The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	2553	11178	4542863		Salmonella_phage(50.0%)	15	NA	NA
WP_063585512.1|2553_3294_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	75.5	2.5e-107
WP_063585513.1|3439_3682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063585514.1|3692_3932_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	45.5	5.2e-14
WP_063587501.1|3968_4166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063585515.1|4327_6799_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	57.0	2.5e-236
WP_063585516.1|6798_6999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063585517.1|6995_7223_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	58.3	2.1e-17
WP_063585518.1|7222_7447_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	55.8	2.7e-12
WP_063585519.1|7514_7856_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.4	6.3e-29
WP_071892118.1|7819_8017_-	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	46.8	1.1e-09
WP_063585520.1|8024_8540_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	52.9	2.5e-45
WP_046358770.1|8572_8794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063585521.1|8920_9481_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.8	2.5e-35
WP_063585522.1|9493_9976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063585523.1|9990_11178_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	39.5	6.1e-63
>prophage 2
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	674641	684732	4542863		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_063585817.1|674641_678022_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.2	6.8e-99
WP_063585818.1|678286_680845_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	1.3e-25
WP_025801555.1|680919_681906_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.0	1.0e-31
WP_080764357.1|681958_682936_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	1.6e-05
WP_063585819.1|683344_683977_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.3e-37
WP_025801558.1|683970_684732_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	2.9e-66
>prophage 3
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	2983329	2995325	4542863	integrase	Enterobacteria_phage(33.33%)	14	2982940:2982963	2994261:2994284
2982940:2982963	attL	ATGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_063586737.1|2983329_2985147_-	DEAD/DEAH box helicase family protein	NA	A0A2I7RXX1	Vibrio_phage	24.7	9.2e-10
WP_071892195.1|2985581_2985836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071892198.1|2985819_2986017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063586738.1|2986055_2986244_-	hypothetical protein	NA	A0A0F7LDQ9	Escherichia_phage	46.7	7.4e-08
WP_081250291.1|2986240_2986981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063586739.1|2987151_2987367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063586740.1|2987691_2990364_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	34.4	4.3e-117
WP_063586741.1|2990360_2990771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063586742.1|2990864_2991326_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	47.8	2.5e-28
WP_063586743.1|2991368_2991647_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	58.0	4.9e-16
WP_161485310.1|2991639_2992221_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	44.7	2.9e-18
WP_063586745.1|2992270_2992483_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	2.6e-09
WP_063586746.1|2992843_2994082_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.6	9.1e-78
WP_063586747.1|2994704_2995325_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	30.8	1.6e-14
2994261:2994284	attR	ATGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	3243775	3252300	4542863		Catovirus(16.67%)	8	NA	NA
WP_081250295.1|3243775_3244723_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.3	7.1e-14
WP_081250296.1|3244753_3245815_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063587607.1|3245831_3246542_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_081250297.1|3246545_3247508_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A223FN07	Murmansk_poxvirus	23.7	6.1e-05
WP_063586848.1|3247509_3248412_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.5	1.0e-46
WP_063586849.1|3248426_3249443_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.0	1.6e-75
WP_063586850.1|3249490_3250657_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.3	8.8e-115
WP_063586851.1|3250887_3252300_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.2	1.6e-38
>prophage 5
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	3517945	3545332	4542863	holin,terminase,tail,integrase	Salmonella_phage(28.57%)	31	3517413:3517426	3525554:3525567
3517413:3517426	attL	AGTTGACTATCATT	NA	NA	NA	NA
WP_063586986.1|3517945_3519178_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	56.3	1.2e-133
WP_046359908.1|3519179_3519392_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	70.4	1.4e-23
WP_046359909.1|3519459_3519702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063586987.1|3519698_3521420_-	hypothetical protein	NA	K7PJT5	Enterobacteria_phage	23.1	1.2e-19
WP_063586988.1|3521530_3521848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046449206.1|3522265_3522472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046449207.1|3522468_3522684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063586989.1|3522946_3523360_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063586990.1|3523437_3523638_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	51.7	1.9e-09
