The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015081	Deinococcus radiodurans R1 chromosome 1, complete sequence	2646742	2107939	2117133	2646742		Bacillus_phage(50.0%)	10	NA	NA
WP_010887250.1|2107939_2108623_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.2	5.9e-10
WP_010887249.1|2108636_2109203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010887248.1|2109199_2110846_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010887247.1|2110842_2111439_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.2	3.1e-07
WP_081816010.1|2111440_2113171_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.2	4.9e-53
WP_010887245.1|2113436_2113676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010887244.1|2113815_2114655_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	50.0	1.8e-61
WP_010887243.1|2114755_2115349_-	M23 family metallopeptidase	NA	A0A0Y0AH42	Bacillus_phage	39.1	7.4e-09
WP_010887242.1|2115405_2116074_+	SCO family protein	NA	NA	NA	NA	NA
WP_010887241.1|2116131_2117133_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	4.4e-06
>prophage 2
NZ_CP015081	Deinococcus radiodurans R1 chromosome 1, complete sequence	2646742	2420922	2430123	2646742	protease	Paramecium_bursaria_Chlorella_virus(16.67%)	9	NA	NA
WP_010886947.1|2420922_2422851_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.5	2.3e-112
WP_010886946.1|2423232_2423529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027480282.1|2423525_2424626_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	22.7	5.2e-08
WP_010886944.1|2424708_2425326_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.5	5.0e-08
WP_010886943.1|2425325_2425949_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	31.3	9.7e-20
WP_010886942.1|2426024_2427497_+	UDP-N-acetylmuramyl-tripeptide synthetase	NA	NA	NA	NA	NA
WP_010886941.1|2427540_2427837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886940.1|2427833_2428682_+	phosphoprotein phosphatase	NA	A0A2H4PRN7	Proteus_phage	25.0	2.0e-07
WP_010886939.1|2428734_2430123_+	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	51.1	5.0e-125
>prophage 1
NZ_CP015083	Deinococcus radiodurans R1 plasmid MP1, complete sequence	203183	20518	70339	203183	transposase	uncultured_virus(11.11%)	40	NA	NA
WP_010884008.1|20518_21769_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.8e-36
WP_063653099.1|21983_23159_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010884019.1|23163_24147_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_149358002.1|24674_25190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010884051.1|26033_26564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027480379.1|27023_28022_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_081816081.1|27976_28615_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_010884007.1|28611_29013_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_010884050.1|29303_31448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884049.1|31657_32866_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010884017.1|32862_33510_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.4e-23
WP_010884048.1|33506_33965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027480382.1|34384_36151_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_010884076.1|36223_36499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884006.1|36554_38105_-	sensor domain-containing diguanylate cyclase	NA	A0A2D0W9B6	Bordetella_phage	48.7	4.6e-10
WP_155896399.1|38323_38491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884005.1|38563_39862_-	MFS transporter	NA	NA	NA	NA	NA
WP_010884004.1|39874_41611_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051618918.1|41639_44453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884046.1|44900_47171_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_010884044.1|47776_49852_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_010884043.1|51264_52221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884003.1|52380_53040_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	7.9e-12
WP_010884002.1|53061_55563_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_010884075.1|55700_56021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884001.1|56235_57372_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A240F4U1	Ochrobactrum_phage	32.5	1.4e-11
WP_010884016.1|57368_58280_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	32.1	2.8e-07
WP_010884000.1|58417_59668_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	3.5e-16
WP_010883999.1|59645_61379_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.0e-26
WP_010883998.1|61375_62431_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883997.1|62525_62939_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883996.1|62919_63345_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010883995.1|63350_64250_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010884042.1|64338_65448_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010884041.1|65619_66171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884074.1|66242_66551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884015.1|66782_67766_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_149358003.1|68054_68399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149358004.1|68359_69061_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.2e-35
WP_082865519.1|69136_70339_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015083	Deinococcus radiodurans R1 plasmid MP1, complete sequence	203183	81963	156870	203183	transposase,integrase	Bacillus_phage(25.0%)	57	110355:110380	144639:144664
WP_010884020.1|81963_82947_-|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_010884040.1|83125_84934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884039.1|84926_86420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884026.1|87273_88149_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	42.6	1.2e-12
WP_010884025.1|88145_88922_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.1	1.8e-10
WP_010884037.1|91109_92438_-	McrC family protein	NA	NA	NA	NA	NA
WP_010883985.1|92437_95347_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	39.8	1.5e-25
WP_010884069.1|95343_95901_-	hypothetical protein	NA	Q24LG0	Clostridium_phage	23.4	2.5e-06
WP_010884027.1|95900_96407_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_081816096.1|96446_96704_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010884036.1|96761_97247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149358005.1|98734_99064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149358006.1|99067_99664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010883983.1|99961_101791_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	52.9	2.7e-09
WP_010883982.1|101787_104613_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.2	3.0e-31
WP_010884023.1|109966_110950_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
110355:110380	attL	ACGAGGTCACCCACAGGTGACCTCGT	NA	NA	NA	NA
WP_010883980.1|111121_112765_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_010889512.1|112839_114042_+|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010883978.1|114418_115333_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.9	4.6e-42
WP_010884078.1|115459_115780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010883977.1|115776_117078_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010883976.1|117074_118388_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010884072.1|118488_118830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010883975.1|118917_119439_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010883974.1|119781_120756_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010883973.1|120752_121676_+	DUF2470 domain-containing protein	NA	NA	NA	NA	NA
WP_010883972.1|121672_122647_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_010883971.1|122619_123675_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_010883970.1|123671_124481_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.7e-16
WP_010883969.1|125776_127045_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.6	7.3e-38
WP_010883968.1|127268_128282_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010884022.1|128297_129281_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010884035.1|129645_130359_+	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_010884077.1|130457_130805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082865520.1|130766_131969_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884071.1|133449_134049_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_010883967.1|134229_136590_-	glycerophosphoryl diester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	36.0	3.2e-07
WP_010884021.1|136597_136861_-	thioredoxin	NA	NA	NA	NA	NA
WP_010883966.1|136853_137918_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A142F1R6	Bacillus_phage	50.8	7.8e-86
WP_010883965.1|137905_140014_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	47.5	6.8e-190
WP_010883964.1|139977_140403_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	33.3	5.1e-12
WP_010883963.1|140559_141003_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010884065.1|140982_141174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010883962.1|141475_142510_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	1.3e-08
WP_063653103.1|142667_143843_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884020.1|144068_145052_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
144639:144664	attR	ACGAGGTCACCCACAGGTGACCTCGT	NA	NA	NA	NA
WP_081816080.1|145475_146357_+	hypothetical protein	NA	A0A1V0SK86	Klosneuvirus	27.6	6.6e-30
WP_010884034.1|146549_147182_+	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.0	5.5e-55
WP_010884064.1|147178_148036_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	38.4	7.6e-39
WP_010884033.1|148011_149253_+	AAA family ATPase	NA	D5GVP0	Campylobacter_virus	31.4	7.2e-06
WP_010884032.1|149336_150296_-	alpha/beta hydrolase	NA	A0A218MNI3	uncultured_virus	40.8	6.0e-61
WP_010884031.1|150294_150633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884030.1|151387_152416_-	RNA ligase (ATP)	NA	D4N471	Pseudomonas_phage	24.3	9.4e-12
WP_010883960.1|152656_153751_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	1.3e-14
WP_010883959.1|153933_154659_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	24.6	1.4e-06
WP_010883958.1|154858_155518_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	2.8e-25
WP_010883957.1|155514_156870_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.0	4.0e-10
