The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	231360	239308	5404176		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|231360_231645_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_063535503.1|231683_233318_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000743909.1|233724_235263_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|235646_236972_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929885.1|237117_237819_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_063535504.1|237802_239308_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	5.4e-32
>prophage 2
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	284519	292895	5404176		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|284519_285827_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|285915_286635_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_063535516.1|286627_286882_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_063535517.1|286878_287562_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055564.1|287545_289765_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879025.1|289749_291165_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_063535518.1|291270_292311_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.1	2.7e-67
WP_063535519.1|292307_292895_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	4.1e-28
>prophage 3
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	627306	635303	5404176		Bacillus_phage(66.67%)	8	NA	NA
WP_153579483.1|627306_628275_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	30.5	4.1e-17
WP_063535642.1|628354_628876_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_063535643.1|628889_630281_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	1.1e-36
WP_000565476.1|630292_630970_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_063535644.1|631145_632393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063535645.1|632526_633057_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.7	4.2e-16
WP_063535646.1|633069_633414_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	77.2	3.2e-41
WP_063535647.1|633851_635303_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.0	9.8e-140
>prophage 4
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	1820526	1829202	5404176		Bacillus_phage(66.67%)	8	NA	NA
WP_063536128.1|1820526_1821813_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194314.1|1821912_1822677_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063536129.1|1822917_1824678_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	97.7	2.2e-271
WP_000612411.1|1824763_1825441_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	3.3e-122
WP_063536130.1|1825437_1826511_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.2	1.1e-185
WP_000823541.1|1826535_1827123_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1827319_1828039_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_061457076.1|1828329_1829202_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 5
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	2008127	2036128	5404176	portal,head,integrase,terminase	Bacillus_phage(38.1%)	31	2015911:2015926	2036692:2036707
WP_000109855.1|2008127_2009201_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.3	6.9e-74
WP_000709201.1|2009197_2009323_+	aspartate phosphatase	NA	NA	NA	NA	NA
WP_063536204.1|2009747_2010884_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.7	8.1e-65
WP_063536205.1|2010904_2011423_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.3	2.9e-25
WP_000004574.1|2011873_2012230_-	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	38.4	1.8e-10
WP_016091031.1|2012416_2012620_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	47.7	8.6e-10
WP_063536206.1|2012653_2012953_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	36.0	1.4e-08
WP_063536207.1|2013020_2013536_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	25.3	8.9e-11
WP_000151153.1|2013566_2013788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536208.1|2013969_2014254_+	hypothetical protein	NA	D2XR42	Bacillus_phage	57.4	4.1e-26
WP_063536209.1|2014371_2015355_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	48.7	1.4e-52
WP_063536210.1|2015365_2015728_+	hypothetical protein	NA	D2XR47	Bacillus_phage	78.3	1.5e-49
WP_000511367.1|2015799_2015991_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	66.7	3.7e-15
2015911:2015926	attL	GGTGGATTTGGTGAAC	NA	NA	NA	NA
WP_061684752.1|2016383_2016770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536211.1|2017634_2018207_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	85.3	2.8e-90
WP_063536212.1|2020067_2021384_-	collagen-like protein	NA	A0A285PWR0	Cedratvirus	62.6	3.4e-38
WP_063536213.1|2023602_2024259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536214.1|2024612_2025095_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.7e-72
WP_063536215.1|2025094_2025637_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	90.6	4.7e-87
WP_063536216.1|2025850_2026801_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_063536217.1|2027609_2028779_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.6	3.9e-22
WP_063536218.1|2029122_2029341_+	hypothetical protein	NA	H0USV5	Bacillus_phage	63.5	1.5e-20
WP_001068928.1|2029767_2029974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063536219.1|2030243_2030648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536220.1|2030647_2030863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576168.1|2031022_2031595_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.3	5.4e-41
WP_000390790.1|2031646_2031826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536221.1|2031847_2032675_+|terminase	terminase	terminase	A0A1L2JY44	Aeribacillus_phage	37.7	1.9e-34
WP_063536222.1|2032667_2033945_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	64.9	9.5e-155
WP_063536223.1|2034014_2035496_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_063536224.1|2035609_2036128_+|head	phage head morphogenesis protein	head	Q1WDG7	Streptomyces_phage	34.4	1.4e-08
2036692:2036707	attR	GGTGGATTTGGTGAAC	NA	NA	NA	NA
>prophage 6