WP_063586991.1|3523648_3524110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063586992.1|3524155_3524395_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_063586993.1|3524395_3525325_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	54.4	1.8e-65
WP_063586994.1|3525327_3525558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063586995.1|3527022_3527280_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
3525554:3525567	attR	AATGATAGTCAACT	NA	NA	NA	NA
WP_046459177.1|3528406_3528655_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_161485312.1|3529179_3529605_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046449210.1|3530709_3531372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063586998.1|3531429_3531708_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	71.7	6.9e-34
WP_063586999.1|3531704_3532355_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	42.0	3.7e-38
WP_046449211.1|3533489_3533753_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_046449212.1|3534115_3534448_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	45.6	1.5e-19
WP_063587000.1|3534457_3535072_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	82.4	1.0e-90
WP_063587001.1|3535068_3535596_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_063587002.1|3535699_3535954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587003.1|3535996_3536182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587004.1|3536243_3537308_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	51.4	5.5e-63
WP_063587005.1|3537276_3538620_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	69.9	1.4e-180
WP_145916006.1|3539060_3539276_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	70.0	5.7e-20
WP_063587006.1|3539331_3542832_+|tail	phage tail protein	tail	F1C571	Cronobacter_phage	58.1	4.9e-310
WP_063587008.1|3543130_3543784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130993647.1|3544138_3545332_+|tail	tail fiber domain-containing protein	tail	A0A0A7RZ88	Escherichia_virus	46.4	3.6e-39
>prophage 6
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	3588172	3704520	4542863	capsid,lysis,plate,portal,terminase,holin,head,integrase,tail,protease	Escherichia_phage(33.33%)	123	3618406:3618422	3714166:3714182
WP_063587034.1|3588172_3589219_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_040044849.1|3589309_3589561_-	YciN family protein	NA	NA	NA	NA	NA
WP_025796836.1|3589995_3592593_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.0	6.8e-91
WP_025796834.1|3593023_3593998_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_063587035.1|3594069_3594675_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_071842629.1|3595433_3595550_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_004094893.1|3595591_3595801_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	3.5e-22
WP_063587036.1|3595869_3596577_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_063587037.1|3596749_3597562_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_040045155.1|3597619_3598192_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_040044853.1|3598596_3599055_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_025796822.1|3599118_3599982_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_008813635.1|3599997_3600795_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_025796819.1|3600860_3601820_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_063587039.1|3602512_3604072_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.1	9.5e-40
WP_040044856.1|3604147_3605716_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025796815.1|3606048_3606360_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_040044857.1|3606362_3606674_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_063587040.1|3606675_3608157_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	36.2	1.2e-44
WP_063587041.1|3608149_3609115_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_040044860.1|3609150_3610431_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_063587042.1|3610599_3611475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796805.1|3611595_3612960_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_040044862.1|3613744_3614317_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_063587043.1|3614313_3615708_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.2	2.0e-41
WP_063587044.1|3615896_3616103_+	YoaH family protein	NA	NA	NA	NA	NA
WP_063587045.1|3616146_3617325_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_063587046.1|3617757_3618909_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	3.0e-83
3618406:3618422	attL	ATTTTGCTACAAGACTA	NA	NA	NA	NA
WP_004094959.1|3619474_3619684_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.9	3.5e-22
WP_063587047.1|3619766_3620276_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025796792.1|3620374_3620680_+	YebG family protein	NA	NA	NA	NA	NA
WP_040044868.1|3620719_3621028_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_040044869.1|3621130_3621490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587048.1|3622114_3623002_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_063587049.1|3623081_3625130_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	24.7	2.4e-35
WP_063587050.1|3625216_3626020_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_063587051.1|3626094_3627207_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.1	4.6e-113
WP_063587052.1|3628714_3629092_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_063587053.1|3629100_3629979_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_063587054.1|3630025_3630379_+	YebY family protein	NA	NA	NA	NA	NA
