-119
WP_058336162.1|2821102_2822590_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.3	2.6e-265
WP_017628804.1|2822592_2823195_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_004245978.1|2823228_2823387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|2823383_2823590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907970.1|2824517_2824979_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
WP_012367623.1|2824981_2825140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628809.1|2825121_2825592_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_058336161.1|2825591_2825861_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	7.9e-19
WP_036976679.1|2825914_2826337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336160.1|2826681_2827140_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_046335273.1|2827379_2828012_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	33.8	2.1e-22
WP_046335274.1|2828011_2828368_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	72.4	1.4e-44
WP_004245984.1|2828364_2828655_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_012367619.1|2828733_2829183_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	3.7e-13
WP_012367618.1|2829208_2830594_-	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_058336159.1|2830593_2831361_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_173647162.1|2831357_2831531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336158.1|2831626_2831974_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	76.8	2.4e-36
WP_004245989.1|2832119_2832329_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_049213521.1|2832411_2833095_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	99.6	7.9e-132
WP_063693508.1|2833199_2834201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740953.1|2834435_2834642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|2834700_2835018_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_004247470.1|2835033_2835186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|2835182_2835368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247467.1|2835532_2835808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336157.1|2835923_2836184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336156.1|2836404_2836680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336155.1|2836676_2836928_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.0	9.2e-38
WP_058336154.1|2836924_2837809_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.2	2.0e-95
WP_081041685.1|2837805_2838504_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.8	9.1e-75
WP_058336153.1|2838493_2838991_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	68.9	9.4e-50
WP_058336152.1|2839006_2839294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336151.1|2839313_2839553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336149.1|2839887_2840241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168713144.1|2840398_2840572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114078407.1|2840596_2840896_+	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	45.9	8.0e-12
WP_058336148.1|2840882_2841485_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	53.3	6.5e-53
WP_004246013.1|2841519_2841765_+	excisionase	NA	NA	NA	NA	NA
WP_026090525.1|2841721_2842723_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	9.7e-70
2842792:2842810	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	2878610	2890570	4272433		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004246054.1|2878610_2879822_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|2880020_2880284_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|2880641_2881286_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|2881386_2882352_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|2882367_2882742_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_162492994.1|2883485_2883626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246068.1|2883810_2884020_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|2884217_2884691_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|2884972_2885197_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|2885208_2885613_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004252248.1|2885641_2887768_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_012367584.1|2887793_2888762_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004246075.1|2889370_2890570_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 11
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	4091463	4161717	4272433	transposase,tRNA,protease,integrase	Stx_converting_phage(10.0%)	59	4104045:4104061	4155385:4155401
WP_017628739.1|4091463_4092048_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004249797.1|4092196_4092601_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
WP_012368617.1|4092898_4093564_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_004246560.1|4093960_4094617_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004246561.1|4095030_4095693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336146.1|4095977_4096616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246563.1|4096640_4096955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249799.1|4097128_4099042_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246565.1|4099063_4099738_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004249975.1|4099922_4100372_+	metal-binding protein	NA	NA	NA	NA	NA
WP_053828402.1|4100466_4101987_-	MFS transporter	NA	NA	NA	NA	NA
WP_017628741.1|4101979_4103083_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012368614.1|4103204_4103843_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246570.1|4103935_4105342_-	YfcC family protein	NA	NA	NA	NA	NA
4104045:4104061	attL	ACTTTACCTACCGCCAG	NA	NA	NA	NA
WP_004246571.1|4105351_4106485_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_012368613.1|4107359_4108172_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_017628742.1|4108260_4108548_+	YjeO family protein	NA	NA	NA	NA	NA
WP_004249808.1|4108575_4108980_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_017628743.1|4109054_4110182_-	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023843642.1|4110246_4111254_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628744.1|4111302_4112994_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004249814.1|4113006_4114083_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-26
