The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	570830	580209	4646070		Hokovirus(16.67%)	7	NA	NA
WP_063494831.1|570830_572783_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	48.9	6.6e-147
WP_063494832.1|573051_574194_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.9	4.7e-28
WP_063494833.1|574218_576108_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	37.0	3.3e-55
WP_063494834.1|576501_577317_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	28.8	8.2e-35
WP_063494835.1|577354_578035_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.5	1.5e-05
WP_063494836.1|578031_578580_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_063494837.1|578628_580209_-	polynucleotide adenylyltransferase PcnB	NA	A0A172Q0J1	Acinetobacter_phage	30.6	1.5e-16
>prophage 2
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	712700	783083	4646070	transposase	Escherichia_phage(23.08%)	59	NA	NA
WP_063494926.1|712700_713918_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.9	1.2e-138
WP_006047743.1|714034_714205_+	rubredoxin	NA	NA	NA	NA	NA
WP_063494927.1|714462_715884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042327851.1|716143_716722_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_063494928.1|716732_717173_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_063494929.1|717159_717702_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_063494930.1|717739_718765_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.7	3.8e-29
WP_063494931.1|718913_720194_+	dihydroorotase	NA	NA	NA	NA	NA
WP_063494932.1|720231_721083_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_082854921.1|721092_722100_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_063494933.1|722365_723499_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	54.4	5.7e-111
WP_063497815.1|723637_724552_+	GDP-mannose 4,6-dehydratase	NA	NA	NA	NA	NA
WP_063494934.1|724850_725912_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.6	1.9e-84
WP_063494935.1|725922_726816_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.9	4.9e-97
WP_063494936.1|726800_727352_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.3	6.8e-49
WP_063494937.1|727348_728242_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	32.2	1.6e-23
WP_054041700.1|728272_729097_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063494938.1|729086_730469_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_063494939.1|730465_733747_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_063494940.1|733757_734801_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	41.5	5.9e-62
WP_063494941.1|734800_735382_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_082854922.1|735378_736086_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_063494942.1|736090_736657_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_063494943.1|736762_737515_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_063494944.1|737603_738011_-	GtrA family protein	NA	NA	NA	NA	NA
WP_063494945.1|738012_738930_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_082854924.1|739005_740970_-	NAD-dependent epimerase/dehydratase family protein	NA	F1C5B0	Cronobacter_phage	37.0	3.0e-46
WP_063494946.1|740992_741898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063494947.1|741894_742680_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	34.8	9.1e-15
WP_158515231.1|742698_744138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063494949.1|744530_745742_-	acyltransferase	NA	NA	NA	NA	NA
WP_063494950.1|746050_746713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494951.1|748146_749205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494952.1|749514_750558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063494953.1|750847_751618_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	26.9	2.1e-19
WP_063494954.1|753286_754948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063494955.1|755387_756503_+	acyltransferase	NA	NA	NA	NA	NA
WP_148662089.1|756551_757418_-	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_181448416.1|758663_759620_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_063494958.1|759729_761757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494959.1|761919_762765_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_063494960.1|762761_763718_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_063494961.1|763726_764761_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063497818.1|764766_766650_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_063494962.1|767219_767669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494963.1|767959_768373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494964.1|768475_768964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063494965.1|768939_769296_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.9	1.2e-17
WP_063494966.1|769326_770907_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_148662090.1|771013_771169_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_063494967.1|771200_773294_-	recombinase family protein	NA	NA	NA	NA	NA
WP_063494968.1|773583_774048_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_158515232.1|774228_774570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082854926.1|774755_776279_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.1	3.6e-60
WP_063494969.1|776293_776785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494970.1|780320_780707_-	GtrA family protein	NA	NA	NA	NA	NA
WP_082854927.1|781937_782204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494971.1|782448_782940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515233.1|782954_783083_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	1070811	1147391	4646070	tRNA,transposase,integrase	Saccharomonospora_phage(10.0%)	59	1145352:1145387	1148722:1148757
WP_063495190.1|1070811_1071696_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_063497836.1|1071936_1072800_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_063495192.1|1073216_1076795_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	35.2	4.7e-175
WP_063495193.1|1076849_1077611_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	33.3	4.9e-05
WP_063495194.1|1077796_1079590_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	26.7	8.4e-48
WP_063495195.1|1079732_1080806_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063495196.1|1081016_1082036_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_063495197.1|1082367_1083378_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158515239.1|1083528_1083672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495198.1|1084030_1084351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495199.1|1084506_1085430_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	41.3	7.8e-58
WP_082854941.1|1086742_1095106_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	32.1	7.7e-27
WP_063495203.1|1095102_1095321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495204.1|1095419_1097174_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_063495205.1|1097542_1098439_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_063495206.1|1098552_1099356_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_063495207.1|1099406_1099880_-	VOC family protein	NA	NA	NA	NA	NA
WP_063495208.1|1099911_1100388_-	VOC family protein	NA	NA	NA	NA	NA
WP_082854942.1|1100643_1102296_-	SH3 domain-containing C40 family peptidase	NA	NA	NA	NA	NA
WP_063495209.1|1102664_1103087_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_063497838.1|1103265_1103766_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_063495210.1|1103965_1104175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495211.1|1104623_1106333_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_063495212.1|1106472_1106982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495213.1|1107160_1108294_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_063497839.1|1108412_1108838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063497840.1|1109167_1109584_-	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_063497841.1|1109595_1109790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495214.1|1110833_1111094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855146.1|1111333_1111564_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063495216.1|1111755_1111992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855147.1|1115316_1116375_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_063495217.1|1116937_1117828_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495218.1|1118019_1118769_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_063495219.1|1120081_1121428_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063495220.1|1121694_1122537_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	28.8	1.8e-08
WP_063495221.1|1122533_1123535_+	transketolase family protein	NA	NA	NA	NA	NA