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	2466688	2554653	5404176	portal,tRNA,transposase,protease,bacteriocin,tail,terminase,holin,capsid,head,integrase	Bacillus_phage(70.45%)	86	2501172:2501204	2562124:2562156
WP_063536426.1|2466688_2468242_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_063536427.1|2468880_2469795_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238990.1|2469920_2470628_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063536428.1|2470624_2471608_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_063538350.1|2472051_2473680_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.3	4.6e-53
WP_063536429.1|2473700_2474285_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063536430.1|2474543_2475314_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	2.8e-32
WP_063536431.1|2475288_2477220_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063536432.1|2477287_2477956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536433.1|2478032_2478374_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517071.1|2478637_2479879_+	lipase	NA	NA	NA	NA	NA
WP_063536434.1|2479966_2480992_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_063536435.1|2481081_2482530_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_061660682.1|2482534_2483449_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000144509.1|2483755_2484445_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2484842_2485106_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_080470706.1|2485649_2485943_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002178127.1|2486432_2486918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536437.1|2487229_2487931_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_063536438.1|2487969_2489079_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	6.4e-147
WP_063536439.1|2489684_2490893_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	43.6	8.3e-76
WP_000367267.1|2491338_2491689_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	37.1	1.4e-15
WP_063536440.1|2491875_2492100_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	3.6e-09
WP_063536441.1|2492140_2492407_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	74.1	7.0e-28
WP_063536442.1|2492782_2493754_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	56.2	2.0e-67
WP_063536443.1|2493757_2494036_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	66.1	9.3e-15
WP_063536444.1|2494028_2494388_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	9.2e-31
WP_080470708.1|2494407_2494575_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	66.0	9.5e-15
WP_063536445.1|2494600_2494852_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	50.0	4.5e-16
WP_063536446.1|2494871_2495381_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	43.8	3.0e-27
WP_063536447.1|2495526_2496303_-	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	82.2	5.3e-124
WP_063536448.1|2498229_2498550_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	72.7	2.4e-14
WP_063536449.1|2499895_2500096_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	77.3	1.9e-22
2501172:2501204	attL	AGAATATAGTCCGGCTAGAAAACTAGAGGACAC	NA	NA	NA	NA
WP_063536450.1|2501477_2501960_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.9	2.1e-70
WP_063536451.1|2501959_2502502_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	8.6e-89
WP_063538352.1|2503498_2504914_+	amino acid permease	NA	NA	NA	NA	NA
WP_154818484.1|2505019_2505961_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.5	2.2e-39
WP_000516502.1|2505882_2506191_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063536454.1|2506575_2507313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536455.1|2507671_2508529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536456.1|2508739_2509033_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	81.4	1.3e-38
WP_063536457.1|2509029_2509422_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	89.1	1.3e-67
WP_063538354.1|2509505_2509931_+|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	93.6	2.0e-69
WP_063536458.1|2509927_2511652_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	93.6	0.0e+00
WP_063536459.1|2511667_2512852_+|portal	phage portal protein	portal	A0A2H4JBS9	uncultured_Caudovirales_phage	97.7	6.0e-220
WP_063536460.1|2512841_2513423_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	94.8	7.8e-96
WP_063536461.1|2513424_2514735_+|capsid	phage major capsid protein	capsid	A0A1B0T682	Bacillus_phage	94.3	9.0e-193
WP_063536462.1|2514736_2514997_+	hypothetical protein	NA	A0A1B0T690	Bacillus_phage	91.9	6.6e-39
WP_063536463.1|2514977_2515307_+	hypothetical protein	NA	A0A1B0T691	Bacillus_phage	97.2	5.4e-54
WP_063536464.1|2515296_2515626_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	97.2	2.6e-56
WP_063536465.1|2515625_2516003_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	98.4	2.5e-63
WP_000215488.1|2516014_2516650_+	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	98.1	6.3e-115
WP_063536466.1|2516661_2517048_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	83.6	1.7e-54
WP_063536467.1|2517291_2520816_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	96.8	0.0e+00
WP_063536468.1|2520816_2521500_+|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	96.9	6.9e-128
WP_063536469.1|2521496_2523839_+	endopeptidase	NA	A0A1B0T695	Bacillus_phage	94.1	0.0e+00
WP_063536470.1|2523853_2525029_+	DUF2479 domain-containing protein	NA	A0A1B1P768	Bacillus_phage	70.9	1.2e-151
WP_000390479.1|2525182_2525407_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
WP_063536471.1|2525482_2525908_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	94.3	4.5e-69
WP_063536472.1|2525907_2526717_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	91.1	4.8e-152
WP_063536473.1|2526974_2528657_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_063536474.1|2528864_2529632_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_063536475.1|2529771_2530188_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878372.1|2530308_2530512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362068.1|2530840_2531053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063536476.1|2531261_2532266_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282687.1|2532411_2532816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063536477.1|2532976_2534212_+	cytochrome P450	NA	NA	NA	NA	NA