WP_008813610.1|3630486_3630729_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_063587055.1|3631036_3631993_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_040044878.1|3632539_3632845_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025796763.1|3633033_3633378_+	RNA helicase	NA	NA	NA	NA	NA
WP_063587057.1|3633647_3634043_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_046449249.1|3634295_3634634_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_063587058.1|3634924_3636121_+	MFS transporter	NA	NA	NA	NA	NA
WP_063587059.1|3636262_3637246_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	63.0	1.9e-118
WP_025796751.1|3637345_3637645_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	65.7	7.7e-31
WP_025796749.1|3637767_3638043_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	72.2	4.1e-31
WP_081250304.1|3638061_3638244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796747.1|3638224_3638725_+	hypothetical protein	NA	U5N0V9	Enterobacteria_phage	63.9	2.5e-58
WP_063587060.1|3638793_3639042_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	46.4	1.2e-05
WP_063587061.1|3639041_3639332_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_063587617.1|3639348_3639633_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	44.9	1.9e-15
WP_063587062.1|3639634_3641905_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	61.9	1.4e-270
WP_063587064.1|3644246_3645269_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.4	1.9e-153
WP_063587065.1|3645268_3647041_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	80.8	5.4e-281
WP_061553138.1|3647208_3648054_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	63.2	1.2e-92
WP_063587066.1|3648119_3649214_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.8	3.3e-148
WP_063587067.1|3649216_3649996_+|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	65.9	3.7e-69
WP_063587068.1|3650089_3650596_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	62.1	4.9e-54
WP_063587069.1|3650595_3650799_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	74.6	7.5e-22
WP_061553134.1|3650802_3651099_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	72.2	4.2e-29
WP_063587070.1|3651098_3651599_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	77.2	7.4e-71
WP_063587071.1|3651595_3652021_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	40.1	9.6e-19
WP_063587618.1|3652578_3653028_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	3.2e-49
WP_063587072.1|3653290_3653602_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_063587073.1|3653598_3654018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145915984.1|3654110_3654848_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	33.1	7.7e-24
WP_063587075.1|3655375_3656290_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_063587619.1|3656459_3656939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063587076.1|3657807_3658191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587077.1|3658415_3659690_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_063587078.1|3660007_3660646_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	65.3	1.5e-71
WP_046457871.1|3660642_3660990_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	72.8	1.2e-40
WP_063587079.1|3661556_3661865_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	2.7e-31
WP_071842598.1|3661897_3662020_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	82.1	5.5e-12
WP_063587080.1|3662009_3664454_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	58.7	4.3e-204
WP_063587081.1|3664466_3664952_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	60.9	3.3e-47
WP_063587082.1|3664948_3666121_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	69.4	1.3e-150
WP_071892219.1|3666198_3666417_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	1.2e-22
WP_046449282.1|3666974_3667412_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_063587083.1|3667565_3668033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038502234.1|3668106_3669270_-	porin	NA	NA	NA	NA	NA
WP_071892222.1|3670143_3670362_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	70.8	4.1e-26
WP_063587084.1|3671586_3672072_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	60.9	4.3e-47
WP_063587085.1|3672084_3674529_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	57.7	1.2e-217
WP_071892224.1|3674518_3674653_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	76.3	5.6e-10
WP_063587086.1|3674685_3674994_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	6.0e-31
WP_063587087.1|3675053_3675572_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	78.5	8.5e-78
WP_063587088.1|3675585_3676773_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.3	1.5e-186
WP_063587089.1|3676910_3677447_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	44.6	7.8e-34
WP_063587090.1|3677458_3679333_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.0	4.5e-76
WP_063587091.1|3679337_3679877_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	81.1	2.0e-82
WP_063587092.1|3679869_3680778_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	78.8	4.1e-128
WP_063587093.1|3680781_3681129_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	71.1	1.0e-39
WP_063587094.1|3681125_3681764_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	66.2	9.8e-76
WP_063587095.1|3682191_3683838_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_063587096.1|3683837_3684713_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_063587097.1|3684910_3685360_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	1.8e-47
WP_063587098.1|3685352_3685820_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	69.7	2.6e-57
WP_063587099.1|3685900_3686341_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	43.5	9.0e-20