WP_063495222.1|1124323_1124536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495223.1|1124532_1124844_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_063495224.1|1125568_1126480_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_082854944.1|1126711_1126822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662104.1|1126841_1127027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495228.1|1128391_1128970_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_063495230.1|1130418_1131579_+	porin	NA	NA	NA	NA	NA
WP_082854945.1|1131728_1132019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495232.1|1132501_1133413_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_063495233.1|1133516_1134404_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495234.1|1134684_1135002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495235.1|1135581_1135809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082854948.1|1136291_1136741_+	MFS transporter	NA	NA	NA	NA	NA
WP_063495236.1|1136673_1137642_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.0	5.4e-118
WP_063495237.1|1137657_1138719_+	MFS transporter	NA	NA	NA	NA	NA
WP_063495238.1|1139309_1140665_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	45.9	3.3e-105
WP_158515240.1|1141826_1141994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495240.1|1142341_1143241_+	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	36.8	1.3e-12
WP_148662105.1|1143318_1143666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148662106.1|1143641_1143998_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
1145352:1145387	attL	ACACCAGTTATGCCGATTCCCGGATTATGCCGCGTC	NA	NA	NA	NA
WP_063495242.1|1145451_1146447_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D2W391	Mycobacterium_phage	25.5	3.0e-07
WP_063495243.1|1146443_1147391_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1148722:1148757	attR	GACGCGGCATAATCCGGGAATCGGCATAACTGGTGT	NA	NA	NA	NA
>prophage 4
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	1427821	1444086	4646070	transposase,tail	Bacillus_phage(50.0%)	14	NA	NA
WP_063497868.1|1427821_1428271_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_063495448.1|1428532_1429588_+|tail	phage tail sheath family protein	tail	A0A127AW39	Bacillus_phage	27.4	3.3e-12
WP_063495449.1|1429649_1431032_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	30.0	4.2e-23
WP_082854965.1|1431097_1432327_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_063495451.1|1432323_1432794_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_063495452.1|1432790_1432970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495453.1|1432966_1433665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495454.1|1433664_1435275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495455.1|1435319_1435742_+	GPW/gp25 family protein	NA	A0A193GZC5	Escherichia_phage	33.0	4.1e-06
WP_063495456.1|1435738_1436158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495457.1|1436276_1438997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495458.1|1438993_1441822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662110.1|1441900_1442578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662111.1|1442524_1444086_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	32.5	1.0e-09
>prophage 5
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	1545388	1669594	4646070	integrase,transposase	Pseudomonas_phage(16.67%)	95	1547918:1547933	1643849:1643866
WP_063495529.1|1545388_1546195_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063495530.1|1546350_1547781_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_063495531.1|1547789_1548230_+	TIR domain-containing protein	NA	NA	NA	NA	NA
1547918:1547933	attL	CGAGCGCAAGGGCGAC	NA	NA	NA	NA
WP_063495532.1|1548703_1550551_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1547918:1547933	attL	CGAGCGCAAGGGCGAC	NA	NA	NA	NA
WP_148662122.1|1551082_1551352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495535.1|1552007_1552286_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	60.7	2.8e-19
WP_063495147.1|1552486_1552693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495536.1|1552877_1553318_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_158515238.1|1553314_1553533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662098.1|1554236_1554659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495149.1|1556295_1557450_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495150.1|1558245_1559904_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	55.9	9.4e-171
WP_063495537.1|1560514_1561555_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
1560031:1560046	attR	CGAGCGCAAGGGCGAC	NA	NA	NA	NA
WP_063495538.1|1561740_1563237_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
1560031:1560046	attR	CGAGCGCAAGGGCGAC	NA	NA	NA	NA
WP_063495539.1|1563268_1564210_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	28.6	4.6e-29
WP_063495540.1|1564507_1566175_+	fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_162493825.1|1566259_1566478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495541.1|1566792_1567767_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063495542.1|1568605_1569508_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063495543.1|1569569_1570412_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_082854974.1|1570786_1571644_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_063495544.1|1571653_1572238_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.4	4.4e-22
WP_082855154.1|1572481_1573291_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_082854975.1|1573323_1574196_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_063495546.1|1574243_1575557_-	MFS transporter	NA	NA	NA	NA	NA
WP_063495547.1|1575613_1576861_-	CoA transferase	NA	NA	NA	NA	NA
WP_063495548.1|1576927_1577710_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_063497881.1|1577744_1578527_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158515246.1|1578649_1579888_-	CoA transferase	NA	NA	NA	NA	NA
WP_063497882.1|1580959_1581904_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495550.1|1582089_1583013_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_063495551.1|1583251_1584694_+	MFS transporter	NA	NA	NA	NA	NA
WP_063495552.1|1584872_1585946_+	porin	NA	NA	NA	NA	NA
WP_063495554.1|1586430_1589397_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_148662123.1|1589609_1590959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495556.1|1591075_1592518_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_082854977.1|1592846_1593038_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_158515247.1|1593055_1593199_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_063495558.1|1593346_1594315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158515248.1|1594523_1594820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515249.1|1594764_1595007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082854979.1|1595244_1595409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495560.1|1595477_1596737_-	MFS transporter	NA	NA	NA	NA	NA
WP_148662124.1|1598441_1599258_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148662125.1|1599354_1599576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495564.1|1599598_1599793_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_063495565.1|1599833_1600016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495566.1|1600350_1600611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515250.1|1601750_1602044_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063495567.1|1602058_1603600_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.6	2.9e-49
WP_063495568.1|1603937_1604210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495569.1|1604922_1605240_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063495570.1|1605357_1606488_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495571.1|1606774_1607362_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082854981.1|1607389_1607887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158515251.1|1609296_1609755_-|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	56.8	2.0e-38
WP_148662126.1|1610268_1610718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063497883.1|1611161_1613120_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.0	2.9e-33
WP_063495574.1|1616120_1616678_-	LysR family substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063495219.1|1616714_1618061_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063495575.1|1618123_1618522_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495576.1|1618623_1619559_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_063495577.1|1619555_1620836_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_063495578.1|1621374_1622445_+	FUSC family protein	NA	NA	NA	NA	NA
WP_181448408.1|1623145_1623547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082854984.1|1624825_1625767_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	64.9	1.4e-110
WP_148662226.1|1626927_1627827_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_063495581.1|1627872_1628676_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_063495582.1|1628730_1629948_+	CoA transferase	NA	NA	NA	NA	NA