WP_063536478.1|2534479_2535763_+	MFS transporter	NA	NA	NA	NA	NA
WP_063536479.1|2535752_2536385_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.8	5.4e-26
WP_000046095.1|2536455_2536611_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2536713_2537211_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063536480.1|2537351_2538566_+	cytochrome P450	NA	NA	NA	NA	NA
WP_063536481.1|2538675_2539254_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_063536482.1|2539429_2540281_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_063536483.1|2540687_2542475_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_063536484.1|2542709_2544836_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_063536485.1|2544912_2545443_+	signal peptidase I	NA	NA	NA	NA	NA
WP_063536486.1|2545701_2546889_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.1	8.9e-06
WP_000864400.1|2546979_2547660_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_063536487.1|2548069_2548618_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063536488.1|2548628_2550329_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.0	1.5e-14
WP_048535402.1|2550321_2551122_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2551258_2551366_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_080470715.1|2551467_2552727_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	7.0e-25
WP_154818485.1|2553493_2554653_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
2562124:2562156	attR	AGAATATAGTCCGGCTAGAAAACTAGAGGACAC	NA	NA	NA	NA
>prophage 7
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	3623928	3634085	5404176	bacteriocin	Bacillus_phage(45.45%)	14	NA	NA
WP_000413738.1|3623928_3624549_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976237.1|3624639_3625443_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031383.1|3625443_3625986_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3625978_3626302_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392444.1|3626673_3626904_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	73.7	1.5e-23
WP_063537086.1|3626965_3627862_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.8	6.0e-79
WP_063537087.1|3628137_3628980_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.0	8.8e-32
WP_153579728.1|3629102_3630089_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.1	3.2e-33
WP_000464425.1|3630324_3630711_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_063537088.1|3630829_3631702_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	60.1	6.8e-96
WP_001189064.1|3631850_3632045_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_063537089.1|3632055_3632814_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	70.7	1.3e-98
WP_000283430.1|3633010_3633223_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_063537090.1|3633425_3634085_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.5	3.0e-35
>prophage 8
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	3687873	3819422	5404176	coat,portal,tRNA,protease,transposase,bacteriocin,integrase,tail,holin,capsid,head,terminase	Bacillus_phage(46.15%)	118	3697619:3697636	3821482:3821499
WP_063537113.1|3687873_3688230_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_063537114.1|3688263_3689697_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006458.1|3689883_3690075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537115.1|3690294_3691002_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671628.1|3691032_3692442_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.0	1.0e-56
WP_000066298.1|3692633_3693623_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_063537116.1|3693801_3695643_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_000771012.1|3695937_3696735_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.0	1.6e-35
WP_063537117.1|3697001_3698339_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
3697619:3697636	attL	TTCCCTAAATATTTCTCA	NA	NA	NA	NA
WP_063537118.1|3698834_3700754_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.7	2.6e-95
WP_063537119.1|3700849_3703633_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000461138.1|3704137_3704323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063537120.1|3704600_3706544_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.4	3.8e-62
WP_063537121.1|3706552_3709225_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.5	7.9e-34
WP_001288799.1|3709405_3709948_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_063537122.1|3710072_3710504_-	master regulator for biofilm formation	NA	NA	NA	NA	NA
WP_001005386.1|3710507_3712037_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190155.1|3712466_3713333_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625418.1|3713319_3715077_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688045.1|3715301_3716225_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3716284_3716545_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3716694_3717489_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000204911.1|3717651_3719214_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001115373.1|3719695_3720121_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.9	2.7e-45
WP_000990690.1|3721197_3722436_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3722456_3723035_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_063537123.1|3723099_3724011_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3724032_3724818_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114450.1|3724956_3725205_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759604.1|3725280_3725994_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411976.1|3726094_3727381_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.0e-10
WP_063537124.1|3727381_3728656_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.3	1.6e-56
WP_000008857.1|3728865_3729825_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3729825_3730884_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456914.1|3730876_3732409_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	3.7e-12
