The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011158	Moraxella ovis strain 199/55 chromosome, complete genome	2265514	228183	293782	2265514	transposase,tail,terminase,holin,tRNA,head,capsid,portal,protease,integrase	Moraxella_phage(69.57%)	78	225144:225166	263859:263881
225144:225166	attL	TGTCAAAATCGACAAACAAGGCA	NA	NA	NA	NA
WP_063513401.1|228183_229512_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	25.9	4.2e-12
WP_063513402.1|229575_230412_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.1	3.9e-24
WP_063513403.1|230431_230998_+	YggT family protein	NA	NA	NA	NA	NA
WP_063513404.1|231066_231717_+|transposase	IS1595-like element ISMov1 family transposase	transposase	NA	NA	NA	NA
WP_063514909.1|231781_232570_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_063514910.1|233314_233863_+	RDD family protein	NA	NA	NA	NA	NA
WP_063513405.1|233909_235310_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_063513406.1|235495_236512_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_063513407.1|236563_237142_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_115265717.1|237261_237891_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_063513409.1|238256_239753_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_063513410.1|239867_240821_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	37.4	9.3e-46
WP_063513411.1|241279_242149_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_063513412.1|242145_242709_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_084260552.1|242725_244699_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_063513414.1|244940_246257_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_063514911.1|246387_247515_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	38.6	1.0e-67
WP_063513415.1|247758_250509_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_063513416.1|250548_251322_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_063513417.1|251953_253072_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	53.5	7.7e-108
WP_063513418.1|253106_253298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513419.1|253308_253692_-	hypothetical protein	NA	R9TLR7	Paenibacillus_phage	59.7	8.0e-33
WP_063513420.1|253688_254087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513421.1|254164_254593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513422.1|254610_256320_-	DEAD/DEAH box helicase	NA	A0A0R6PL06	Moraxella_phage	49.4	7.7e-152
WP_063513423.1|256323_256821_-	siphovirus Gp157 family protein	NA	A0A0R6PHR8	Moraxella_phage	48.5	7.0e-37
WP_063513424.1|256831_257032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157079168.1|257031_257190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513425.1|257299_258022_-	hypothetical protein	NA	B6SD57	Bacteriophage	40.5	2.9e-39
WP_157079169.1|258024_258174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513426.1|258415_258868_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_063513427.1|258848_259070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513428.1|259286_259826_-	DUF669 domain-containing protein	NA	A0A0R6PIJ1	Moraxella_phage	54.6	6.9e-38
WP_063513429.1|259869_260565_-	ATP-binding protein	NA	A0A0R6PDV7	Moraxella_phage	71.1	9.6e-85
WP_157079170.1|260564_260732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063513430.1|261134_262007_-	DUF3037 domain-containing protein	NA	A0A0R6PJ36	Moraxella_phage	67.0	3.4e-111
WP_147285060.1|262003_262765_-	hypothetical protein	NA	A0A0R6PJ79	Moraxella_phage	64.6	1.7e-90
WP_063513432.1|262853_263267_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJ59	Moraxella_phage	46.3	3.6e-23
WP_063513433.1|263419_263644_+	hypothetical protein	NA	A0A0R6PGV0	Moraxella_phage	54.4	5.9e-12
WP_063513434.1|263640_266046_+	DUF3987 domain-containing protein	NA	A0A0R6PI84	Moraxella_phage	48.4	1.0e-202
263859:263881	attR	TGCCTTGTTTGTCGATTTTGACA	NA	NA	NA	NA
WP_063513435.1|266292_266637_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	66.1	5.3e-36