WP_063495583.1|1629983_1630733_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_063495584.1|1630732_1631677_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_063495585.1|1631756_1633409_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_063495586.1|1633536_1635339_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_158515252.1|1635516_1636530_+	FUSC family protein	NA	NA	NA	NA	NA
WP_063497886.1|1637112_1637418_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_082854986.1|1638122_1639769_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_063495588.1|1641501_1642677_-	porin	NA	NA	NA	NA	NA
WP_063495589.1|1643273_1643582_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_063495590.1|1643848_1644325_-	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	33.5	5.7e-12
WP_082854987.1|1645099_1645405_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_181448418.1|1645648_1645957_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063495592.1|1646449_1646797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082854988.1|1646875_1647961_-	porin	NA	NA	NA	NA	NA
WP_063495593.1|1648115_1649771_-	fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_063495594.1|1650085_1652875_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_063495596.1|1653704_1655963_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_063495597.1|1656429_1657059_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063495598.1|1657055_1658702_-	response regulator	NA	W8CYM9	Bacillus_phage	36.8	8.0e-13
WP_063495599.1|1659188_1662140_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	37.3	9.0e-31
WP_063495600.1|1662383_1663193_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495601.1|1663544_1664360_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063495602.1|1664526_1664733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662128.1|1665647_1665896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515253.1|1666711_1668040_+	amino acid permease	NA	NA	NA	NA	NA
WP_063495606.1|1668208_1669594_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	1678938	1764067	4646070	integrase,transposase	Burkholderia_virus(25.0%)	60	1740570:1740586	1771625:1771641
WP_148662129.1|1678938_1680172_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	90.1	1.1e-147
WP_063495615.1|1681641_1682595_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.9	9.1e-118
WP_063495616.1|1683354_1683984_-	VOC family protein	NA	NA	NA	NA	NA
WP_063497892.1|1684119_1684482_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063495617.1|1684757_1685063_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_063495618.1|1685595_1686366_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063495620.1|1687169_1687481_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_148662130.1|1687594_1688386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063497893.1|1689365_1690394_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082854992.1|1691019_1691415_+	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_063495624.1|1692391_1693696_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_063495625.1|1693967_1694261_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_158515255.1|1694388_1694526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662131.1|1694744_1695728_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495628.1|1695878_1696823_+	AEC family transporter	NA	NA	NA	NA	NA
WP_063495629.1|1697360_1697618_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_063495630.1|1697633_1698692_+	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
WP_063495631.1|1698701_1700849_+	FUSC family protein	NA	NA	NA	NA	NA
WP_063495632.1|1700835_1702305_+	MdtP family multidrug efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_063495633.1|1702479_1703358_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063495634.1|1703371_1703572_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_063495635.1|1703833_1705429_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_063495636.1|1705847_1706846_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063495637.1|1707586_1707934_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_063495639.1|1708558_1708906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082854993.1|1709367_1710702_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	D2TEZ5	Emiliania_huxleyi_virus	30.3	3.3e-41
WP_063495640.1|1711593_1711893_+	DUF4406 domain-containing protein	NA	A0A1D8EU53	Propionibacterium_phage	41.2	2.8e-09
WP_063495641.1|1712303_1714499_+	FUSC family protein	NA	NA	NA	NA	NA
WP_148662133.1|1715494_1715923_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_063495643.1|1716064_1716613_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_063495644.1|1716824_1718339_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_063495645.1|1718463_1719405_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495646.1|1720512_1722492_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.1e-32
WP_082854994.1|1723031_1723475_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_063495647.1|1724033_1724483_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148662134.1|1724510_1725755_-	CoA transferase	NA	NA	NA	NA	NA
WP_063495648.1|1725754_1726942_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_063497897.1|1727072_1727984_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063495649.1|1728222_1729644_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_148662228.1|1729640_1730498_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_063495651.1|1730619_1730820_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_063495652.1|1730853_1732920_-	FUSC family protein	NA	NA	NA	NA	NA
WP_063495653.1|1733622_1734513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158515256.1|1734827_1741043_+	AAA family ATPase	NA	A0A1V0SGX0	Hokovirus	35.1	1.2e-45
1740570:1740586	attL	ATGCCGGAGATGGACGG	NA	NA	NA	NA
WP_063495655.1|1742235_1742682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495657.1|1743508_1743847_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	43.5	1.8e-07
WP_158515257.1|1743821_1744469_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	42.6	2.4e-29
WP_063495659.1|1744659_1745679_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495661.1|1745950_1746208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063495570.1|1747136_1748267_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495662.1|1748695_1749829_+	porin	NA	NA	NA	NA	NA
WP_082855156.1|1750380_1750473_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_063495664.1|1752300_1752555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855157.1|1754743_1755031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063495667.1|1755327_1756347_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495668.1|1756689_1756959_+	DUF1488 family protein	NA	NA	NA	NA	NA
WP_063495669.1|1757152_1758424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495670.1|1760382_1761327_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063495671.1|1761323_1762322_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063495672.1|1762366_1764067_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1771625:1771641	attR	ATGCCGGAGATGGACGG	NA	NA	NA	NA
>prophage 7
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	2221791	2270248	4646070	integrase,transposase,protease	Ralstonia_phage(25.0%)	41	2219264:2219278	2268572:2268586
2219264:2219278	attL	TGCGCGCTGCTGTTC	NA	NA	NA	NA
WP_063496006.1|2221791_2222343_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_082855163.1|2222606_2225012_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_063496007.1|2225091_2225409_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_063496008.1|2225439_2226156_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_082855025.1|2226152_2227427_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_063496009.1|2227423_2228506_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_063496010.1|2228524_2228854_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_063496011.1|2228853_2229939_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_063496012.1|2229991_2230834_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063496014.1|2231064_2231952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063496015.1|2232052_2233210_+	muconate cycloisomerase CatB2	NA	NA	NA	NA	NA
WP_063496016.1|2233257_2234166_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_063496017.1|2234282_2234573_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_063496018.1|2234917_2235412_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_063495615.1|2235954_2236908_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.9	9.1e-118
WP_063496019.1|2236939_2237383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496020.1|2237404_2239024_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_063496021.1|2239355_2240246_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063496022.1|2240365_2241595_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_063496023.1|2241737_2242541_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_181448412.1|2242633_2245585_-	Hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	27.1	1.9e-09