WP_000725771.1|3732526_3733612_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3733704_3734430_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118782.1|3734967_3737349_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605036.1|3737561_3737765_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139806.1|3737761_3738511_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_063537125.1|3738612_3740283_-	ribonuclease J	NA	NA	NA	NA	NA
WP_063537126.1|3741019_3741898_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3741909_3743142_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3743165_3744212_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_154818489.1|3744362_3744599_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_063537127.1|3744788_3746507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063537128.1|3746521_3747010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063537129.1|3748398_3749208_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	83.3	3.4e-134
WP_000389069.1|3749207_3749435_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	98.6	2.0e-23
WP_063537130.1|3749474_3749804_-	hypothetical protein	NA	A0A2H4JGF7	uncultured_Caudovirales_phage	51.7	8.4e-23
WP_063537131.1|3749818_3755131_-	peptidase S74	NA	D2XR28	Bacillus_phage	46.4	3.0e-295
WP_063537132.1|3755127_3756585_-|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	53.0	5.8e-156
WP_063537133.1|3756626_3760247_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	91.3	4.0e-198
WP_063537134.1|3760477_3760840_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	80.8	3.6e-51
WP_063537135.1|3760844_3761432_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	83.1	3.0e-87
WP_063537136.1|3761432_3761762_-	hypothetical protein	NA	D2XR22	Bacillus_phage	94.5	2.7e-53
WP_063537137.1|3761758_3762103_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	91.1	2.2e-50
WP_063537138.1|3762104_3762458_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	5.1e-58
WP_063537139.1|3762459_3762753_-	hypothetical protein	NA	D2XR19	Bacillus_phage	88.7	1.3e-43
WP_063537140.1|3762758_3763913_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.7	2.1e-201
WP_063537141.1|3763916_3764699_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	59.5	2.7e-59
WP_063537142.1|3764682_3765846_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.0	1.7e-179
WP_063537143.1|3765854_3767522_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	91.0	1.8e-307
WP_063537144.1|3767518_3767830_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	98.1	1.2e-47
WP_063538410.1|3767956_3768292_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	89.2	1.2e-51
WP_063537145.1|3768387_3768636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537146.1|3769200_3769824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537147.1|3770109_3770493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537148.1|3770820_3771363_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	3.8e-89
WP_063537149.1|3771362_3771827_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	93.5	2.3e-74
WP_085964400.1|3772254_3773615_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.1e-111
WP_063537150.1|3773703_3775056_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	37.0	4.1e-15
WP_080470787.1|3775138_3776410_-	hypothetical protein	NA	A0A0E3D983	Bacillus_phage	57.3	8.6e-23
WP_063537151.1|3776755_3776950_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	57.1	7.9e-13
WP_063537152.1|3777027_3777390_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	6.4e-56
WP_001991829.1|3777364_3777553_-	hypothetical protein	NA	D2XR45	Bacillus_phage	85.5	1.3e-15
WP_063537153.1|3777555_3778878_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.5	1.8e-236
WP_063537154.1|3778874_3779825_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	58.4	3.7e-79
WP_063537155.1|3780104_3780389_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	1.9e-23
WP_063537156.1|3780569_3780791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537277.1|3780804_3781392_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.7	2.2e-74
WP_063537157.1|3781482_3781731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061654401.1|3781782_3781971_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	55.0	5.5e-11
WP_061654403.1|3782126_3782561_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	50.3	2.5e-30
WP_063537158.1|3782573_3783008_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	77.1	1.1e-59
WP_063537159.1|3783048_3783681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063537160.1|3783781_3784663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063537161.1|3784783_3786331_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.6	1.0e-142
WP_000954735.1|3786785_3787688_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3787858_3788110_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592996.1|3788243_3789485_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	5.8e-56
WP_017672874.1|3789571_3790471_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076737.1|3790624_3792763_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3792923_3793193_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_063537162.1|3793293_3794265_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	1.6e-05
WP_000399356.1|3794308_3795232_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3795318_3795675_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582363.1|3795690_3795972_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036343.1|3795968_3798029_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_001286523.1|3798033_3798345_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|3798345_3798618_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102604.1|3798629_3799736_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359096.1|3799753_3800224_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060005.1|3800560_3804862_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814302.1|3804986_3806687_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090243.1|3806796_3808053_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_000790373.1|3808070_3809213_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000813592.1|3809236_3810028_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000971296.1|3810045_3810822_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000531501.1|3810907_3811465_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000042668.1|3811467_3812190_-	UMP kinase	NA	NA	NA	NA	NA