WP_063587100.1|3686337_3686838_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	77.2	4.4e-71
WP_063587101.1|3686837_3687134_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	77.2	6.4e-30
WP_063587102.1|3687137_3687341_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	73.1	1.7e-21
WP_063587103.1|3687340_3687826_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	61.3	1.2e-52
WP_063587104.1|3687919_3688576_-	hypothetical protein	NA	A0A218M4L0	Erwinia_phage	66.8	6.1e-73
WP_063587105.1|3688578_3689652_-|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	71.1	1.0e-149
WP_063587106.1|3689699_3690545_-|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	66.0	7.1e-98
WP_063587107.1|3690687_3692457_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	78.9	1.9e-278
WP_063587108.1|3692456_3693473_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.1	7.8e-152
WP_063587109.1|3693682_3696163_-	methyltransferase	NA	A0A0P0ZG22	Escherichia_phage	55.5	4.3e-103
WP_063587110.1|3697022_3699290_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.9	3.5e-261
WP_063587111.1|3699286_3699505_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	54.9	3.4e-12
WP_063587112.1|3699574_3700084_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	53.9	5.5e-45
WP_063587113.1|3700265_3700784_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	37.8	5.4e-24
WP_063587114.1|3700816_3701203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161485315.1|3701315_3701993_+	bacteriophage CI repressor	NA	A0A0M4RE65	Salmonella_phage	43.5	8.9e-35
WP_161485316.1|3701965_3702469_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	39.8	9.3e-29
WP_063587115.1|3702452_3702887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587116.1|3702952_3703366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063587117.1|3703464_3704520_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.7	1.8e-122
3714166:3714182	attR	TAGTCTTGTAGCAAAAT	NA	NA	NA	NA
>prophage 7
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	3916023	3930114	4542863	tRNA	Tupanvirus(22.22%)	14	NA	NA
WP_040045009.1|3916023_3918006_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
WP_046449407.1|3918005_3919022_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.9	1.5e-38
WP_063587211.1|3919014_3920163_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.8	3.5e-23
WP_081250337.1|3920631_3921423_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.6	1.9e-07
WP_063587212.1|3921425_3922451_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_025801269.1|3922509_3922707_-	protein DsrB	NA	NA	NA	NA	NA
WP_004089944.1|3922790_3923087_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_063587213.1|3923091_3925479_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	6.6e-08
WP_025801267.1|3925493_3926477_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.7e-34
WP_121626058.1|3926768_3926813_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004089950.1|3926943_3927300_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_025801266.1|3927342_3927540_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_025801265.1|3927638_3928181_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
WP_040045013.1|3928176_3930114_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	2.7e-129
>prophage 8
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	4280287	4348982	4542863	coat,plate,head,integrase,tail	Escherichia_phage(30.0%)	65	4281746:4281773	4302757:4302784
WP_063587366.1|4280287_4280824_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	75.0	6.6e-41
4281746:4281773	attL	TACAGCCTTACAGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_063587368.1|4281853_4282345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063587369.1|4282337_4283348_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	60.8	1.3e-111
WP_081250320.1|4283409_4283979_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	35.9	2.2e-26
WP_063587370.1|4284094_4284307_+	hypothetical protein	NA	R9TMQ7	Vibrio_phage	41.5	8.7e-05
WP_063587371.1|4284409_4284919_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	51.5	2.7e-44
WP_063587372.1|4284987_4285215_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_063587373.1|4285214_4285433_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	57.7	5.1e-16
WP_063587374.1|4285429_4287727_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	61.1	2.6e-259
WP_061553748.1|4287828_4288014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081250321.1|4288341_4288815_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	37.3	3.7e-19
WP_063587375.1|4288814_4289018_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	67.2	1.4e-20
WP_061553745.1|4289008_4289230_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	38.4	1.8e-08
WP_063587376.1|4289213_4289723_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	68.6	7.1e-61
WP_063587377.1|4289719_4290151_+	hypothetical protein	NA	F1BUQ1	Erwinia_phage	29.5	1.2e-08
WP_063587378.1|4290240_4290708_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	53.6	2.4e-39
WP_063587379.1|4290807_4291446_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	69.0	3.6e-78
WP_063587380.1|4291442_4291790_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	64.0	4.1e-36
WP_063587381.1|4291793_4292702_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	77.2	3.0e-126
WP_063587382.1|4292694_4293234_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	74.3	4.1e-75
WP_063587383.1|4293238_4295125_+	hypothetical protein	NA	Q858V4	Yersinia_virus	56.6	6.7e-80
WP_063587384.1|4295131_4295692_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	51.6	5.3e-41