WP_063496024.1|2245581_2247432_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_063496025.1|2247428_2248028_-	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_063496027.1|2248862_2249084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496028.1|2249530_2250397_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_063496029.1|2250694_2252950_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_063496030.1|2253037_2253499_+	CHRD domain-containing protein	NA	A0A2K9L200	Tupanvirus	35.4	1.7e-05
WP_063496031.1|2253543_2254236_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_063496032.1|2254680_2255535_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_063496034.1|2255877_2256588_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_063496035.1|2256898_2257399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148662147.1|2257494_2258562_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_148662148.1|2258714_2259032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496038.1|2259301_2259811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496039.1|2259803_2262128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496040.1|2262124_2263657_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063496041.1|2263659_2264877_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063496042.1|2265562_2266084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063496043.1|2266322_2266739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855028.1|2267138_2268335_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	28.1	5.6e-08
WP_063496044.1|2268646_2270248_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
2268572:2268586	attR	TGCGCGCTGCTGTTC	NA	NA	NA	NA
>prophage 8
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	2276675	2322550	4646070	integrase,transposase	Stx2-converting_phage(20.0%)	45	2267259:2267274	2329223:2329238
2267259:2267274	attL	GCGGATCAGCCTGAGG	NA	NA	NA	NA
WP_063496049.1|2276675_2277758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_063496050.1|2277803_2278013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496051.1|2278123_2279089_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_063496052.1|2279123_2279633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496054.1|2279950_2280241_-	DUF2471 family protein	NA	NA	NA	NA	NA
WP_063496056.1|2280653_2281361_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063496057.1|2281958_2282291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496058.1|2283450_2284797_+	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	30.4	4.0e-10
WP_063497941.1|2285397_2286681_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	9.6e-30
WP_148662149.1|2287786_2288323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515268.1|2289862_2290120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662150.1|2290116_2290890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496061.1|2292030_2292825_+	metallophosphoesterase family protein	NA	K4K650	Caulobacter_phage	33.7	2.5e-36
WP_063496062.1|2292827_2293340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496063.1|2293525_2294017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496065.1|2295165_2295705_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_082855031.1|2296264_2296543_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_063496066.1|2296897_2298487_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	3.3e-149
WP_035936384.1|2298538_2298886_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.9	1.9e-33
WP_082855032.1|2298882_2299290_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_063496069.1|2299851_2300154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496070.1|2300603_2301629_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_181448413.1|2302294_2302453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496072.1|2302491_2302773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496073.1|2303298_2303943_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_082855164.1|2304066_2304483_-	response regulator	NA	NA	NA	NA	NA
WP_181448421.1|2304884_2306021_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_082855033.1|2306691_2307441_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.5	3.2e-09
WP_063496077.1|2307717_2308671_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.6	7.7e-117
WP_181448414.1|2308824_2308998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496078.1|2309142_2309439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496079.1|2310240_2310516_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	56.2	3.7e-16
WP_063496080.1|2310907_2312194_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_063496081.1|2312541_2313012_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_063496082.1|2313151_2313478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496083.1|2314979_2316044_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063496084.1|2316365_2316953_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
WP_063496085.1|2317304_2317697_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_063496086.1|2317786_2317963_-	CsbD family protein	NA	NA	NA	NA	NA
WP_082855034.1|2318087_2318243_-	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_063496087.1|2318772_2319492_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_063496088.1|2319943_2320258_+|transposase	IS3 family transposase	transposase	A0A0N7C1Z2	Escherichia_phage	52.6	2.1e-07
WP_082855035.1|2320254_2320761_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082855036.1|2320769_2322146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	7.1e-39
WP_063497944.1|2322244_2322550_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2329223:2329238	attR	GCGGATCAGCCTGAGG	NA	NA	NA	NA
>prophage 9
NZ_CP014578	Paraburkholderia phytofirmans OLGA172 chromosome 1, complete sequence	4646070	2336977	2396720	4646070	integrase,transposase	Staphylococcus_phage(33.33%)	51	2395340:2395376	2398703:2398739
WP_063496109.1|2336977_2338138_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.9e-41
WP_063496110.1|2339833_2340772_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_063496112.1|2343195_2343642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496113.1|2343863_2344052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496114.1|2344168_2344558_+	response regulator	NA	NA	NA	NA	NA
WP_082855039.1|2344739_2344961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181448363.1|2345047_2345191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063497941.1|2346672_2347956_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	9.6e-30
WP_063496115.1|2348896_2349361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496116.1|2349502_2349727_-	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_063497945.1|2350205_2350466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063497946.1|2350893_2351211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027778272.1|2351377_2351620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496117.1|2351822_2353421_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_063496119.1|2355689_2356433_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_181448364.1|2356530_2356689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496120.1|2356742_2357009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496122.1|2358151_2358853_+|transposase	IS6 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	38.1	1.0e-33
WP_063496123.1|2359059_2359326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496124.1|2359442_2360483_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	25.3	4.6e-14
WP_082855165.1|2360900_2362709_+	oleate hydratase	NA	NA	NA	NA	NA
WP_063496126.1|2362767_2363613_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_063496127.1|2363609_2365163_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_063496128.1|2365164_2365914_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_012427417.1|2365923_2366172_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_063496129.1|2366168_2366867_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_063496130.1|2366863_2367142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063496131.1|2367134_2367452_-	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_063496132.1|2367448_2367907_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_063496133.1|2367903_2369382_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_063496134.1|2369724_2370561_+	universal stress protein	NA	NA	NA	NA	NA
WP_063497948.1|2370895_2372998_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_063496135.1|2372994_2373642_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063496136.1|2373827_2374259_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063496137.1|2374251_2375034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148662234.1|2375145_2375442_+	cytochrome C	NA	NA	NA	NA	NA
