The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	798797	805499	3241330		Staphylococcus_phage(50.0%)	7	NA	NA
WP_025592817.1|798797_799937_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.4	6.5e-62
WP_017448803.1|799954_801205_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	2.1e-98
WP_005482986.1|801332_801782_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_015296329.1|801789_802914_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	1.8e-48
WP_005483039.1|802926_803580_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.5	1.6e-33
WP_005496254.1|803749_804859_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	1.5e-63
WP_005440184.1|805028_805499_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
>prophage 2
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	1154706	1234899	3241330	terminase,head,tRNA,portal,tail,integrase,capsid,protease	Vibrio_phage(68.89%)	81	1155489:1155513	1190754:1190778
WP_005481860.1|1154706_1155513_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	28.2	3.9e-13
1155489:1155513	attL	TGATGTTAAAGCTGATTACTTTCAT	NA	NA	NA	NA
WP_063517278.1|1155646_1156669_-|integrase	tyrosine-type recombinase/integrase	integrase	R9TMQ4	Vibrio_phage	54.7	1.3e-101
WP_063517279.1|1156655_1158101_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	62.5	1.5e-164
WP_063517280.1|1158293_1159880_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	63.8	1.3e-79
WP_063517281.1|1159914_1160565_-	phage repressor protein CI	NA	R9TR74	Vibrio_phage	68.6	9.3e-82
WP_045588167.1|1160712_1160925_+	hypothetical protein	NA	R9TMQ7	Vibrio_phage	75.7	1.2e-22
WP_063517282.1|1161036_1161576_+	transcriptional regulator	NA	U3PIJ8	Vibrio_phage	59.8	4.7e-55
WP_029559288.1|1161585_1161921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517283.1|1161988_1162633_+	hypothetical protein	NA	R9TNP8	Vibrio_phage	37.1	2.5e-18
WP_063517284.1|1162629_1163037_+	hypothetical protein	NA	A0A2I7RNG1	Vibrio_phage	60.2	4.4e-37
WP_063517285.1|1163047_1163590_+	hypothetical protein	NA	U3PDF3	Vibrio_phage	82.3	1.4e-83
WP_079771525.1|1163688_1166244_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	64.5	7.4e-308
WP_063517286.1|1166313_1166823_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	32.7	7.2e-05
WP_063517287.1|1166809_1167193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154020290.1|1167989_1168241_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	65.7	1.2e-16
WP_079771420.1|1168242_1168494_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	86.7	6.6e-36
WP_154020277.1|1168711_1168861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517289.1|1168904_1169930_-|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	75.1	1.4e-148
WP_063517290.1|1169926_1171702_-|terminase	terminase	terminase	A0A2I7RNI3	Vibrio_phage	90.2	5.7e-307
WP_063517291.1|1171868_1172726_+|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	69.3	9.4e-90
WP_063517292.1|1172725_1173730_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	63.4	8.7e-111
WP_063517293.1|1173742_1174468_+|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	70.3	6.3e-95
WP_063517294.1|1174583_1175003_+|head	head protein	head	A0A2I7RNH7	Vibrio_phage	77.0	2.6e-53
WP_063517295.1|1174999_1175491_+|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	86.9	2.3e-77
WP_063517296.1|1175474_1176131_+	hypothetical protein	NA	A0A2I7RNI6	Vibrio_phage	81.2	4.7e-97
WP_063517297.1|1176134_1177265_+	DUF2586 family protein	NA	A0A2I7RNI8	Vibrio_phage	84.0	3.1e-181
WP_025605246.1|1177268_1177718_+	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	96.0	9.6e-78
WP_031856783.1|1177730_1177949_+	molecular chaperone DnaK	NA	A0A2I7RNJ6	Vibrio_phage	73.5	1.2e-22
WP_063517298.1|1177945_1178443_+	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	49.6	2.0e-23
WP_063517299.1|1178439_1178670_+	hypothetical protein	NA	W6B371	Vibrio_phage	42.9	3.5e-07
WP_045607483.1|1178672_1178957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047508669.1|1178953_1179217_+	hypothetical protein	NA	A0A1D9C9R9	Salinivibrio_phage	55.3	1.7e-18
WP_154020278.1|1179234_1179399_+	hypothetical protein	NA	Q1I0Y8	Pasteurella_virus	45.3	9.4e-07
