The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	238167	246266	5400819		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|238167_238452_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|238490_240125_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_164852166.1|240528_242070_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	6.8e-22
WP_000833094.1|242456_243782_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_000929886.1|244075_244777_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-39
WP_000719237.1|244760_246266_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-30
>prophage 2
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	278500	286876	5400819		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625682.1|278500_279808_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170545.1|279896_280616_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|280608_280863_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666782.1|280859_281543_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055594.1|281526_283746_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000879026.1|283730_285146_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262424.1|285251_286292_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_000088578.1|286288_286876_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	7.0e-28
>prophage 3
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	637952	646125	5400819		Bacillus_phage(66.67%)	8	NA	NA
WP_003276662.1|637952_638939_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.4	1.2e-16
WP_000085771.1|639014_639536_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822549.1|639701_641093_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	2.6e-33
WP_000565487.1|641104_641782_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	2.9e-33
WP_063674904.1|641957_643205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277056.1|643338_643869_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	34.3	2.5e-16
WP_000831286.1|643881_644226_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_063674906.1|644673_646125_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.2	2.2e-139
>prophage 4
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	651883	691721	5400819	tail,terminase,integrase,portal,holin,head,protease,capsid	Bacillus_phage(64.71%)	58	649184:649198	693296:693310
649184:649198	attL	TTAATCGGTTTAGTA	NA	NA	NA	NA
WP_001132865.1|651883_652780_+	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.2	3.3e-05
WP_000716151.1|652776_653172_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_044797803.1|653576_654737_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	100.0	2.2e-219
WP_063674912.1|654806_655232_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	99.3	2.2e-76
WP_044797807.1|655247_655670_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	100.0	2.8e-71
WP_044797808.1|655941_656127_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	100.0	9.2e-27
WP_044797810.1|656126_656399_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	100.0	5.3e-47
WP_172452020.1|656412_656568_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	100.0	6.7e-23
WP_044797811.1|656584_657415_+	ORF6C domain-containing protein	NA	A0A1C8E9A5	Bacillus_phage	100.0	4.0e-154
WP_063674917.1|657426_657615_+	hypothetical protein	NA	A0A0S2MVG8	Bacillus_phage	98.4	1.6e-26
WP_000453496.1|657641_658076_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	97.9	9.0e-73
WP_063674919.1|658094_658808_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.2	9.4e-128
WP_000355710.1|658807_659023_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	4.2e-31
WP_080350656.1|658952_659294_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	100.0	1.4e-52
WP_042596611.1|659387_660341_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	3.8e-148
WP_042596609.1|660352_660832_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	94.3	9.9e-81
WP_042596607.1|660824_661055_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	8.2e-33
WP_042596606.1|661078_661621_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	93.0	1.5e-80
WP_042596604.1|661659_662094_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	93.8	4.3e-75
WP_042596602.1|662152_662443_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	8.4e-51
WP_170951649.1|662447_662588_+	hypothetical protein	NA	A0A1C8E9B6	Bacillus_phage	95.7	3.6e-15
WP_001093039.1|662589_663381_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_042596600.1|663463_663823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540089.1|663861_664389_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.9	8.3e-97
WP_063674920.1|664385_664712_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	95.4	5.7e-56
WP_003308641.1|664749_665151_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_015670519.1|665532_665952_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_079246335.1|666003_666186_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	2.7e-15
WP_000476218.1|666522_667272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340442.1|667312_667495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063674923.1|667506_667701_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	84.2	2.8e-18
WP_001177575.1|667815_668025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378697.1|668031_668289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177573.1|668279_668654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666400.1|668619_668955_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	2.7e-53
WP_000253626.1|668948_669446_+	HNH endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	43.9	9.8e-31
WP_000763336.1|669581_669938_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_000635296.1|669934_671590_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.7	0.0e+00
WP_049816489.1|671655_672762_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.3	2.0e-185
WP_000216401.1|672745_673522_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234858.1|673541_674705_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	9.4e-210
WP_001246765.1|674717_675014_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	88.2	3.1e-40