WP_063587385.1|4295828_4297016_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.8	5.7e-186
WP_063587386.1|4297030_4297549_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.7	9.4e-77
WP_063587387.1|4297613_4297895_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.7	3.0e-29
WP_071892835.1|4297927_4298050_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	1.4e-12
WP_063587388.1|4298039_4300496_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	43.3	6.5e-168
WP_063587389.1|4300517_4300994_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	55.2	2.1e-46
WP_063587390.1|4300990_4302151_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	59.1	2.5e-122
WP_063587391.1|4302265_4302484_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	1.8e-21
WP_025801668.1|4303186_4303735_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
4302757:4302784	attR	TACAGCCTTACAGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_040047175.1|4303792_4305625_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_025801666.1|4305617_4306274_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_004094789.1|4306884_4307109_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_025801665.1|4307237_4307582_+	GlpM family protein	NA	NA	NA	NA	NA
WP_040047173.1|4307699_4307960_+	DUF2545 family protein	NA	NA	NA	NA	NA
WP_063587392.1|4308653_4309100_+	glyoxalase	NA	NA	NA	NA	NA
WP_063587393.1|4309202_4309421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063587394.1|4309821_4310481_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_063587647.1|4311094_4311664_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_063587395.1|4311670_4312207_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_081250322.1|4312222_4312984_+	molecular chaperone	NA	NA	NA	NA	NA
WP_063587649.1|4313052_4315416_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_063587396.1|4315417_4316398_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_063587397.1|4316443_4317925_-	alpha-amylase	NA	NA	NA	NA	NA
WP_063587398.1|4318298_4319789_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_063587399.1|4319948_4322330_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_063587400.1|4322371_4323739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040045974.1|4323772_4324210_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_063587401.1|4324213_4324762_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_063587402.1|4324742_4325828_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_063587403.1|4325791_4327555_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061554280.1|4327634_4329227_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_145915991.1|4329226_4332562_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_063587404.1|4332548_4333937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025801644.1|4333937_4334192_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_063587405.1|4334371_4335238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063587407.1|4336103_4336973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063587408.1|4336986_4339182_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	26.7	2.4e-36
WP_063587409.1|4339174_4341706_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	8.8e-19
WP_063587410.1|4341699_4344468_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.7	2.0e-93
WP_025802740.1|4344675_4345167_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_063587411.1|4345254_4346964_-	OmpA family protein	NA	NA	NA	NA	NA
WP_040045958.1|4346976_4347636_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_063587412.1|4347632_4348982_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP015379	Hafnia alvei strain HUMV-5920 chromosome, complete genome	4542863	4458489	4542727	4542863	capsid,lysis,plate,tRNA,portal,terminase,head,tail,protease	Salmonella_phage(40.0%)	82	NA	NA
WP_025800959.1|4458489_4459230_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_025800958.1|4459782_4460238_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_040045898.1|4460313_4461453_-	MFS transporter	NA	NA	NA	NA	NA
WP_063587451.1|4461569_4462157_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	36.3	2.3e-23
WP_063587452.1|4462156_4462771_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.2	3.9e-29
WP_063587453.1|4462884_4463745_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	36.4	3.3e-26
WP_063587454.1|4463746_4464367_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	2.5e-76
WP_063587654.1|4464377_4466822_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.3e-213
WP_025800951.1|4467305_4468598_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
WP_040045894.1|4468706_4470050_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.8e-79
WP_040045893.1|4470076_4470688_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_063587455.1|4470977_4474766_-	hypothetical protein	NA	A0A218M9A2	Mycobacterium_phage	49.9	6.4e-90
WP_008812989.1|4474966_4475461_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_040045891.1|4476253_4477219_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.1	1.9e-62
WP_063587456.1|4477487_4479260_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.7	3.9e-21
WP_063587457.1|4479262_4480984_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	8.4e-21
WP_063587458.1|4481043_4481775_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|4481870_4482089_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025800943.1|4482258_4484535_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	8.7e-167
WP_004095820.1|4484561_4484885_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	3.7e-15