WP_063517300.1|1179410_1181297_+|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	59.0	3.9e-221
WP_025589745.1|1181296_1181638_+	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	80.9	4.0e-44
WP_063517301.1|1181637_1182825_+	hypothetical protein	NA	A0A2I7RNJ7	Vibrio_phage	81.0	2.9e-190
WP_063517302.1|1182811_1183414_+	hemolysin	NA	A0A2I7RNJ4	Vibrio_phage	82.5	1.7e-98
WP_063517304.1|1186492_1187029_+	hypothetical protein	NA	A0A2I7RNK5	Vibrio_phage	70.6	2.1e-63
WP_063517305.1|1187038_1187728_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	73.7	1.0e-102
WP_063517306.1|1187718_1188390_+	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	73.6	4.5e-95
WP_063517307.1|1188486_1189578_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.7	2.2e-11
WP_063517308.1|1189748_1189946_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	68.8	3.9e-15
WP_005456217.1|1190868_1191033_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
1190754:1190778	attR	TGATGTTAAAGCTGATTACTTTCAT	NA	NA	NA	NA
WP_005456195.1|1191032_1191578_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_005456200.1|1191574_1192360_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_063517309.1|1192374_1194450_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	1.2e-45
WP_021449333.1|1194964_1195990_+	porin	NA	NA	NA	NA	NA
WP_025605441.1|1196066_1196744_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_063517310.1|1196856_1197555_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005456197.1|1197866_1200092_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011105762.1|1200222_1200462_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.4e-14
WP_005456259.1|1201140_1201461_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.1e-14
WP_005495889.1|1201508_1203779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	1.7e-167
WP_063517311.1|1203912_1204953_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001040192.1|1205021_1205240_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025577953.1|1205321_1206023_-	arginyltransferase	NA	NA	NA	NA	NA
WP_063517312.1|1206019_1206730_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020904016.1|1206766_1207246_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_063517313.1|1207407_1208688_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_063517314.1|1208745_1208994_-	YciN family protein	NA	NA	NA	NA	NA
WP_063517315.1|1209459_1212090_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	33.9	9.6e-85
WP_025532764.1|1212686_1213904_+	glucose-1-phosphate adenylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	28.2	2.9e-07
WP_079771421.1|1213893_1215351_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_005495870.1|1215473_1216277_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021485379.1|1216318_1216639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020840339.1|1216638_1217331_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_005457243.1|1217542_1218133_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_005457245.1|1218605_1219610_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
WP_063517317.1|1220047_1220695_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_005457237.1|1220960_1221674_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	31.6	1.3e-23
WP_005457224.1|1221743_1222529_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_029803718.1|1222643_1223435_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_005483103.1|1223437_1224775_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_011105765.1|1224734_1225481_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_025543151.1|1225483_1229947_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005457235.1|1230115_1230268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005457241.1|1230470_1231439_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_005495851.1|1231442_1232948_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_005457212.1|1232959_1233706_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_011105768.1|1233653_1233815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005483112.1|1233927_1234899_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	1367367	1377181	3241330	tRNA	Mycobacterium_phage(16.67%)	7	NA	NA