WP_001247275.1|675015_675369_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.0	1.6e-56
WP_000997536.1|675370_675715_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	83.9	3.3e-46
WP_063674926.1|675711_676041_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_063674928.1|676041_676635_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	92.3	3.3e-102
WP_000415931.1|676641_677004_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_063674930.1|677234_678470_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	72.8	1.4e-150
WP_063674933.1|678747_681135_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	43.2	5.4e-42
WP_063674935.1|681176_682646_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	78.7	7.2e-231
WP_063674937.1|682642_687496_+|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	83.6	0.0e+00
WP_001039175.1|687511_687886_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	99.2	9.2e-66
WP_000373898.1|687923_688349_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_021729802.1|688348_689305_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	100.0	3.7e-188
WP_063676289.1|689620_690187_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.0	1.3e-23
WP_063674939.1|690341_690560_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	97.2	5.9e-33
WP_063674941.1|690583_690877_+	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	97.9	7.5e-47
WP_044797846.1|690893_691721_-	helix-turn-helix domain-containing protein	NA	A0A1C8EA76	Bacillus_phage	100.0	5.1e-149
693296:693310	attR	TTAATCGGTTTAGTA	NA	NA	NA	NA
>prophage 5
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	1025252	1065559	5400819	tail,terminase,integrase,portal,head,protease,transposase,capsid	Bacillus_phage(49.06%)	60	1025186:1025205	1065883:1065902
1025186:1025205	attL	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
WP_000135925.1|1025252_1026410_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	89.1	1.9e-202
WP_000253874.1|1026479_1026905_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	98.6	3.8e-76
WP_000102962.1|1026920_1027343_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	75.0	1.3e-52
WP_001236353.1|1027747_1028977_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000361154.1|1029346_1029529_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	86.7	6.7e-22
WP_000127563.1|1029531_1029804_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	97.8	4.5e-46
WP_000788387.1|1029818_1029974_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	82.0	3.6e-16
WP_001072822.1|1029988_1030744_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	86.2	3.1e-113
WP_001186271.1|1030755_1030944_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	100.0	7.2e-27
WP_000453493.1|1030970_1031405_+	hypothetical protein	NA	A0A1C8E9A2	Bacillus_phage	97.9	2.4e-73
WP_063675055.1|1031423_1032137_+	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	98.7	1.4e-126
WP_063675056.1|1032136_1032352_+	hypothetical protein	NA	A0A2H4J3B2	uncultured_Caudovirales_phage	90.1	2.0e-28
WP_063675057.1|1032284_1032623_+	hypothetical protein	NA	A0A2H4J6H7	uncultured_Caudovirales_phage	97.3	6.8e-52
WP_063675058.1|1032708_1033626_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	93.1	6.4e-129
WP_042596609.1|1033637_1034117_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	94.3	9.9e-81
WP_042596607.1|1034109_1034340_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	8.2e-33
WP_042596606.1|1034363_1034906_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	93.0	1.5e-80
WP_042596604.1|1034944_1035379_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	93.8	4.3e-75
WP_042596602.1|1035437_1035728_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	8.4e-51
WP_170951649.1|1035732_1035873_+	hypothetical protein	NA	A0A1C8E9B6	Bacillus_phage	95.7	3.6e-15
WP_001093039.1|1035874_1036666_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_042596600.1|1036748_1037108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540089.1|1037146_1037674_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.9	8.3e-97
WP_063674920.1|1037670_1037997_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	95.4	5.7e-56
WP_003308641.1|1038034_1038436_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_015670519.1|1038817_1039237_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_079246335.1|1039288_1039471_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	2.7e-15
WP_000476218.1|1039807_1040557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340442.1|1040597_1040780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063674923.1|1040791_1040986_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	84.2	2.8e-18
WP_001177575.1|1041100_1041310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378697.1|1041316_1041574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177573.1|1041564_1041939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666400.1|1041904_1042240_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	2.7e-53
WP_000253626.1|1042233_1042731_+	HNH endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	43.9	9.8e-31
WP_000763336.1|1042866_1043223_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_000635296.1|1043219_1044875_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.7	0.0e+00
WP_049816489.1|1044940_1046047_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.3	2.0e-185
WP_000216401.1|1046030_1046807_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234858.1|1046826_1047990_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	9.4e-210
WP_001246765.1|1048002_1048299_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	88.2	3.1e-40
WP_001247275.1|1048300_1048654_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.0	1.6e-56
WP_000997536.1|1048655_1049000_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	83.9	3.3e-46
WP_063674926.1|1048996_1049326_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_063674928.1|1049326_1049920_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	92.3	3.3e-102
WP_000415931.1|1049926_1050289_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_063674930.1|1050519_1051755_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	72.8	1.4e-150