WP_063496138.1|2375488_2375863_+	DUF3564 domain-containing protein	NA	NA	NA	NA	NA
WP_063496139.1|2376158_2378135_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.9	1.8e-75
WP_063496140.1|2378269_2378875_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_063496141.1|2378924_2379668_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_063497950.1|2379688_2380165_-	universal stress protein	NA	NA	NA	NA	NA
WP_063495601.1|2382568_2383384_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063496142.1|2383343_2385350_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	51.2	3.5e-188
WP_063496143.1|2385359_2385938_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	54.4	1.3e-39
WP_063496144.1|2386181_2387525_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_063496146.1|2387934_2388954_+	D-cysteine desulfhydrase family protein	NA	NA	NA	NA	NA
WP_082855040.1|2390549_2392043_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	4.2e-29
WP_063496149.1|2393103_2393373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496150.1|2393940_2394735_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148662155.1|2394736_2395339_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
2395340:2395376	attL	CGAGGGTTATGTGCCGGCCAAATATATGTCGCGGCGG	NA	NA	NA	NA
WP_082855043.1|2395754_2396720_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	24.8	5.0e-07
WP_082855043.1|2395754_2396720_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	24.8	5.0e-07
2398703:2398739	attR	CCGCCGCGACATATATTTGGCCGGCACATAACCCTCG	NA	NA	NA	NA
>prophage 1
NZ_CP014579	Paraburkholderia phytofirmans OLGA172 chromosome 2, complete sequence	3497621	99217	158705	3497621	integrase,transposase	Bacillus_phage(40.0%)	46	119436:119452	167223:167239
WP_063498201.1|99217_102016_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148662257.1|102029_103259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515296.1|103438_104737_+	TniQ family protein	NA	NA	NA	NA	NA
WP_063498204.1|105366_105771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063498205.1|106879_107626_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_082855198.1|107627_109016_+	TniQ family protein	NA	NA	NA	NA	NA
WP_148662259.1|109053_109374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063500588.1|109469_110255_+	metallophosphoesterase	NA	A0A076YQ07	Rhizobium_phage	33.2	3.7e-24
WP_063498208.1|110285_110636_+	hypothetical protein	NA	A0A2H4N839	Lake_Baikal_phage	36.1	8.2e-08
WP_063498211.1|111803_112604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498212.1|112750_113206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498214.1|114508_114940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498215.1|114945_115458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498216.1|115454_116900_+	caspase family protein	NA	NA	NA	NA	NA
WP_063498217.1|116885_117113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515297.1|117372_118905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498219.1|119079_119358_-	H-NS histone family protein	NA	NA	NA	NA	NA
119436:119452	attL	GGTGAGGACTTCCAGGA	NA	NA	NA	NA
WP_063498220.1|120043_121897_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	2.9e-11
WP_148662262.1|122192_124007_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_063498222.1|123996_124392_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_148662263.1|124743_125337_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_063500589.1|125435_126233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855481.1|126313_126694_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_063498224.1|126671_127694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498225.1|127699_128329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498226.1|128325_128898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063498227.1|128890_129727_-	bis-aminopropyl spermidine synthase family protein	NA	NA	NA	NA	NA
WP_063498228.1|130158_130722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148662264.1|131680_133207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498230.1|133307_134783_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_148662265.1|134794_135502_+	TIGR02594 family protein	NA	NA	NA	NA	NA
WP_063498232.1|135702_136389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063498233.1|137098_138856_-	S8/S53 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	29.1	5.4e-07
WP_148662266.1|139798_140809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498236.1|141627_142752_+	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_063498237.1|142800_146787_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_063498238.1|147017_149381_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_063498239.1|149670_150483_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_082855205.1|150649_150901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498240.1|150957_152598_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_063498241.1|152575_153310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063498243.1|153915_155157_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063498244.1|155153_156080_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855206.1|156076_156748_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	28.7	1.5e-10
WP_063498245.1|156748_157765_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063498246.1|157757_158705_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
167223:167239	attR	GGTGAGGACTTCCAGGA	NA	NA	NA	NA
>prophage 2
NZ_CP014579	Paraburkholderia phytofirmans OLGA172 chromosome 2, complete sequence	3497621	1483122	1511149	3497621	integrase,transposase	Staphylococcus_phage(33.33%)	27	1472833:1472848	1507233:1507248
1472833:1472848	attL	TCACGATCGTCACCTC	NA	NA	NA	NA
WP_063499158.1|1483122_1484496_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	3.1e-34
WP_148662307.1|1484497_1485172_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	1.7e-22
WP_063499159.1|1485108_1485405_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_063499160.1|1485714_1487352_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063500722.1|1487634_1488453_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082855330.1|1488649_1489126_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_082855331.1|1489167_1489563_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_063499161.1|1490096_1490861_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_063499162.1|1490920_1492297_+	MFS transporter	NA	NA	NA	NA	NA
WP_063499163.1|1492720_1493251_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063499164.1|1493865_1494714_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063500723.1|1494980_1495781_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	27.6	2.6e-09
WP_063499165.1|1496339_1496906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515332.1|1497059_1497878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082855501.1|1498513_1498828_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_063499167.1|1499202_1499397_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063499168.1|1499662_1499857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662308.1|1499880_1500138_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_063499170.1|1500560_1500998_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_063496041.1|1501399_1502617_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063496040.1|1502619_1504152_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063496039.1|1504148_1506473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063496038.1|1506465_1506975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662148.1|1507244_1507562_+	hypothetical protein	NA	NA	NA	NA	NA
1507233:1507248	attR	GAGGTGACGATCGTGA	NA	NA	NA	NA
WP_148662147.1|1507714_1508782_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_063496035.1|1508877_1509378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499171.1|1509748_1511149_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014579	Paraburkholderia phytofirmans OLGA172 chromosome 2, complete sequence	3497621	2047727	2290719	3497621	integrase,transposase,tRNA	Ralstonia_phage(12.5%)	190	2055188:2055202	2262656:2263851
WP_063494433.1|2047727_2048681_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.2	4.1e-118
WP_063499555.1|2049119_2049827_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148662333.1|2050171_2050450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499557.1|2051647_2052994_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	29.8	5.0e-29
WP_148662334.1|2053100_2053640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148662335.1|2054326_2055028_+	hypothetical protein	NA	NA	NA	NA	NA
2055188:2055202	attL	GCCCTTCTTCGCCTC	NA	NA	NA	NA
WP_063499560.1|2055259_2056912_+	hypothetical protein	NA	NA	NA	NA	NA
2055188:2055202	attL	GCCCTTCTTCGCCTC	NA	NA	NA	NA