WP_063513436.1|266633_266897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513437.1|266900_267182_+	hypothetical protein	NA	S5MLS6	Pseudoalteromonas_phage	67.1	1.4e-26
WP_063513438.1|267178_267580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513439.1|267701_268076_+	HNH endonuclease	NA	G3EN93	Psychrobacter_phage	55.3	3.9e-32
WP_063513440.1|268152_268635_+|terminase	phage terminase small subunit P27 family	terminase	A0A0R6PIJ3	Moraxella_phage	61.6	3.1e-50
WP_063513441.1|268631_270323_+|terminase	terminase large subunit	terminase	A0A0R6PKH7	Moraxella_phage	82.3	4.2e-283
WP_063513442.1|270368_271568_+|portal	phage portal protein	portal	A0A0R6PDY3	Moraxella_phage	64.9	1.4e-139
WP_063513443.1|271564_272098_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PKF0	Moraxella_phage	60.6	1.7e-49
WP_063513444.1|272108_273296_+|capsid	phage major capsid protein	capsid	A0A0R6PIU4	Moraxella_phage	61.0	7.1e-128
WP_063513445.1|273371_273587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513446.1|273579_273900_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	33.3	2.1e-10
WP_063513447.1|273901_274231_+|head	phage head closure protein	head	A0A0R6PHN1	Moraxella_phage	65.7	3.3e-35
WP_063513448.1|274227_274770_+	hypothetical protein	NA	A0A0R6PK38	Moraxella_phage	55.3	8.7e-49
WP_063513449.1|274793_275162_+	DUF3168 domain-containing protein	NA	A0A0R6PKK8	Moraxella_phage	50.9	3.1e-26
WP_063513450.1|275165_275594_+	hypothetical protein	NA	A0A0R6PJI3	Moraxella_phage	73.8	3.3e-51
WP_063513451.1|275629_275953_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A0R6PJ73	Moraxella_phage	39.1	7.0e-14
WP_063513452.1|275973_276291_+	DUF4035 domain-containing protein	NA	A0A0R6PHY9	Moraxella_phage	54.6	4.3e-24
WP_063513453.1|276335_276737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513454.1|276767_280445_+	hypothetical protein	NA	A0A0R6PHL3	Moraxella_phage	34.7	5.4e-126
WP_084260554.1|280434_280776_+|tail	phage tail protein	tail	A0A0R6PHZ9	Moraxella_phage	81.7	5.8e-51
WP_063513455.1|280816_281206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513456.1|281257_281968_+|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	91.9	5.9e-130
WP_063513457.1|281976_282207_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	43.1	1.3e-06
WP_063513458.1|282380_282791_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	66.7	9.6e-08
WP_063513459.1|282783_283329_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	62.4	2.1e-58
WP_063513460.1|283325_283511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513461.1|283571_284363_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	80.2	2.8e-128
WP_063513462.1|284337_284535_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	43.1	2.1e-05
WP_063514913.1|284944_285529_+|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	84.5	1.5e-70
WP_063513463.1|285558_289830_+|tail	phage tail protein	tail	A0A0R6PGJ9	Moraxella_phage	86.2	0.0e+00
WP_063513464.1|289826_290186_+	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	46.2	1.1e-20
WP_063513465.1|290182_291226_+	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	39.2	6.1e-59
WP_063513466.1|291275_291644_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	43.8	2.4e-18
WP_063513467.1|291785_292112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513468.1|292121_292895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063513469.1|292897_293215_+|holin	phage holin family protein	holin	A0A0R6PHF6	Moraxella_phage	72.7	4.9e-36
WP_063513470.1|293242_293782_+	TIGR02594 family protein	NA	A0A1I9KFD8	Aeromonas_phage	46.5	5.4e-35
>prophage 2
NZ_CP011158	Moraxella ovis strain 199/55 chromosome, complete genome	2265514	1079304	1086464	2265514	integrase	Moraxella_phage(28.57%)	9	1067159:1067172	1081715:1081728
1067159:1067172	attL	TTTATAAAGCAGTA	NA	NA	NA	NA
WP_063514034.1|1079304_1080384_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	2.3e-08