WP_001018578.1|3812256_3813144_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000111485.1|3813247_3813949_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000421290.1|3814296_3815076_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000550078.1|3815153_3816545_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.5	3.6e-46
WP_000526272.1|3816567_3817110_-|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_001101243.1|3817152_3818052_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.8	3.1e-35
WP_000213002.1|3818117_3819422_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
3821482:3821499	attR	TTCCCTAAATATTTCTCA	NA	NA	NA	NA
>prophage 9
NZ_CP011155	Bacillus cereus strain HN001, complete genome	5404176	3884323	3956212	5404176	portal,tRNA,protease,integrase,tail,holin,capsid,terminase	Bacillus_phage(83.02%)	85	3883950:3883966	3956603:3956619
3883950:3883966	attL	CTATTTCCATTTTAAAT	NA	NA	NA	NA
WP_063537196.1|3884323_3887089_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	9.1e-86
WP_001131611.1|3887435_3887942_-	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_002164454.1|3888031_3888799_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000214233.1|3888814_3889078_-	YggT family protein	NA	NA	NA	NA	NA
WP_000119129.1|3889084_3889555_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_000218005.1|3889574_3890249_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001209008.1|3890245_3891064_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000236745.1|3891184_3891466_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000197755.1|3891629_3892409_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	3.4e-46
WP_000976948.1|3892566_3893286_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_000261975.1|3893306_3894224_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000888984.1|3894481_3895636_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001087558.1|3895675_3896983_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_001065793.1|3897382_3898153_-	cell division protein DivIB	NA	NA	NA	NA	NA
WP_063537198.1|3898251_3899157_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_025689214.1|3899369_3900464_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000753524.1|3900567_3901659_-	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_063537200.1|3901749_3903102_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000893060.1|3903102_3904077_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_063537202.1|3904099_3905575_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001266235.1|3905760_3907677_-	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_063538414.1|3907758_3909855_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000182804.1|3909927_3910290_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000472508.1|3910305_3911238_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_063537204.1|3911608_3913225_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_002182931.1|3913304_3914189_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000506694.1|3914485_3914959_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000246467.1|3914992_3915499_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.9e-11
WP_001984764.1|3915628_3915802_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000872149.1|3915863_3916364_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_063537206.1|3916648_3917266_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	88.1	1.8e-98
WP_063538416.1|3917207_3918389_-	cell division protein FtsK	NA	A0A288WGQ0	Bacillus_phage	89.3	1.4e-205
WP_063537208.1|3918506_3918689_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.0e-22
WP_063537210.1|3918691_3918994_-	hypothetical protein	NA	Q2I8E3	Bacillus_phage	93.0	1.4e-48
WP_063537212.1|3919156_3919363_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7S8	Bacillus_phage	66.2	1.6e-16
WP_063537214.1|3919590_3919944_+	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.7	1.3e-08
WP_063538418.1|3919985_3920714_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7T9	Bacillus_phage	82.1	5.9e-117
WP_000792698.1|3920730_3920961_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	4.5e-31
WP_001115042.1|3921003_3921243_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_063537216.1|3921323_3922505_-	DUF2479 domain-containing protein	NA	A0A1B1P768	Bacillus_phage	95.2	5.8e-215
WP_063537218.1|3922519_3924925_-	endopeptidase	NA	A0A1B1P770	Bacillus_phage	93.4	0.0e+00
WP_063537220.1|3924924_3925608_-|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	93.8	9.1e-120
WP_063537222.1|3925609_3928705_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	91.0	3.7e-237
WP_063537224.1|3928959_3930540_-	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	99.2	1.5e-133
WP_063537226.1|3930718_3931180_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	99.3	8.9e-79
WP_063537228.1|3931251_3931836_-	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	86.6	3.3e-94
WP_080470790.1|3931836_3932265_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	99.3	8.0e-74
WP_063537230.1|3932251_3932629_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	73.6	2.8e-46
WP_063537232.1|3932603_3933002_-	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	78.0	2.3e-46
WP_063537234.1|3932982_3933279_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	99.0	5.2e-48
WP_063537236.1|3933298_3934450_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	97.7	1.5e-212
WP_063538422.1|3934478_3935204_-|protease	Clp protease ClpP	protease	A0A1B1P753	Bacillus_phage	99.2	6.0e-122
WP_063537238.1|3935205_3936375_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	92.8	1.8e-208