WP_063674933.1|1052032_1054420_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	43.2	5.4e-42
WP_063674935.1|1054461_1055931_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	78.7	7.2e-231
WP_063675059.1|1055927_1060781_+|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_063675060.1|1060796_1061171_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	97.6	2.3e-64
WP_063675061.1|1061208_1061490_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	82.4	6.9e-34
WP_063675062.1|1061492_1061705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675063.1|1061704_1062568_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	72.0	1.2e-116
WP_063675064.1|1062610_1062925_-	hypothetical protein	NA	A0A2H4J842	uncultured_Caudovirales_phage	74.7	1.3e-25
WP_063675065.1|1062927_1063398_-	hypothetical protein	NA	A0A2H4JFX9	uncultured_Caudovirales_phage	60.9	3.3e-52
WP_063675066.1|1063712_1064036_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	61.8	5.5e-27
WP_063675067.1|1064175_1064394_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	4.7e-30
WP_000100788.1|1064418_1064709_+	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_063676304.1|1064725_1065559_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	85.2	7.9e-126
1065883:1065902	attR	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
>prophage 6
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	1875408	1882856	5400819		Bacillus_phage(83.33%)	7	NA	NA
WP_063675233.1|1875408_1876695_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.6	3.8e-10
WP_001194305.1|1876793_1877558_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453881.1|1877793_1879554_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	99.2	1.5e-275
WP_000612415.1|1879594_1880272_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_017763041.1|1880268_1881342_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	99.4	1.4e-191
WP_000818985.1|1881569_1882289_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_133963882.1|1882391_1882856_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	98.6	1.8e-71
>prophage 7
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	2066296	2073175	5400819		Bacillus_phage(33.33%)	9	NA	NA
WP_000427801.1|2066296_2066572_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000478848.1|2066770_2067034_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	3.4e-06
WP_001012095.1|2067065_2067239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000541073.1|2067681_2068029_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.1	1.1e-09
WP_000109862.1|2068215_2069289_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.9e-74
WP_000709202.1|2069285_2069411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675279.1|2069707_2070526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165956.1|2070635_2071283_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.7	5.0e-11
WP_063675280.1|2071279_2073175_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	3.7e-46
>prophage 8
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	2328709	2372247	5400819	tail,terminase,portal	Bacillus_phage(65.62%)	59	NA	NA
WP_063675337.1|2328709_2329249_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	37.6	6.7e-25
WP_033697005.1|2329260_2330040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675339.1|2330600_2330795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172452006.1|2331176_2331332_+	hypothetical protein	NA	D2XR51	Bacillus_phage	89.8	4.5e-19
WP_063675340.1|2331370_2331691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675341.1|2331873_2332194_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	57.0	2.1e-26
WP_155728775.1|2332230_2332407_+	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	77.6	3.0e-19
WP_063675342.1|2332448_2332907_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	50.9	7.4e-09
WP_063675343.1|2332893_2333538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675344.1|2333564_2333882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675345.1|2333898_2334762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790088.1|2334764_2334911_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_042597799.1|2335036_2335231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675346.1|2335255_2335636_+	hypothetical protein	NA	A0A088F787	Idiomarinaceae_phage	61.3	5.5e-26
WP_063675347.1|2335632_2335914_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	58.7	2.1e-14
WP_042597805.1|2335915_2336113_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	49.1	6.6e-07
WP_063676328.1|2336336_2336567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675348.1|2336566_2337094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675349.1|2337261_2337612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675350.1|2337848_2338229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025118128.1|2338635_2339199_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	46.6	7.4e-35
WP_001086032.1|2339396_2339825_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_063675351.1|2339841_2341557_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	54.5	7.5e-155
WP_063675352.1|2341573_2343091_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	29.6	2.0e-66
WP_063675353.1|2343149_2343935_+	phage scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_063675354.1|2343995_2345120_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_063675355.1|2345169_2345394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675356.1|2345422_2345764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698994.1|2345768_2346575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698996.1|2346578_2346953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698998.1|2346952_2347312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033699000.1|2347314_2347722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675357.1|2347735_2348239_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_053513156.1|2348289_2348502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675358.1|2348498_2348717_+	hypothetical protein	NA	D2XR60	Bacillus_phage	56.9	6.2e-14
WP_000818630.1|2348787_2349165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931846.1|2349254_2349509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676330.1|2349545_2353442_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	5.5e-12