WP_025800942.1|4485470_4485692_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.5e-15
WP_040045887.1|4486053_4487004_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_040045886.1|4487065_4488736_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_025800939.1|4488959_4489859_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_063587459.1|4490071_4491724_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_063587460.1|4491787_4492792_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_063587461.1|4493053_4494775_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_063587462.1|4495020_4496073_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_063587463.1|4496285_4497731_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_025800933.1|4498018_4499038_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063587464.1|4499031_4499892_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	31.0	1.8e-11
WP_025800931.1|4500066_4500387_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063587465.1|4500431_4501832_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_063587466.1|4501994_4502363_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	33.0	2.4e-10
WP_063587467.1|4502388_4503003_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_063587468.1|4503139_4504057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025800926.1|4504267_4504996_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	1.4e-30
WP_025800925.1|4505066_4505798_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063587469.1|4505965_4506682_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_040045874.1|4506681_4507350_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_046358732.1|4507580_4508312_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063587470.1|4508456_4508945_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.1	9.3e-26
WP_063587471.1|4508932_4510066_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.1	4.8e-25
WP_063587472.1|4510174_4510666_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_063587473.1|4510776_4511622_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_063587474.1|4511621_4512584_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_040045867.1|4512594_4513728_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.9	5.0e-30
WP_063587475.1|4513881_4514988_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_063587476.1|4516021_4516216_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_063587477.1|4516212_4517100_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	36.7	7.3e-37
WP_040045863.1|4517127_4517850_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_040045862.1|4517833_4518139_-	YbjC family protein	NA	NA	NA	NA	NA
WP_004095905.1|4518294_4518558_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	4.5e-27
WP_040045861.1|4518629_4519022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800908.1|4519353_4521042_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_046358737.1|4521365_4521581_-	late control protein B	NA	Q53ZE7	Salmonella_virus	65.3	6.3e-19
WP_063587478.1|4521650_4522751_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	65.3	1.4e-125
WP_063587479.1|4522747_4523212_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.1	1.3e-48
WP_063587480.1|4523211_4526373_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	49.4	2.0e-246
WP_063587655.1|4526365_4526485_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	74.4	1.7e-10
WP_063587481.1|4526499_4526853_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	63.6	2.0e-25
WP_063587482.1|4526907_4527423_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	70.2	7.4e-66
WP_063587483.1|4527441_4528608_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.7	6.4e-182
WP_063587484.1|4528682_4529273_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	70.2	2.6e-67
WP_063587485.1|4529730_4530216_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	54.5	2.5e-47
WP_081250324.1|4531009_4531645_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	70.0	2.1e-70
WP_063587486.1|4531634_4532252_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	71.2	7.2e-84
WP_063587487.1|4532244_4533153_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	66.2	7.6e-106
WP_063587488.1|4533152_4533500_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	59.1	4.0e-31
WP_063587489.1|4533496_4534057_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	55.0	1.7e-52
WP_063587490.1|4534137_4534590_-	phage virion morphogenesis protein	NA	E5E3R3	Burkholderia_phage	45.8	1.4e-28
WP_063587491.1|4534586_4535015_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	55.1	4.6e-37
WP_063587492.1|4535110_4535536_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	46.0	1.2e-26
WP_063587493.1|4535535_4536048_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	70.1	6.0e-60
WP_046358755.1|4536028_4536244_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	38.0	4.5e-09
WP_063587494.1|4536247_4536451_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	73.1	8.0e-24
WP_063587495.1|4536450_4536915_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	52.6	8.2e-40
WP_063587496.1|4537010_4537670_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	56.2	4.3e-58
WP_081250325.1|4537673_4538939_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	77.5	2.7e-154
WP_063587497.1|4538954_4539782_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	55.2	9.1e-74
WP_063587498.1|4539925_4541698_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	84.2	1.1e-302
WP_063587499.1|4541701_4542727_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	84.0	6.0e-160