WP_148662336.1|2057063_2057489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499562.1|2057737_2058349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499563.1|2058888_2059167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515345.1|2059266_2059422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499565.1|2060405_2060618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499566.1|2060857_2061349_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063499567.1|2061329_2061683_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.1	3.0e-18
WP_063499035.1|2063519_2064725_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_063499036.1|2064733_2065612_-|integrase	site-specific integrase	integrase	A0A2H4PCY2	Mycobacterium_phage	35.6	1.4e-16
WP_063495244.1|2065914_2067147_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063495243.1|2067143_2068091_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063495242.1|2068087_2069083_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D2W391	Mycobacterium_phage	25.5	3.0e-07
WP_063499568.1|2069680_2069941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499569.1|2070165_2071317_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063499570.1|2071783_2072590_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063499569.1|2073020_2074172_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063500786.1|2074679_2075138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515385.1|2075070_2075712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662337.1|2075908_2076355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662338.1|2076716_2077229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148662339.1|2077562_2077844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662340.1|2077983_2078262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499573.1|2078906_2079293_-	response regulator	NA	NA	NA	NA	NA
WP_063499574.1|2079459_2081547_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_158515346.1|2081747_2082698_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063499575.1|2082698_2083670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063499576.1|2084099_2085032_+	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_063499577.1|2085062_2085755_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_063499578.1|2085790_2087047_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063499579.1|2087233_2087884_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_063500789.1|2088019_2088973_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_063499580.1|2089189_2090323_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_148662341.1|2090362_2091700_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_063499582.1|2091692_2093471_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_063499583.1|2093546_2094242_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_063494433.1|2094647_2095601_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.2	4.1e-118
WP_063500790.1|2096115_2096937_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063500791.1|2096940_2097504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499584.1|2097662_2097878_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_063499585.1|2099044_2099920_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063499586.1|2100022_2100979_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	46.8	1.6e-05
WP_063499587.1|2101063_2101924_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_063499588.1|2102181_2102436_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063499589.1|2102529_2103681_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063499447.1|2104107_2104395_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_082855511.1|2104437_2105787_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.1	2.5e-28
WP_063499591.1|2106425_2106947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499592.1|2107598_2107961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499593.1|2107957_2109838_-	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	28.4	1.5e-34
WP_063499594.1|2109834_2111715_-	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	29.5	2.6e-23
WP_063500792.1|2111711_2113160_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063499595.1|2113107_2113398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855378.1|2114209_2114410_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499596.1|2115817_2116762_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499677.1|2116758_2117757_+|integrase	site-specific integrase	integrase	B8R670	Lactobacillus_phage	22.4	4.9e-05
WP_063499600.1|2118667_2119627_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499601.1|2119623_2120868_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	3.7e-10
WP_063499602.1|2121317_2122313_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D6X8B0	Bacillus_phage	22.5	4.0e-07
WP_063499603.1|2122305_2123247_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855379.1|2123243_2124023_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499605.1|2124044_2124803_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.4	4.6e-64
WP_082855380.1|2124812_2126345_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	4.2e-125
WP_063499607.1|2126485_2126977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499608.1|2126991_2128515_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.0	2.0e-58
WP_063500793.1|2128580_2128877_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.5	3.9e-11
WP_063499609.1|2128921_2129335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855381.1|2129474_2130062_+	maturase	NA	NA	NA	NA	NA
WP_063499610.1|2130209_2131457_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855382.1|2131453_2132392_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499612.1|2132384_2132942_+	porin	NA	NA	NA	NA	NA
WP_148662434.1|2133369_2134113_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_063495529.1|2134263_2135070_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2134882:2134896	attR	GAGGCGAAGAAGGGC	NA	NA	NA	NA
WP_082855383.1|2135238_2135625_-	BON domain-containing protein	NA	NA	NA	NA	NA
2134882:2134896	attR	GAGGCGAAGAAGGGC	NA	NA	NA	NA
WP_082855513.1|2135676_2136306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148662344.1|2136575_2142191_-	AAA family ATPase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	24.5	5.7e-10
WP_063499615.1|2142390_2145342_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158515348.1|2145468_2147934_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_063499617.1|2148805_2149480_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_148662346.1|2150439_2150922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499619.1|2151382_2151769_-	response regulator	NA	NA	NA	NA	NA
WP_082855384.1|2152099_2155162_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063499621.1|2155353_2156334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158515349.1|2156622_2156796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855514.1|2156810_2158205_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_082855385.1|2158211_2158385_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082855386.1|2158385_2159204_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_063500796.1|2159446_2160964_+	MFS transporter	NA	NA	NA	NA	NA
WP_063499623.1|2161028_2162150_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_082855387.1|2162398_2163658_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_063499624.1|2163588_2164572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499625.1|2165204_2165612_+	DoxX family protein	NA	NA	NA	NA	NA
WP_063499626.1|2166118_2167708_+	MFS transporter	NA	NA	NA	NA	NA
WP_063499627.1|2168024_2169308_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_063499628.1|2169304_2169817_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_063499629.1|2169813_2172078_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_063499630.1|2172186_2172438_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_063499631.1|2172542_2173184_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_063499632.1|2173363_2174863_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_181448438.1|2174902_2176783_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_063499634.1|2177027_2177717_-	hydrolase	NA	NA	NA	NA	NA
WP_063499635.1|2178039_2178972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063499636.1|2179091_2179745_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_063499637.1|2179840_2181055_+	MFS transporter	NA	NA	NA	NA	NA
WP_063499638.1|2181353_2181683_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_063499639.1|2181736_2182558_-	alpha/beta hydrolase	NA	A0A2R4AP45	Mycobacterium_phage	29.9	3.5e-17
WP_063499640.1|2182742_2183777_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158515350.1|2183918_2184809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148662347.1|2184867_2185338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515351.1|2185434_2187495_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063495238.1|2189098_2190454_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	45.9	3.3e-105