WP_063675359.1|2353456_2354953_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	79.5	6.4e-219
WP_081252864.1|2354949_2359572_+|tail	tail fiber domain-containing protein	tail	A0A0A7AQG2	Bacillus_phage	50.3	0.0e+00
WP_016081457.1|2359614_2359851_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	3.4e-18
WP_063675360.1|2359850_2360090_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	96.2	5.9e-34
WP_063675361.1|2360086_2361151_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	98.0	2.2e-205
WP_063676334.1|2361212_2362232_-	zinc-ribbon domain-containing protein	NA	A0A1B1P7Q7	Bacillus_phage	54.2	6.3e-109
WP_063675362.1|2362231_2362558_-	hypothetical protein	NA	A0A1B1P7R1	Bacillus_phage	47.2	4.3e-19
WP_063675363.1|2362621_2362951_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	48.6	1.0e-20
WP_001999824.1|2363027_2363294_-	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	61.8	4.1e-20
WP_142286838.1|2363448_2363571_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	67.6	4.3e-09
WP_061884062.1|2364214_2364415_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	1.1e-12
WP_033699018.1|2364600_2364870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675364.1|2364866_2365169_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	58.2	1.0e-27
WP_000170792.1|2365165_2365348_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	86.7	4.4e-21
WP_063675365.1|2365463_2366648_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	63.7	1.1e-141
WP_033699025.1|2366589_2367210_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	78.2	3.3e-92
WP_063676339.1|2367699_2369163_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	51.5	2.7e-137
WP_050821864.1|2369168_2369462_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_000691159.1|2369708_2370395_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017763155.1|2370554_2370869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063675366.1|2370897_2372247_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	7.4e-57
>prophage 9
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	3574264	3583563	5400819	bacteriocin	Bacillus_phage(40.0%)	14	NA	NA
WP_000413739.1|3574264_3574885_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976234.1|3574975_3575779_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031383.1|3575779_3576322_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3576314_3576638_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392443.1|3577009_3577240_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_001051376.1|3577301_3578144_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	1.4e-32
WP_033668930.1|3578267_3579254_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	1.7e-34
WP_063675606.1|3579491_3579878_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	68.5	1.9e-45
WP_000900737.1|3579852_3580017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511422.1|3580286_3581174_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	64.6	1.0e-94
WP_001189066.1|3581326_3581521_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	72.6	2.6e-16
WP_063675607.1|3581532_3582291_-	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.8	1.2e-96
WP_000283430.1|3582487_3582700_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000708856.1|3582903_3583563_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 10
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	4267651	4325105	5400819	protease,tRNA,coat	Klosneuvirus(22.22%)	55	NA	NA
WP_000125365.1|4267651_4268791_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354016.1|4268803_4269856_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|4269875_4270076_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_063675731.1|4270072_4271074_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464512.1|4271079_4271697_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823610.1|4271885_4272830_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871202.1|4272841_4273372_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000874883.1|4273853_4274234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093530.1|4274267_4274915_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_063675733.1|4275093_4276953_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025283.1|4277179_4278286_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092241.1|4278317_4279151_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138541.1|4279170_4280700_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973781.1|4280852_4281995_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.2	8.5e-30
WP_000812273.1|4281994_4282537_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000511662.1|4282616_4283264_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000796366.1|4283456_4283927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621701.1|4284104_4284956_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026364.1|4285052_4286963_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011408.1|4287012_4288935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114530.1|4288909_4289686_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
WP_000865417.1|4289779_4290862_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4290851_4291559_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497121.1|4291747_4293034_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003585.1|4293038_4293581_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|4293644_4293935_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002082112.1|4293938_4294283_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4294294_4294603_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_063675735.1|4294772_4296161_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_063675737.1|4296228_4297089_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_000797477.1|4297081_4297828_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4297961_4298759_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391514.1|4298761_4299448_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975762.1|4299483_4300029_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135484.1|4300043_4300895_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4300936_4301956_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013396.1|4302113_4302791_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000720491.1|4302837_4303413_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360997.1|4303645_4304596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017763622.1|4304760_4306062_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072243.1|4306155_4308801_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	5.5e-165