WP_063537240.1|3936389_3938072_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.4	1.1e-310
WP_063537242.1|3938055_3938376_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	1.9e-43
WP_063537244.1|3938483_3938792_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	90.4	1.9e-45
WP_063537246.1|3938794_3939142_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	55.9	1.9e-25
WP_063537248.1|3939144_3939411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537250.1|3939415_3939640_-	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	76.7	2.8e-22
WP_063537252.1|3939687_3939885_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	8.6e-23
WP_063537254.1|3939926_3940145_-	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	41.5	3.0e-08
WP_063537256.1|3940752_3941295_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	99.4	1.2e-95
WP_001041469.1|3941291_3941762_-	hypothetical protein	NA	A0A1B1P744	Bacillus_phage	99.4	5.5e-84
WP_063537258.1|3942224_3942524_-	hypothetical protein	NA	Q3HKX6	Bacillus_phage	81.8	2.2e-38
WP_063537260.1|3942514_3942727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537262.1|3942759_3943680_-	DNA cytosine methyltransferase	NA	A0A0U4JEA2	Bacillus_phage	59.4	9.4e-88
WP_063537264.1|3944343_3944775_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	38.9	1.3e-18
WP_063537266.1|3945090_3945810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063537268.1|3946001_3946478_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	66.9	1.7e-61
WP_063537270.1|3946481_3946997_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	46.0	6.8e-27
WP_063537272.1|3947017_3947491_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	35.5	3.9e-05
WP_000711473.1|3947516_3947681_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	53.7	2.4e-10
WP_001125976.1|3947700_3948060_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	56.9	7.5e-33
WP_063537274.1|3948052_3948331_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	6.7e-13
WP_063537276.1|3948334_3949303_-	DnaD domain protein	NA	A0A0U3TZZ4	Bacillus_phage	95.4	1.1e-78
WP_000284336.1|3949734_3949935_-	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	49.0	1.4e-07
WP_000935433.1|3950044_3950239_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	45.2	4.7e-05
WP_001021267.1|3950407_3950764_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	41.6	5.9e-14
WP_000908627.1|3950760_3950943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002000721.1|3951085_3951199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834541.1|3951221_3952367_-	hypothetical protein	NA	H0UST6	Bacillus_phage	33.2	7.4e-58
WP_002164445.1|3952803_3953148_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	27.8	4.9e-05
WP_063537278.1|3953664_3953970_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	44.0	6.2e-12
WP_063537280.1|3953960_3954851_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_063537282.1|3955081_3956212_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	38.6	5.2e-64
3956603:3956619	attR	CTATTTCCATTTTAAAT	NA	NA	NA	NA
>prophage 1
NZ_CP011156	Bacillus cereus strain HN001 plasmid pRML01, complete sequence	435420	22158	95208	435420	transposase	Bacillus_phage(35.71%)	48	NA	NA
WP_080470899.1|22158_22281_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.5	6.5e-05
WP_000219733.1|22380_22677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538475.1|23062_24184_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.0	1.8e-173
WP_063538479.1|27262_28264_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.8	1.5e-22
WP_063538481.1|28353_29634_-	MFS transporter	NA	NA	NA	NA	NA
WP_063538488.1|30126_31152_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_063538490.1|31250_32249_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_063538492.1|32327_33791_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_063538494.1|33945_35880_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_063538496.1|36002_36899_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_063538498.1|36987_37833_+	class II aldolase	NA	NA	NA	NA	NA
WP_063538500.1|37937_38729_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_048565539.1|38910_39795_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_063538502.1|40138_41404_+	peptidoglycan-binding protein	NA	F8TUT3	EBPR_podovirus	57.6	2.3e-15
WP_063538504.1|41541_42177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538506.1|42860_43787_+	YndM family protein	NA	NA	NA	NA	NA
WP_063538508.1|43786_45301_+	LysM peptidoglycan-binding domain-containing protein	NA	L0LA71	Bacillus_phage	32.1	5.3e-19
WP_063538510.1|45690_46566_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7HER1	Arthrobacter_phage	41.0	2.4e-08
WP_063538512.1|48367_50035_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_063538514.1|50052_51222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141550226.1|51605_51791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538516.1|52415_52676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080470900.1|52612_53320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080470901.1|53420_55526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080470902.1|55892_56456_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_063538522.1|56651_58040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538524.1|59734_60070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538526.1|60329_60704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538528.1|61847_63830_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.9	2.6e-18
WP_063538532.1|64152_65268_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.3	1.2e-108
WP_063538534.1|65868_66993_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000527366.1|66989_68093_-	endospore germination permease	NA	NA	NA	NA	NA
WP_063538536.1|68094_69588_-	spore germination protein	NA	NA	NA	NA	NA
WP_063538538.1|70478_71522_-	Fic family protein	NA	NA	NA	NA	NA
WP_063538540.1|72695_73808_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	44.7	6.3e-78
WP_063538542.1|73819_74218_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	1.5e-50
WP_063538544.1|74730_76107_+	chitin-binding protein	NA	G1FGA4	Mycobacterium_phage	38.1	1.3e-08