WP_063514035.1|1080441_1081425_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.2	8.3e-66
WP_063514036.1|1081426_1082524_-	ribonucleotide-diphosphate reductase subunit beta	NA	M4M9S3	Vibrio_phage	70.8	1.9e-151
1081715:1081728	attR	TACTGCTTTATAAA	NA	NA	NA	NA
WP_063514037.1|1082529_1082832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063514038.1|1082812_1083331_-	hypothetical protein	NA	U5PZY8	Acinetobacter_phage	44.4	4.0e-35
WP_063514039.1|1083330_1084134_-	AAA family ATPase	NA	M4SLY4	Vibrio_phage	49.1	1.1e-55
WP_063514040.1|1084135_1084627_-	hypothetical protein	NA	A0A0R6PGZ8	Moraxella_phage	36.7	3.0e-08
WP_063514041.1|1084623_1084857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063514042.1|1085255_1086464_-	hypothetical protein	NA	A0A2P9J4X1	Pectobacterium_phage	38.3	3.0e-73
>prophage 3
NZ_CP011158	Moraxella ovis strain 199/55 chromosome, complete genome	2265514	1092672	1105915	2265514	capsid	Pectobacterium_phage(33.33%)	10	NA	NA
WP_046702105.1|1092672_1093356_+	hypothetical protein	NA	A0A0A0YUA7	Escherichia_phage	54.6	3.6e-60
WP_063514049.1|1093443_1095018_+	hypothetical protein	NA	A0A2P0PAT7	Pectobacterium_phage	61.6	5.8e-194
WP_063514050.1|1095027_1095672_+	hypothetical protein	NA	U5PWM5	Acinetobacter_phage	25.5	4.1e-05
WP_063514051.1|1095668_1097969_+	hypothetical protein	NA	A0A0A0YRN0	Escherichia_phage	47.7	3.2e-169
WP_063514052.1|1098033_1098336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063514053.1|1098328_1099438_+	hypothetical protein	NA	A0A2P9J503	Pectobacterium_phage	39.6	2.5e-42
WP_063514054.1|1099456_1100614_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2P0PAU2	Pectobacterium_phage	56.8	1.9e-117
WP_063514055.1|1100686_1101199_+	hypothetical protein	NA	A0A2I7R0J6	Vibrio_phage	40.6	1.1e-24
WP_063514056.1|1101216_1103328_+	hypothetical protein	NA	A0A2I7RAT8	Vibrio_phage	43.0	5.7e-11
WP_147285070.1|1103365_1105915_+	hypothetical protein	NA	U5PW53	Acinetobacter_phage	23.4	7.8e-31
>prophage 4
NZ_CP011158	Moraxella ovis strain 199/55 chromosome, complete genome	2265514	1320275	1329466	2265514		Acinetobacter_phage(50.0%)	10	NA	NA
WP_046698257.1|1320275_1320755_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.5	1.9e-15
WP_084260642.1|1321200_1322721_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_063514207.1|1322896_1323520_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	70.0	4.9e-80
WP_063514208.1|1323552_1324635_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	53.8	6.7e-93
WP_063514209.1|1324664_1325501_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	49.2	8.7e-56
WP_063514210.1|1325565_1326195_-	MarC family protein	NA	NA	NA	NA	NA
WP_063514211.1|1326346_1327042_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0D4D9V8	Escherichia_phage	36.6	8.0e-31
WP_063514212.1|1327151_1327493_+	quaternary ammonium transporter	NA	E5E3Y9	Acinetobacter_phage	40.0	3.8e-10
WP_063514213.1|1327510_1328095_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	52.5	8.8e-39
WP_046696703.1|1328152_1329466_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	85.1	1.7e-191
>prophage 5
NZ_CP011158	Moraxella ovis strain 199/55 chromosome, complete genome	2265514	1444442	1451197	2265514		Lake_Baikal_phage(33.33%)	8	NA	NA
WP_063514305.1|1444442_1445666_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.4	1.7e-31
WP_036366269.1|1445773_1446157_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	80.6	1.3e-51
WP_063514306.1|1446182_1446503_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.0	3.7e-23
WP_063514307.1|1446512_1447034_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_063514308.1|1447147_1449016_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	38.8	4.1e-98
WP_063514309.1|1449053_1449392_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_115265746.1|1449436_1450084_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	3.0e-24
WP_063514311.1|1450153_1451197_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	1.3e-77