WP_000350652.1|4309284_4310310_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063675739.1|4310376_4311348_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712938.1|4311458_4312745_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087080.1|4312744_4313734_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_063675741.1|4313754_4314507_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226403.1|4314509_4315439_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009002.1|4315454_4316288_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_000547868.1|4316305_4317640_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133913.1|4318056_4318509_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359773.1|4318511_4318928_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4318962_4319559_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097281.1|4319555_4321886_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	7.3e-177
WP_000119171.1|4322068_4323739_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4323845_4325105_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 11
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	4388394	4396082	5400819		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221121.1|4388394_4389318_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
WP_000247670.1|4389443_4390379_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	4.4e-24
WP_000018046.1|4390380_4391073_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	26.9	6.8e-06
WP_001293576.1|4391243_4391417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4391417_4391612_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255945.1|4391651_4392851_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4393145_4393469_+	heme oxygenase	NA	NA	NA	NA	NA
WP_002162479.1|4393541_4394306_-	class B sortase	NA	NA	NA	NA	NA
WP_063675784.1|4394338_4395109_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_001036829.1|4395098_4396082_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.9e-17
>prophage 12
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	4885908	4979717	5400819	tail,terminase,integrase,holin,portal,head,tRNA,plate,protease,capsid,bacteriocin	Bacillus_phage(48.21%)	112	4965211:4965263	4979944:4979996
WP_063675970.1|4885908_4887171_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	3.1e-89
WP_001057103.1|4887540_4888458_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573651.1|4888841_4889237_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_063675972.1|4889433_4890936_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000714043.1|4890968_4892027_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000639338.1|4892372_4892777_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568584.1|4892773_4893130_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980956.1|4893160_4893400_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000086300.1|4893479_4893713_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_063675974.1|4893872_4895066_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.4	2.0e-42
WP_044783103.1|4895071_4896619_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.7	4.7e-47
WP_001071083.1|4897055_4897571_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_063675976.1|4897856_4898333_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000834707.1|4898381_4898786_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002181000.1|4898835_4899792_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001001093.1|4900229_4900787_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	27.5	1.2e-05
WP_063676385.1|4900824_4901259_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_063675978.1|4901603_4902569_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_002008929.1|4902832_4903264_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000926482.1|4903431_4904013_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_041488180.1|4904068_4904518_+	cyanase	NA	NA	NA	NA	NA
WP_001034722.1|4904645_4905926_+	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_017763741.1|4905960_4907499_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590056.1|4907933_4908686_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631243.1|4908682_4909747_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000041823.1|4909743_4910760_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	1.0e-58
WP_000749440.1|4910779_4911799_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001250260.1|4912184_4912862_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172452013.1|4913454_4914000_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_001123920.1|4914754_4915222_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_063675980.1|4915471_4917910_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.3e-91
WP_000761986.1|4918052_4918793_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557266.1|4918953_4919187_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|4919281_4919974_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|4919970_4920339_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_063675982.1|4920691_4921642_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|4921692_4922988_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231141.1|4923018_4924548_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231042.1|4924544_4925300_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036332.1|4925332_4926517_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161234.1|4926656_4927661_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|4927687_4928716_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869737.1|4928852_4929098_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647951.1|4929107_4930415_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_063675984.1|4930978_4931806_+	helix-turn-helix domain-containing protein	NA	A0A1C8EA76	Bacillus_phage	85.8	5.4e-127