WP_158515352.1|2191970_2192276_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_148662129.1|2193326_2194560_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	90.1	1.1e-147
WP_158515353.1|2195022_2195199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499647.1|2195502_2196570_-	porin	NA	NA	NA	NA	NA
WP_063499648.1|2197057_2197684_-	cytochrome c4	NA	NA	NA	NA	NA
WP_063499649.1|2197794_2198946_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063495529.1|2199412_2200219_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063499650.1|2200649_2200928_-	YciI family protein	NA	NA	NA	NA	NA
WP_063499651.1|2201538_2202234_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_082855389.1|2202892_2204026_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_158515354.1|2204263_2204581_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_063499653.1|2204771_2206196_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_063500798.1|2206192_2207191_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063499654.1|2207823_2208342_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_063494433.1|2208724_2209680_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.2	4.1e-118
WP_063499655.1|2210622_2211537_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_063500800.1|2211648_2212623_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063499656.1|2215481_2217185_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	55.7	7.2e-174
WP_063499657.1|2217335_2218580_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499658.1|2218576_2219446_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855391.1|2219366_2219948_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148662349.1|2220446_2221946_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.2	3.9e-147
WP_063500802.1|2222020_2223121_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063499659.1|2223822_2225334_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_063499660.1|2225662_2227711_+	FUSC family protein	NA	NA	NA	NA	NA
WP_063499661.1|2228137_2228449_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_181448439.1|2228750_2228894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499662.1|2229286_2231200_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	34.8	9.3e-21
WP_181448440.1|2231196_2232627_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_063499664.1|2232643_2233642_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_063499665.1|2233760_2234435_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_063499666.1|2234421_2235354_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_082855515.1|2235363_2238432_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_063500804.1|2238688_2239753_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_063499669.1|2240770_2241013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499670.1|2241009_2242104_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_063499671.1|2242596_2243706_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063499672.1|2243793_2244825_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_148662350.1|2244911_2245745_-	porin	NA	NA	NA	NA	NA
WP_063500805.1|2245772_2246678_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063499674.1|2247025_2248138_+	alkene reductase	NA	NA	NA	NA	NA
WP_063499675.1|2248313_2249384_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	2.2e-40
WP_063499676.1|2249529_2249730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499677.1|2249896_2250895_-|integrase	site-specific integrase	integrase	B8R670	Lactobacillus_phage	22.4	4.9e-05
WP_063499596.1|2250891_2251836_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063500806.1|2251832_2253071_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_082855392.1|2253123_2254002_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499678.1|2253994_2254969_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499679.1|2254965_2255925_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.0	2.8e-10
WP_063499680.1|2256456_2257662_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_063499681.1|2257670_2258549_-|integrase	site-specific integrase	integrase	A0A0B5GXV1	Mycobacterium_phage	27.4	2.0e-10
WP_063499682.1|2258836_2259583_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063499683.1|2259936_2260422_+	VOC family protein	NA	NA	NA	NA	NA
WP_181448441.1|2260424_2261645_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_063499685.1|2261724_2262087_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_063499686.1|2262083_2262347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063494433.1|2262810_2263766_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.2	4.1e-118
WP_063499687.1|2266480_2267656_-	porin	NA	NA	NA	NA	NA
WP_063499688.1|2268070_2269177_-	alkene reductase	NA	NA	NA	NA	NA
WP_063499689.1|2269404_2270346_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_063499691.1|2270740_2271679_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158515355.1|2272686_2272857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148662351.1|2273405_2276474_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_063499695.1|2276691_2277615_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_063499696.1|2277601_2278261_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_158515356.1|2278382_2278880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499698.1|2279246_2279684_+	MFS transporter	NA	NA	NA	NA	NA
WP_063499699.1|2279694_2281524_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148662354.1|2282370_2283312_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_063499700.1|2283411_2284638_-	porin	NA	NA	NA	NA	NA
WP_063499701.1|2286349_2288428_+	recombinase family protein	NA	A0A2K9V3K8	Faecalibacterium_phage	23.9	1.7e-07
WP_063499702.1|2289838_2290192_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.4	3.9e-18
WP_063499703.1|2290167_2290719_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP014579	Paraburkholderia phytofirmans OLGA172 chromosome 2, complete sequence	3497621	2313213	2354955	3497621	protease,transposase,integrase	Mycobacterium_phage(40.0%)	32	2330767:2330781	2358880:2358894
WP_063499720.1|2313213_2315955_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	34.4	6.9e-126
WP_063499721.1|2316895_2317213_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_063499722.1|2317438_2317882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063499723.1|2317947_2318373_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_063499724.1|2320086_2320737_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_063499725.1|2320841_2321738_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082855397.1|2321797_2323312_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_148662129.1|2323372_2324607_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	90.1	1.1e-147
WP_063500809.1|2326331_2327471_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_063499727.1|2327639_2328776_-	alkene reductase	NA	NA	NA	NA	NA
WP_063499729.1|2330059_2331202_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
2330767:2330781	attL	CACCGACAATCTTGG	NA	NA	NA	NA
WP_063499730.1|2331430_2331916_+	VOC family protein	NA	NA	NA	NA	NA
WP_063499731.1|2331918_2333145_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_063499732.1|2333220_2333583_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_063499733.1|2333579_2335214_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_063499734.1|2335253_2336255_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_063499735.1|2336308_2337697_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_082855518.1|2338042_2339425_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_082855519.1|2339622_2341353_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_063499738.1|2341383_2341704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063499739.1|2341779_2343330_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	53.9	4.0e-155
WP_148662357.1|2344105_2344882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855044.1|2345667_2346522_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063496154.1|2346530_2347526_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063496153.1|2347518_2348457_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855043.1|2348453_2349419_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	24.8	5.0e-07
WP_148662155.1|2349834_2350437_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_063496150.1|2350438_2351233_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148662358.1|2351592_2352081_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499741.1|2352074_2352983_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063499742.1|2352979_2354002_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	31.4	3.5e-06
WP_158515358.1|2354556_2354955_+|transposase	transposase	transposase	NA	NA	NA	NA
2358880:2358894	attR	CACCGACAATCTTGG	NA	NA	NA	NA
>prophage 1
NZ_CP014580	Paraburkholderia phytofirmans OLGA172 plasmid pOLGA1, complete sequence	271008	9113	67153	271008	transposase,protease,integrase	Leptospira_phage(23.08%)	45	54506:54521	74253:74268