WP_063517345.1|1367367_1370454_+	hypothetical protein	NA	A0A218M9A2	Mycobacterium_phage	49.9	3.8e-88
WP_023585423.1|1370528_1371155_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005495763.1|1371161_1372511_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	1.1e-84
WP_005495761.1|1372602_1373910_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	2.2e-90
WP_029816223.1|1374112_1375012_+	DUF3380 domain-containing protein	NA	K4RM41	Pseudomonas_phage	43.5	1.3e-36
WP_063517347.1|1375564_1375831_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	46.6	6.2e-16
WP_063517348.1|1375900_1377181_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.3e-22
>prophage 4
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	1816982	1828520	3241330		Vibrio_phage(91.67%)	15	NA	NA
WP_063517466.1|1816982_1818713_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	2.7e-43
WP_063517467.1|1818880_1819249_-	antirepressor	NA	Q9MCC3	Vibrio_phage	96.7	1.1e-58
WP_063517468.1|1819407_1820019_+	hypothetical protein	NA	A0A1W6UG66	Vibrio_phage	98.0	6.0e-107
WP_012842282.1|1820015_1820231_+	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	98.6	2.6e-33
WP_079771461.1|1820154_1821363_+	phage replication protein	NA	Q783T8	Vibrio_phage	98.0	1.7e-241
WP_017822035.1|1821366_1821720_+	DUF1293 domain-containing protein	NA	A0A1W6UG87	Vibrio_phage	100.0	2.2e-61
WP_063517470.1|1821731_1821977_+	single-stranded DNA-binding protein	NA	A0A1W6UH23	Vibrio_phage	98.8	3.4e-37
WP_017447548.1|1821987_1822221_+	membrane protein	NA	A0A1W6UG80	Vibrio_phage	98.7	1.7e-30
WP_063517471.1|1822354_1823830_+	methyl-accepting chemotaxis protein	NA	A0A1W6UG63	Vibrio_phage	99.2	1.4e-218
WP_015975177.1|1823831_1824146_+	DUF2523 domain-containing protein	NA	O88125	Vibrio_phage	100.0	8.0e-47
WP_063517472.1|1824142_1825285_+	assembly protein	NA	O88128	Vibrio_phage	99.5	2.5e-215
WP_063517473.1|1825705_1826524_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_063517474.1|1826704_1827535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517475.1|1827568_1828120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517476.1|1828154_1828520_-	phage protein	NA	Q9MCC4	Vibrio_phage	93.4	6.6e-61
>prophage 5
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	2137489	2204703	3241330	integrase,capsid,transposase	Vibrio_phage(54.84%)	58	2134579:2134599	2207899:2207919
2134579:2134599	attL	TAACGCCCTGTTAAGGTGTGA	NA	NA	NA	NA
WP_060658550.1|2137489_2138452_+|integrase	integron integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.4	8.5e-15
WP_025441687.1|2138502_2138976_-	DUF2947 domain-containing protein	NA	NA	NA	NA	NA
WP_025533804.1|2138989_2139577_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_025548004.1|2139578_2140163_-	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_025623183.1|2140199_2141744_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_063517601.1|2141844_2142885_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_063517602.1|2142881_2144258_-	YcjX family protein	NA	NA	NA	NA	NA
WP_005458825.1|2144469_2144655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517603.1|2144829_2146347_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011105977.1|2146350_2146440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517605.1|2146618_2147983_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	33.5	3.6e-43
WP_025501223.1|2148121_2149822_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	6.7e-47
WP_015296942.1|2149829_2150369_-	guanylate cyclase-related protein	NA	NA	NA	NA	NA
WP_005458814.1|2150653_2151253_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005458812.1|2151607_2152861_+	serine transporter	NA	NA	NA	NA	NA
WP_021823429.1|2152959_2154321_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_025635704.1|2154624_2156340_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_079400447.1|2156411_2156990_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079771546.1|2157072_2157486_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	38.6	4.6e-10