WP_053512216.1|4931822_4932116_-	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	90.7	1.6e-44
WP_063675986.1|4932139_4932358_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	98.6	4.6e-33
WP_000119474.1|4932496_4932826_+	hypothetical protein	NA	A0A1C8E989	Bacillus_phage	100.0	2.8e-50
WP_063675988.1|4933003_4934056_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	95.4	2.9e-194
WP_063675994.1|4934052_4934283_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	97.4	1.4e-32
WP_063675996.1|4934345_4935527_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	83.5	2.5e-189
WP_063675998.1|4935541_4937884_-|tail	phage tail protein	tail	A0A1B1P7P0	Bacillus_phage	98.1	0.0e+00
WP_063676000.1|4937880_4938564_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	99.6	1.3e-129
WP_063676002.1|4938565_4942087_-|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	95.3	2.1e-289
WP_006927278.1|4942103_4942292_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_053512980.1|4942330_4942717_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	97.7	1.4e-64
WP_016125430.1|4942728_4943364_-|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	98.6	4.8e-115
WP_063676004.1|4943375_4943753_-	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	97.6	2.5e-63
WP_063676006.1|4943752_4944082_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	98.2	2.6e-56
WP_033689833.1|4944071_4944407_-	phage protein	NA	A0A1C8E986	Bacillus_phage	99.1	1.1e-54
WP_043924595.1|4944381_4944642_-	phage protein	NA	A0A1B0T690	Bacillus_phage	100.0	8.4e-42
WP_063676008.1|4944643_4945960_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	92.4	2.2e-199
WP_063676011.1|4945961_4946543_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	95.9	3.5e-96
WP_063676013.1|4946532_4947717_-|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	97.7	6.0e-220
WP_000799706.1|4947765_4948023_-	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	64.7	7.0e-25
WP_001009049.1|4948022_4948295_-	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	82.2	1.4e-42
WP_000572796.1|4948309_4950037_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	97.7	0.0e+00
WP_000104850.1|4950033_4950471_-|terminase	P27 family phage terminase small subunit	terminase	A0A2H4JFK0	uncultured_Caudovirales_phage	93.8	3.6e-69
WP_063676015.1|4950555_4950948_-	HNH endonuclease	NA	A0A2H4JFG4	uncultured_Caudovirales_phage	96.2	4.8e-73
WP_063676412.1|4950944_4951265_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	80.2	1.9e-40
WP_063676017.1|4951428_4951632_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	72.3	2.3e-18
WP_063676019.1|4951913_4952300_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	77.3	9.5e-50
WP_001216580.1|4952488_4952752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676021.1|4952821_4953259_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	95.9	2.0e-72
WP_063676023.1|4953332_4953872_-	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	55.9	4.6e-50
WP_063676025.1|4953874_4954150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676027.1|4954153_4954582_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	88.0	1.3e-71
WP_063676029.1|4954566_4954797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676031.1|4955068_4957423_-	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	87.8	0.0e+00
WP_044796182.1|4957494_4957953_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	92.8	5.8e-78
WP_063676033.1|4957982_4958654_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	90.6	5.6e-114
WP_063676035.1|4958670_4959267_-	hypothetical protein	NA	A0A1B2AQ10	Phage_Wrath	91.4	9.7e-94
WP_063676037.1|4959272_4959464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155722460.1|4959460_4959634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172795634.1|4959626_4959827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676039.1|4959774_4960092_-	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	45.3	2.6e-13
WP_000998383.1|4960091_4960445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262629.1|4960441_4960639_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	100.0	5.6e-30
WP_172452039.1|4960657_4960813_-	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	82.0	2.5e-17
WP_003280171.1|4960875_4961523_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	78.1	9.9e-92
WP_063676041.1|4961543_4961894_-	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	78.4	1.8e-47
WP_000472440.1|4961894_4962122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170924136.1|4962137_4962290_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	79.2	1.8e-12
WP_023523446.1|4962348_4962582_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|4962616_4962847_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523448.1|4963011_4963404_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	2.5e-13
WP_038413877.1|4963414_4963882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676044.1|4963912_4965049_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	1.8e-96
4965211:4965263	attL	CAGACGTGGTACCGGAAACCACCGCTCTATCCGACTGAGCTATGGGCGCATGA	NA	NA	NA	NA
WP_063676046.1|4965630_4968954_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	35.6	2.8e-65
WP_063676048.1|4969064_4969319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676052.1|4969620_4970418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142286829.1|4970448_4970712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676057.1|4970690_4971263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676059.1|4971259_4971514_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_172795635.1|4971848_4972094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676063.1|4972249_4972786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063676065.1|4974375_4974984_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	36.3	5.2e-10