WP_001353740.1|4115011_4115251_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|4116747_4117221_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|4117315_4117840_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_001206315.1|4117897_4118686_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|4118761_4119259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4119319_4119691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271300.1|4120100_4120478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251879.1|4120708_4122325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001243518.1|4122325_4123852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001276994.1|4123854_4125522_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|4125518_4127627_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|4127613_4128435_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246586.1|4128594_4130421_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_004246587.1|4130578_4131952_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246588.1|4132102_4132519_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246589.1|4132540_4133923_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246591.1|4133957_4134821_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246592.1|4134878_4136420_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246594.1|4136434_4136968_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246595.1|4136980_4137451_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246596.1|4137512_4137752_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246597.1|4137797_4138622_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246598.1|4138653_4139031_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246599.1|4139646_4140273_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017628745.1|4140269_4142168_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004249871.1|4142547_4142988_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246603.1|4143088_4143550_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004246604.1|4143710_4144703_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246605.1|4144703_4146161_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_017628746.1|4146168_4147668_-	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	38.0	3.0e-22
WP_004246607.1|4147948_4148875_+	ribokinase	NA	NA	NA	NA	NA
WP_012368605.1|4148956_4150354_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004249867.1|4150434_4151121_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628597.1|4157867_4159286_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
4155385:4155401	attR	CTGGCGGTAGGTAAAGT	NA	NA	NA	NA
WP_012368603.1|4159289_4159982_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_058336253.1|4160068_4160437_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.1e-38
WP_063693479.1|4160508_4161717_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
>prophage 12
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	4169667	4229385	4272433	transposase,tRNA,integrase	Escherichia_phage(29.41%)	52	4216691:4216750	4223089:4223203
WP_036895833.1|4169667_4170084_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_058336251.1|4170106_4171303_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.0	7.0e-184
WP_004246627.1|4171363_4172392_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004249859.1|4172393_4173104_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246629.1|4173100_4173775_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249858.1|4173819_4174635_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_017628602.1|4174716_4175661_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249857.1|4175815_4176910_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_012368596.1|4176962_4177484_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004246639.1|4178064_4179180_-	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
WP_017628603.1|4179186_4179720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628604.1|4179703_4180303_-	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_017628605.1|4180290_4181115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628606.1|4181231_4183766_+	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_004249852.1|4184099_4184903_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004246647.1|4184992_4185550_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249850.1|4185905_4188014_+	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_004246651.1|4188087_4188501_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_004246652.1|4188528_4189413_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_058336250.1|4189617_4191237_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	6.4e-140
WP_004249849.1|4191352_4192054_-	pirin family protein	NA	NA	NA	NA	NA
WP_012368590.1|4193205_4194411_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004246659.1|4194719_4196219_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_004246660.1|4196290_4196623_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246661.1|4197036_4197471_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_017628608.1|4197724_4199065_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246663.1|4199193_4199943_+	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_012368588.1|4200013_4200760_-	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_004249995.1|4200763_4202806_-	oligopeptidase A	NA	NA	NA	NA	NA
WP_001218908.1|4203439_4204624_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_169774393.1|4206604_4207408_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_000412211.1|4209732_4210392_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4210592_4210970_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|4213757_4214462_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001206317.1|4215291_4216083_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777555.1|4216175_4216649_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
4216691:4216750	attL	CTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACATCGACCCACGGCGTAACGCGC	NA	NA	NA	NA
WP_000845048.1|4216805_4217819_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159185.1|4218165_4218732_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	7.9e-45
WP_011191340.1|4218860_4219109_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_173647164.1|4219241_4219388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|4219378_4220083_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|4220228_4221044_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|4221173_4221878_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071891019.1|4222019_4223033_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	4.0e-71
WP_032488579.1|4223212_4223767_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
4223089:4223203	attR	GCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGCATCACAAAG	NA	NA	NA	NA
WP_002089484.1|4223842_4224307_+	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_001102919.1|4224425_4224938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206316.1|4225350_4226142_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|4226305_4226653_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4226646_4227486_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4227613_4228114_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|4228620_4229385_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 13
NZ_CP015347	Proteus mirabilis strain AOUC-001 chromosome, complete genome	4272433	4235607	4246665	4272433	integrase	Escherichia_phage(25.0%)	11	4231953:4231970	4251394:4251411
4231953:4231970	attL	CGCGCATCTTGTCGAGCA	NA	NA	NA	NA
WP_001776122.1|4235607_4236573_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|4237042_4238530_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|4238935_4239367_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|4239366_4240638_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|4240719_4241694_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|4241693_4242899_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|4243313_4243583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|4243939_4244806_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	31.1	1.0e-27
WP_032409716.1|4245340_4245445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|4245573_4245831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|4245888_4246665_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
4251394:4251411	attR	TGCTCGACAAGATGCGCG	NA	NA	NA	NA