WP_154020284.1|2157744_2157906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517607.1|2158376_2158985_+	Rha family transcriptional regulator	NA	A0A0P0HSR5	Acinetobacter_phage	46.0	2.9e-24
WP_154020285.1|2159033_2159597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114139936.1|2159650_2160773_+|transposase	IS3-like element ISVpa4 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_020840871.1|2161168_2161648_+	SocA family protein	NA	A8ATC0	Listeria_phage	38.9	7.5e-12
WP_020840872.1|2161644_2162025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517608.1|2162080_2170435_-	PLxRFG domain-containing protein	NA	M4M9L8	Vibrio_phage	35.0	0.0e+00
WP_154020286.1|2170499_2170802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050581389.1|2170846_2171455_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	56.4	1.8e-23
WP_025562151.1|2171780_2172722_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025507220.1|2172746_2173256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154020292.1|2173322_2173739_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	55.8	5.3e-38
WP_063517610.1|2173796_2174975_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	64.9	1.6e-119
WP_063517611.1|2175121_2176831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020840878.1|2177084_2177591_-	hypothetical protein	NA	M4MCN4	Vibrio_phage	41.3	1.3e-14
WP_063517612.1|2177612_2178290_-	hypothetical protein	NA	M4M9K5	Vibrio_phage	39.0	1.5e-29
WP_020840880.1|2178282_2178699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021453944.1|2178717_2181213_-	fibronectin type III family protein	NA	M4M9M2	Vibrio_phage	36.0	1.7e-30
WP_063517613.1|2181213_2182824_-	hypothetical protein	NA	M4MHD1	Vibrio_phage	46.0	1.1e-131
WP_020840883.1|2182823_2183048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517614.1|2183169_2184030_-	DUF4376 domain-containing protein	NA	A0A2I7RB39	Vibrio_phage	43.7	1.2e-28
WP_154020287.1|2184026_2186372_-	hypothetical protein	NA	M4M9Z4	Vibrio_phage	35.9	3.9e-114
WP_114139936.1|2186477_2187601_-|transposase	IS3-like element ISVpa4 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_063517616.1|2188718_2189627_-	cation transporter	NA	NA	NA	NA	NA
WP_114139936.1|2189902_2191026_-|transposase	IS3-like element ISVpa4 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_063517617.1|2191018_2193139_-	hypothetical protein	NA	M4M9Z4	Vibrio_phage	48.8	4.6e-37
WP_029810711.1|2193158_2193830_-	hypothetical protein	NA	M4M9I0	Vibrio_phage	38.9	7.0e-40
WP_063517618.1|2193838_2194417_-	hypothetical protein	NA	A0A1B1ITE9	uncultured_Mediterranean_phage	28.3	1.2e-08
WP_043854126.1|2194416_2194881_-	hypothetical protein	NA	M4MB04	Vibrio_phage	36.8	2.3e-18
WP_021485001.1|2194994_2195441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517619.1|2195500_2196724_-|capsid	N4-gp56 family major capsid protein	capsid	M4M9G4	Vibrio_phage	74.4	1.5e-168
WP_127891399.1|2196738_2197851_-	hypothetical protein	NA	M4M9I4	Vibrio_phage	40.1	2.2e-46
WP_063517620.1|2198058_2198544_-	hypothetical protein	NA	M4MH86	Vibrio_phage	46.0	1.7e-35
WP_021454730.1|2198570_2198888_-	phage family protein	NA	G4WAN4	Salmonella_phage	39.0	2.2e-12
WP_063517621.1|2198892_2199405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517622.1|2199424_2201530_-	hypothetical protein	NA	M4MB09	Vibrio_phage	70.1	1.4e-259
WP_063517843.1|2201541_2203272_-	hypothetical protein	NA	M4MCI5	Vibrio_phage	55.7	3.7e-186
WP_021453543.1|2203324_2204242_-	hypothetical protein	NA	M4M9G7	Vibrio_phage	21.1	7.4e-08
WP_063517623.1|2204280_2204703_-	hypothetical protein	NA	M4M9H1	Vibrio_phage	60.3	3.7e-39
2207899:2207919	attR	TCACACCTTAACAGGGCGTTA	NA	NA	NA	NA
>prophage 6
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	2212914	2227331	3241330	integrase,tRNA	Vibrio_phage(45.45%)	18	2215104:2215118	2225356:2225370
WP_020840924.1|2212914_2213724_-	hypothetical protein	NA	A0A2R2ZGJ9	Clostridioides_phage	38.0	2.7e-22
WP_021454738.1|2213961_2214111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063517629.1|2214118_2214424_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	46.2	3.3e-13