WP_063676067.1|4975744_4975930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103629761.1|4976904_4977294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676071.1|4977378_4977615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172452018.1|4977727_4977904_-	hypothetical protein	NA	A0A2H4JCU3	uncultured_Caudovirales_phage	44.6	3.8e-06
WP_063676073.1|4978748_4979717_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	25.1	4.9e-10
4979944:4979996	attR	CAGACGTGGTACCGGAAACCACCGCTCTATCCGACTGAGCTATGGGCGCATGA	NA	NA	NA	NA
>prophage 13
NZ_CP015176	Bacillus thuringiensis serovar alesti strain BGSC 4C1 chromosome, complete genome	5400819	4996088	5064516	5400819	tail,terminase,holin,portal,head,protease,capsid	uncultured_Caudovirales_phage(52.94%)	80	NA	NA
WP_001267311.1|4996088_4996469_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000394720.1|4996580_4997033_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_063676077.1|4997091_4999968_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_044783072.1|4999973_5001950_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_016099278.1|5002101_5002533_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_063676079.1|5002577_5003198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260349.1|5003194_5003956_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000422656.1|5004055_5004283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538366.1|5004431_5004629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063676081.1|5004864_5005887_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_001100016.1|5006038_5006932_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	1.9e-08
WP_001219206.1|5006983_5007352_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000497616.1|5007356_5007902_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000186323.1|5007904_5008264_+	hypothetical protein	NA	A0A1B0RXA0	Streptococcus_phage	38.5	3.0e-05
WP_000637523.1|5008380_5008692_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944607.1|5008757_5010473_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	4.1e-60
WP_063676082.1|5010698_5011901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002083587.1|5011992_5013477_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.2	1.9e-21
WP_000645028.1|5013547_5014441_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594331.1|5014430_5015117_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.4	1.5e-26
WP_000727971.1|5015401_5015725_-	cytochrome c-551	NA	NA	NA	NA	NA
WP_097807990.1|5016155_5017254_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000579374.1|5017398_5019906_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_000671187.1|5020177_5020720_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001990088.1|5021041_5021239_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
WP_044783038.1|5021365_5022070_-	ComF family protein	NA	NA	NA	NA	NA
WP_063676084.1|5023238_5024072_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.9	5.3e-122
WP_000119478.1|5024134_5024458_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	62.7	1.9e-27
WP_033690498.1|5024645_5024885_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	97.5	2.6e-34
WP_142286830.1|5024887_5025067_-	hypothetical protein	NA	A0A2H4J839	uncultured_Caudovirales_phage	91.5	1.9e-21
WP_061186062.1|5025150_5025321_-	hypothetical protein	NA	A0A2H4J852	uncultured_Caudovirales_phage	92.9	2.4e-13
WP_063676086.1|5025435_5026368_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.6	5.0e-153
WP_000373898.1|5026367_5026793_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_001039175.1|5026830_5027205_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	99.2	9.2e-66
WP_063676088.1|5027220_5032137_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	72.7	0.0e+00
WP_063676090.1|5032133_5033603_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	77.9	1.8e-229
WP_063674933.1|5033644_5036032_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	43.2	5.4e-42
WP_063674930.1|5036309_5037545_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	72.8	1.4e-150
WP_000415931.1|5037775_5038138_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_063674928.1|5038144_5038738_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	92.3	3.3e-102
WP_063676091.1|5038738_5039074_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	93.6	1.6e-53
WP_063676093.1|5039070_5039415_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	6.3e-45
WP_061666392.1|5039416_5039767_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.1	7.1e-52
WP_063676095.1|5039768_5040062_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.6	8.5e-43
WP_063676099.1|5040067_5041225_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.4	1.0e-200
WP_003308646.1|5041228_5041972_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	85.0	9.9e-112
WP_172451981.1|5041971_5043120_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	95.3	9.6e-207
WP_063676100.1|5043124_5044780_-|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	98.9	0.0e+00
WP_000763336.1|5044776_5045133_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_000253626.1|5045268_5045766_-	HNH endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	43.9	9.8e-31
WP_000666400.1|5045759_5046095_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	2.7e-53
WP_001177573.1|5046060_5046435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378697.1|5046425_5046683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5046689_5046899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063674923.1|5047013_5047208_-	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	84.2	2.8e-18
WP_000340442.1|5047219_5047402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476218.1|5047442_5048192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818549.1|5048422_5049355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460730.1|5049537_5049933_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	88.5	2.2e-57
WP_000066163.1|5050112_5050403_-	hypothetical protein	NA	A0A2H4J820	uncultured_Caudovirales_phage	77.1	1.2e-33
WP_001151587.1|5050462_5050807_-	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	58.5	1.7e-26
WP_001273080.1|5050864_5051404_-	ERCC4 domain-containing protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	91.1	1.1e-88