WP_063538546.1|76300_77716_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_063538548.1|78128_78698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538993.1|79563_81546_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001281108.1|82209_82905_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	1.3e-36
WP_063538550.1|82894_84049_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.5	4.9e-17
WP_063538552.1|85342_85981_+	teicoplanin resistance protein VanZ	NA	NA	NA	NA	NA
WP_063538554.1|86278_87262_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_063538556.1|87912_88338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538560.1|89225_90425_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063538562.1|90491_91958_+	MBL fold metallo-hydrolase	NA	A0A0P0BYG5	Ostreococcus_lucimarinus_virus	33.7	4.2e-05
WP_154818496.1|93777_95208_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011156	Bacillus cereus strain HN001 plasmid pRML01, complete sequence	435420	218173	278877	435420	coat,transposase	Bacillus_phage(50.0%)	48	NA	NA
WP_063538721.1|218173_219295_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.7	2.0e-164
WP_063538723.1|219589_219910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538725.1|220003_221170_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	26.9	9.7e-21
WP_063538727.1|222775_222937_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_063538729.1|223558_223927_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_063538731.1|224483_225575_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	25.7	6.5e-11
WP_063538733.1|225841_226216_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080470920.1|226476_226752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080470921.1|228542_229289_-	peptide transporter	NA	NA	NA	NA	NA
WP_063538735.1|229324_229636_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_154818498.1|230904_231312_-	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_063538741.1|231684_232059_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	47.9	1.9e-26
WP_063538743.1|232640_232955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247531.1|233863_234205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538745.1|234286_234475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538750.1|235086_236208_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	78.3	1.5e-164
WP_000120178.1|236537_236630_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_063538752.1|237249_238377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538754.1|238823_239195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538756.1|241609_241837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000505646.1|244017_244407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538758.1|245138_245327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538762.1|248466_249681_-	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	25.8	2.7e-13
WP_063538766.1|251393_252215_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.2	4.7e-54
WP_063538768.1|252421_253711_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.9	3.4e-75
WP_063538770.1|253707_254661_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	34.0	3.9e-36
WP_063538772.1|254664_255855_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063538774.1|256596_257463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538776.1|257543_258110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000393193.1|258111_259170_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_000684274.1|259194_260331_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002182058.1|260480_261584_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_063538778.1|263078_263450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528327.1|263902_264088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528326.1|264163_264349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538780.1|264424_264697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538782.1|265360_266230_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001041681.1|266584_266764_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_063538784.1|267477_268041_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_063538786.1|268498_269116_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_063538788.1|269346_269655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538790.1|269892_270690_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063538792.1|271159_271936_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_001048815.1|273834_274401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153579814.1|275032_275254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038400.1|277381_277954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080470926.1|278177_278399_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_142292806.1|278358_278877_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.0	1.2e-23
>prophage 3
NZ_CP011156	Bacillus cereus strain HN001 plasmid pRML01, complete sequence	435420	288749	340368	435420	transposase,protease,integrase	Bacillus_phage(52.94%)	42	281747:281762	333301:333316
281747:281762	attL	AATTTTATTTAAAATA	NA	NA	NA	NA
WP_063538812.1|288749_289322_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.9	3.2e-33
WP_080001279.1|289733_289943_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	57.4	1.4e-07
WP_063538814.1|290177_291407_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000648342.1|292001_292280_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.6	7.1e-15
WP_063538816.1|292703_292967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063539005.1|292993_293182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538820.1|293866_294697_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	80.8	1.9e-132
WP_063538822.1|294918_295152_-	hypothetical protein	NA	A0A1B1P7E0	Bacillus_phage	63.8	7.3e-21
WP_063538824.1|295247_295616_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	83.7	1.0e-53
WP_063538826.1|295753_296416_-	class D sortase	NA	NA	NA	NA	NA