WP_021453894.1|2214420_2214822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025562246.1|2214884_2215250_-	hypothetical protein	NA	NA	NA	NA	NA
2215104:2215118	attL	GTTGCTGGTGGCTTC	NA	NA	NA	NA
WP_133296389.1|2215246_2215756_-	hypothetical protein	NA	M4PMR5	Vibrio_phage	35.1	4.7e-20
WP_031856842.1|2215676_2216636_-	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	34.7	3.3e-11
WP_020840932.1|2216710_2217025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086586418.1|2217313_2217952_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063517845.1|2218296_2218704_+	hypothetical protein	NA	R9TMP0	Vibrio_phage	47.8	1.0e-22
WP_021484985.1|2218717_2219542_+	DUF2303 family protein	NA	R9TRN9	Vibrio_phage	42.6	3.7e-59
WP_020840936.1|2219607_2220732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051395178.1|2220728_2221355_+	hypothetical protein	NA	A0A2I7RS54	Vibrio_phage	60.0	4.1e-58
WP_020840938.1|2221339_2221549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063517630.1|2221833_2222442_+	Rha family transcriptional regulator	NA	A0A0P0HSR5	Acinetobacter_phage	48.4	5.2e-26
WP_063517631.1|2222461_2223625_-|integrase	site-specific integrase	integrase	B6ET93	Enterobacteria_phage	30.2	2.1e-44
WP_063517632.1|2224116_2225742_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	1.1e-19
2225356:2225370	attR	GAAGCCACCAGCAAC	NA	NA	NA	NA
WP_005458036.1|2225930_2227331_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.8	2.5e-84
>prophage 7
NZ_CP011406	Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence	3241330	2921220	2938616	3241330	tRNA	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_005455546.1|2921220_2923803_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.0e-78
WP_025636075.1|2923945_2924413_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005478550.1|2924536_2925580_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	8.1e-112
WP_063517761.1|2925780_2926263_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.1	6.4e-27
WP_063517762.1|2926347_2928909_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.0	8.9e-35
WP_024699751.1|2930057_2930981_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005455562.1|2930995_2931622_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	1.3e-35
WP_063517763.1|2931621_2932398_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.6e-65
WP_005455570.1|2932397_2933441_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005380896.1|2933487_2933964_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_005478544.1|2933981_2934686_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	23.6	5.9e-05
WP_005455577.1|2934687_2934969_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005455579.1|2935595_2936897_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.2e-134
WP_005455581.1|2936975_2938616_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	4.2e-155
>prophage 1
NZ_CP011407	Vibrio parahaemolyticus strain FORC_014 chromosome 2, complete sequence	1997247	1091391	1097985	1997247		Vibrio_phage(100.0%)	11	NA	NA
WP_021483992.1|1091391_1091760_-	phage related family protein	NA	A0A1W6UGD7	Vibrio_phage	100.0	1.3e-61
WP_063518144.1|1091949_1092255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063518145.1|1092254_1092527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043048356.1|1092526_1092727_+	hypothetical protein	NA	C3W4P3	Vibrio_phage	75.4	5.1e-23
WP_043048353.1|1092716_1093817_+	replication initiation factor family protein	NA	Q8W6E3	Vibrio_phage	76.1	2.3e-157
WP_063518146.1|1093788_1094124_+	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	65.8	4.9e-34
WP_005376279.1|1094126_1094372_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	43.9	4.8e-07
WP_048626399.1|1094400_1094592_+	hypothetical protein	NA	G8IRU8	Vibrio_phage	53.2	8.4e-07
WP_063518147.1|1094726_1096220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005376274.1|1096219_1096552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063518148.1|1096557_1097985_+	toxin	NA	R9TQ09	Vibrio_phage	51.2	1.1e-122