WP_001206918.1|5051406_5051775_-	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	41.7	1.4e-13
WP_063676102.1|5051777_5052212_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	74.6	2.9e-55
WP_063676104.1|5052212_5052584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676106.1|5052878_5055257_-	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	94.2	0.0e+00
WP_063676108.1|5055326_5055761_-	DUF669 domain-containing protein	NA	A0A0S2SXX0	Bacillus_phage	74.3	1.3e-55
WP_063676110.1|5055760_5056690_-	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	54.2	6.0e-90
WP_063676111.1|5056692_5057241_-	host-nuclease inhibitor Gam family protein	NA	A0A2H4JFX2	uncultured_Caudovirales_phage	90.1	2.1e-87
WP_063676114.1|5057218_5057503_-	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	87.2	2.5e-39
WP_016125195.1|5057598_5057949_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	87.1	1.0e-50
WP_063676115.1|5057972_5058158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172452057.1|5058158_5058326_-	hypothetical protein	NA	A0A2H4J829	uncultured_Caudovirales_phage	80.0	1.8e-13
WP_063676117.1|5058345_5058573_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	98.7	2.7e-36
WP_063676119.1|5059017_5059674_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	98.2	3.2e-122
WP_063676121.1|5059692_5061048_+	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	99.8	1.1e-252
WP_042596693.1|5061079_5061481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499489.1|5061607_5063038_-	C40 family peptidase	NA	A0A2H4PQY6	Streptomyces_phage	37.2	2.0e-12
WP_000400857.1|5063186_5063501_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000684725.1|5063673_5064516_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	3.6e-17
>prophage 1
NZ_CP015177	Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence	267609	3002	70285	267609	transposase,tRNA,protease,integrase	Bacillus_phage(50.0%)	54	3092:3108	29335:29351
WP_063676422.1|3002_3398_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	51.2	7.3e-21
3092:3108	attL	AGAATCCTTCGGATTTT	NA	NA	NA	NA
WP_063676424.1|3419_3869_-|transposase	IS3 family transposase	transposase	A0A0N9S8A3	Staphylococcus_phage	34.1	1.4e-07
WP_063676426.1|5071_5752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676428.1|5772_6045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676432.1|6346_6805_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_063676434.1|6880_7129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676436.1|7375_7828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676438.1|8388_8778_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_063676441.1|9130_9367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676443.1|9814_10309_+	DUF3902 family protein	NA	NA	NA	NA	NA
WP_081252962.1|10515_11832_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_063676445.1|12147_12957_-	YitT family protein	NA	NA	NA	NA	NA
WP_063676447.1|13361_14237_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172452027.1|15234_15399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676449.1|15958_16471_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000149390.1|16492_16843_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_063676451.1|17074_18118_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	2.6e-09
WP_063676453.1|18330_18657_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	50.0	1.6e-21
WP_172452033.1|18989_19145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676455.1|19141_20365_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	62.9	6.8e-142
WP_063676457.1|20573_22217_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063676459.1|22947_23598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676462.1|24272_24551_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	45.2	1.4e-07
WP_081252964.1|24618_24759_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063676466.1|25545_25818_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	7.5e-25
WP_063676468.1|26306_26822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676677.1|28939_30247_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.9e-25
29335:29351	attR	AAAATCCGAAGGATTCT	NA	NA	NA	NA
WP_063676470.1|32159_33374_-	MFS transporter	NA	NA	NA	NA	NA
WP_063676472.1|33431_33908_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063676473.1|34187_34658_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072386.1|34781_36002_-	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_063676475.1|36037_36757_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_063676679.1|37278_38709_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063676477.1|39224_39707_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_063676479.1|39746_40892_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_081252967.1|42707_44282_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_063676683.1|45494_45944_-	poly-gamma-glutamate biosynthesis protein PgsC	NA	NA	NA	NA	NA
WP_081252968.1|46359_47544_-	poly-gamma-glutamate synthase PgsB	NA	NA	NA	NA	NA
WP_063676480.1|49517_50204_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063676482.1|50835_51063_-	hypothetical protein	NA	U5PVK0	Bacillus_phage	55.9	9.9e-15
WP_172452026.1|51996_52146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676484.1|52142_52526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676485.1|52688_53264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081252969.1|53280_54390_-	C40 family peptidase	NA	A7KUS1	Bacillus_phage	38.3	4.4e-15
WP_063676687.1|54449_54785_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_172795636.1|54985_56224_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.6	3.0e-28
WP_000108316.1|57300_59106_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_063676489.1|60774_64767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676490.1|64797_66906_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000891999.1|66908_67823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676491.1|67823_68174_-	PrgI family protein	NA	NA	NA	NA	NA
WP_044798332.1|68240_68660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063676492.1|69006_69276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063676493.1|69361_70285_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