WP_063500925.1|9113_10715_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	33.6	2.0e-37
WP_063500926.1|10711_12109_-	ubiquinone biosynthesis protein UbiB	NA	E5EQ95	Micromonas_sp._RCC1109_virus	28.7	1.8e-37
WP_082855537.1|12090_13620_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_181448483.1|13616_13994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855538.1|13932_14343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082855539.1|14745_15765_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_063500927.1|15890_16127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158515386.1|16366_16528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500928.1|16718_18461_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_063495219.1|18999_20346_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063500454.1|20865_22446_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	31.7	1.2e-34
WP_063494893.1|22477_22831_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.2e-16
WP_063494892.1|22812_23322_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063500931.1|24922_25456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082855541.1|26930_28832_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.8	2.8e-102
WP_063500932.1|29194_29815_+	LemA family protein	NA	NA	NA	NA	NA
WP_082855542.1|30673_31171_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_181448481.1|31340_31511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158515387.1|31576_31732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063495219.1|31742_33089_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063500933.1|33042_34575_-	NAD(P)/FAD-dependent oxidoreductase	NA	G8DGZ2	Emiliania_huxleyi_virus	25.8	3.1e-19
WP_063501104.1|34841_36575_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_063500934.1|36585_37905_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.3	2.5e-33
WP_063500935.1|37908_38598_+	VIT family protein	NA	NA	NA	NA	NA
WP_063501105.1|38833_39319_+	universal stress protein	NA	NA	NA	NA	NA
WP_063500936.1|39464_40115_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_063500937.1|40317_41250_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_063500938.1|41290_43696_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	1.1e-167
WP_063501106.1|43863_44331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500939.1|44636_45653_-	transporter	NA	NA	NA	NA	NA
WP_063500940.1|45653_45887_-	ChaB family protein	NA	NA	NA	NA	NA
WP_063500941.1|46379_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063501107.1|47484_48075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500942.1|49352_49682_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_063500943.1|49816_50140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500944.1|50222_50942_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	4.5e-45
WP_063500945.1|53718_54897_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
54506:54521	attL	AATGCCTGATGCTGGC	NA	NA	NA	NA
WP_035486548.1|55078_56023_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_063500947.1|59959_60955_-|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.3	3.6e-08
WP_063500948.1|60947_61889_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082855566.1|61885_62851_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	25.5	5.6e-06
WP_063500950.1|64057_64876_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.1	7.0e-26
WP_082855543.1|64935_65262_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063500951.1|65258_66167_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063500952.1|66163_67153_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	30.0	5.3e-12
74253:74268	attR	GCCAGCATCAGGCATT	NA	NA	NA	NA
>prophage 2
NZ_CP014580	Paraburkholderia phytofirmans OLGA172 plasmid pOLGA1, complete sequence	271008	75762	131860	271008	transposase,integrase	uncultured_Caudovirales_phage(30.0%)	60	129840:129864	133206:133230
WP_046564501.1|75762_76938_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	28.9	6.8e-06
WP_052719587.1|77303_77849_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	50.3	4.6e-42
WP_046564505.1|78035_78368_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046564507.1|78364_78805_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_046564509.1|78832_79354_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.5	3.1e-27
WP_063500959.1|79340_80426_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_063500960.1|80422_80845_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.8	2.5e-51
WP_063500961.1|80844_81609_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.9	2.6e-91
WP_046564520.1|81577_82843_+	MFS transporter	NA	NA	NA	NA	NA
WP_046564522.1|82853_83333_+	GNAT family N-acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	33.1	4.3e-07
WP_046564524.1|83713_84664_+	universal stress protein	NA	NA	NA	NA	NA
WP_082855545.1|84739_86113_-	sensor histidine kinase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_007182765.1|86109_86772_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	1.1e-24
WP_007182766.1|86978_87257_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_063500963.1|87253_87805_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_082094190.1|88093_88336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063500964.1|88455_88785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500965.1|89313_90336_+	universal stress protein	NA	NA	NA	NA	NA
WP_063500966.1|90451_91345_+	universal stress protein	NA	NA	NA	NA	NA
WP_082094238.1|91419_92040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063501109.1|92075_94586_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	28.9	9.2e-69
WP_063500967.1|94630_95104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046564543.1|95368_95845_+	CreA family protein	NA	NA	NA	NA	NA
WP_148662447.1|95881_96373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052719530.1|96867_97293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046564545.1|97311_98181_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_063500970.1|98352_99336_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_063500971.1|99484_101233_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.6	1.7e-16
WP_046564547.1|101622_101988_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_046564548.1|102001_103756_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_063500972.1|103792_104653_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046564553.1|104739_105057_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046564555.1|105069_105504_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_046564556.1|105505_105937_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_063500973.1|105967_106219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082855546.1|106221_106812_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063500974.1|106946_108464_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.3	1.6e-39
WP_063496044.1|108973_110575_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	33.6	2.7e-37
WP_063496045.1|110672_111023_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_063496046.1|111003_111498_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	30.0	1.1e-05
WP_082855547.1|111759_112242_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063500975.1|112238_112739_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063500976.1|112842_114150_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.9	1.5e-30
WP_181448482.1|114661_114979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063500977.1|115032_115380_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_046565394.1|115482_115977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063501110.1|116494_117067_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_063500978.1|117325_117853_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_046564565.1|117912_119121_+	MFS transporter	NA	NA	NA	NA	NA
WP_063500979.1|119117_119879_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_148662457.1|119943_120612_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	2.8e-41
WP_063501111.1|121229_123125_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.2	3.5e-28
WP_063500981.1|123443_124469_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	2.7e-35
WP_148662457.1|125510_126179_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	2.8e-41
WP_063500983.1|126668_127388_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.5	1.6e-45
WP_063500984.1|127381_127561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500986.1|128023_128242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063500987.1|128238_129006_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.4	6.5e-34
129840:129864	attL	GAGTATGGTGTGGTAAAAAAAATGT	NA	NA	NA	NA
WP_063500947.1|129930_130926_-|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.3	3.6e-08
WP_063500948.1|130918_131860_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
133206:133230	attR	ACATTTTTTTTACCACACCATACTC	NA	NA	NA	NA