WP_063538828.1|299379_300129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538830.1|300154_301603_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001006721.1|301602_302037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538835.1|304573_305413_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063538837.1|305753_307451_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061667515.1|308001_308733_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_063538841.1|308725_310261_+	gluconokinase	NA	NA	NA	NA	NA
WP_063538843.1|310379_311726_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_063538845.1|311989_313399_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.2	7.5e-44
WP_063538847.1|315092_316802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061668076.1|317699_317921_-	helix-turn-helix transcriptional regulator	NA	B5LPT1	Bacillus_virus	50.0	2.5e-10
WP_063538849.1|318210_318531_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	58.5	3.2e-27
WP_063538851.1|318541_319708_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	78.6	3.6e-177
WP_063539007.1|319730_320306_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	76.7	8.0e-85
WP_063538853.1|320749_321427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154818499.1|321451_321613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538855.1|322271_322919_+	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	32.5	4.1e-13
WP_063538857.1|323225_323732_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063538859.1|323978_324911_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_063538861.1|325694_326588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538863.1|328149_328617_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_063538865.1|328965_330606_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	24.9	2.0e-19
WP_074542402.1|330824_331226_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.2	4.4e-50
WP_063538869.1|331231_332311_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.8	4.9e-19
WP_000577223.1|332889_333297_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016093854.1|333286_333700_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
333301:333316	attR	TATTTTAAATAAAATT	NA	NA	NA	NA
WP_063538871.1|334115_334526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063538873.1|335244_335724_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063538875.1|336704_338447_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_001167049.1|338630_338846_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.1	1.7e-19
WP_063538877.1|338915_339335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063538879.1|339969_340368_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	4.0e-51
>prophage 4
NZ_CP011156	Bacillus cereus strain HN001 plasmid pRML01, complete sequence	435420	426353	433550	435420		Catovirus(33.33%)	6	NA	NA
WP_063538985.1|426353_427145_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	34.3	3.2e-07
WP_001182747.1|427570_428860_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.7	4.8e-05
WP_001124413.1|429149_429917_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.6	1.2e-08
WP_000465152.1|430360_431386_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELS8	Moumouvirus	33.6	7.2e-36
WP_000699379.1|431382_432345_+	NAD-dependent epimerase/dehydratase family protein	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	31.2	3.8e-31
WP_000251218.1|432344_433550_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2P1ELT3	Moumouvirus	34.0	4.8e-47
>prophage 1
NZ_CP011157	Bacillus cereus strain HN001 plasmid pRML02, complete sequence	141238	17874	44476	141238	integrase,bacteriocin,transposase	Bacillus_phage(40.0%)	31	40263:40278	47000:47015
WP_063539031.1|17874_18519_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	60.2	1.8e-64
WP_063539033.1|18928_20008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080470941.1|20119_20311_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_063539035.1|21392_21716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063539037.1|21836_22130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141435850.1|22698_22869_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_063539039.1|22904_23681_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	35.5	4.4e-38
WP_061667675.1|23677_23968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063539041.1|24266_24764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063539043.1|25166_25793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063539044.1|27080_27599_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	77.8	2.2e-49
WP_154818504.1|27845_28016_-	sortase	NA	NA	NA	NA	NA
WP_063539046.1|28239_28713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063539048.1|30369_31749_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_063539050.1|32392_32578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046945618.1|33030_33330_+	DUF2089 family protein	NA	NA	NA	NA	NA
WP_063539052.1|33329_33623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063539054.1|33993_34140_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063539056.1|34182_34329_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063539058.1|34371_34518_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063539058.1|34560_34707_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063539060.1|34749_34896_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_080470945.1|35138_35630_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_063539064.1|35650_37168_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_063539066.1|37262_38456_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_063539068.1|38452_39133_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	6.9e-35
WP_063539070.1|39129_40320_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
40263:40278	attL	AATTCCTGCAAATAAA	NA	NA	NA	NA
WP_063539072.1|40391_41066_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_063539074.1|41267_41654_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063539076.1|41927_42929_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063539078.1|43303_44476_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.0	1.4e-06
47000:47015	attR	TTTATTTGCAGGAATT	NA	NA	NA	NA
