The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	11968	48985	4132586	integrase,transposase	Pseudomonas_phage(20.0%)	38	3542:3559	45623:45640
3542:3559	attL	GATTGTGTTGAAAAACTC	NA	NA	NA	NA
WP_042464324.1|11968_12787_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063490860.1|13007_13214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734681.1|13216_13366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456283.1|13513_14119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456285.1|14291_14720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456288.1|14716_14908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072071626.1|15028_15229_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072071731.1|15264_16188_-	Abi family protein	NA	NA	NA	NA	NA
WP_072071627.1|16616_17573_-	hypothetical protein	NA	A0A1B0YZU0	Pseudomonas_phage	37.3	8.4e-39
WP_072071628.1|17503_18100_-	hypothetical protein	NA	I7GSL3	Xanthomonas_virus	41.3	1.4e-07
WP_042456291.1|18200_18551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456294.1|18805_19855_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	33.7	3.9e-29
WP_155734682.1|19832_20009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456297.1|20551_22549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456300.1|22551_23466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052677873.1|23560_24973_+	hypothetical protein	NA	G8DGC0	Emiliania_huxleyi_virus	58.9	1.4e-146
WP_052677874.1|25605_25908_+	hypothetical protein	NA	A0A291AUP9	Sinorhizobium_phage	56.3	3.8e-22
WP_042456306.1|26257_27277_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155734683.1|28656_29472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071726.1|29723_30611_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_042465387.1|31391_31835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|32018_33038_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042456309.1|33738_34173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456312.1|34244_34676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456316.1|34756_35779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456319.1|35783_36965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734684.1|37469_38084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|38438_39458_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042459733.1|40198_40999_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042456322.1|41476_41839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168161798.1|42045_42369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155735146.1|42601_43930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456325.1|44461_45481_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155734686.1|46218_46365_+	hypothetical protein	NA	NA	NA	NA	NA
45623:45640	attR	GATTGTGTTGAAAAACTC	NA	NA	NA	NA
WP_042456331.1|46446_47883_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_052677875.1|47960_48431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168161794.1|48627_48768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071630.1|48721_48985_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	173286	180688	4132586	integrase	Rhodobacter_phage(28.57%)	16	165752:165771	180354:180373
165752:165771	attL	GGCGCGGGCGGCCAGCGCCG	NA	NA	NA	NA
WP_042456610.1|173286_174387_-|integrase	tyrosine-type recombinase/integrase	integrase	G8DH71	Emiliania_huxleyi_virus	27.7	7.0e-13
WP_042456614.1|174576_175134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734873.1|175130_175844_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.2	3.9e-81
WP_042456620.1|175840_176101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456623.1|176097_176325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734691.1|176324_176477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456625.1|176534_176807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456628.1|177032_177305_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	61.4	9.1e-23
WP_042464351.1|177264_177507_+	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	50.0	2.4e-06
WP_155735147.1|177532_178216_-	phage repressor protein	NA	NA	NA	NA	NA
WP_042456633.1|178261_178477_+	hypothetical protein	NA	I3UM51	Rhodobacter_phage	69.4	5.9e-17
WP_042456636.1|178542_178824_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	58.9	7.0e-26
WP_155734692.1|178820_178961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456639.1|178957_179236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456642.1|179228_179549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081251720.1|179554_180688_+	hypothetical protein	NA	I3UM61	Rhodobacter_phage	52.1	1.2e-89
180354:180373	attR	CGGCGCTGGCCGCCCGCGCC	NA	NA	NA	NA
>prophage 3
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	188446	198558	4132586	integrase	Burkholderia_phage(22.22%)	17	193342:193358	200467:200483
WP_042456669.1|188446_189673_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	56.9	1.6e-122
WP_072071632.1|189665_190142_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	55.0	2.8e-43
WP_042456672.1|190138_191509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456675.1|192001_192238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456677.1|192234_192474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052677880.1|192461_193286_+	ERF family protein	NA	B5WZW4	Pseudomonas_phage	40.3	1.2e-30
193342:193358	attL	CGCGCCGTGATCGGCGG	NA	NA	NA	NA
WP_081252013.1|193482_194022_+	hypothetical protein	NA	A0A088F866	Sulfitobacter_phage	63.7	6.2e-23
WP_155734693.1|194021_194198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456682.1|194194_194380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081252014.1|194379_194769_+	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	32.5	2.4e-08
WP_052677882.1|194765_195122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456685.1|195118_195439_+	hypothetical protein	NA	A0A1P8D5Q7	Corynebacterium_phage	29.3	4.5e-05
WP_042456688.1|195431_196232_+	DUF2303 family protein	NA	A0A0A8IL76	Aurantimonas_phage	25.1	5.1e-13
WP_042456691.1|196353_197055_+	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.7	1.6e-79
WP_042456694.1|197054_197288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456697.1|197287_197479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456700.1|197448_198558_+|integrase	tyrosine-type recombinase/integrase	integrase	H6WBN7	Rhodobacter_phage	54.1	1.7e-91
200467:200483	attR	CCGCCGATCACGGCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	1004060	1010295	4132586	integrase	Rhodobacter_phage(50.0%)	9	997489:997507	1010322:1010340
997489:997507	attL	GTGGTGACCCCGGCAGGAC	NA	NA	NA	NA
WP_042464563.1|1004060_1004867_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	60.2	1.7e-85
WP_042456270.1|1005026_1005368_-	bacteriophage spanin2 family protein	NA	NA	NA	NA	NA
WP_045291834.1|1005364_1005877_-	glycoside hydrolase family protein	NA	A0A0K1Y6F2	Rhodobacter_phage	59.7	4.8e-17
WP_042458581.1|1005996_1006380_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	41.6	1.6e-17
WP_042458584.1|1006918_1007506_-	SocA family protein	NA	NA	NA	NA	NA
WP_042458587.1|1007693_1008353_-	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	37.4	3.4e-23
WP_052677927.1|1008349_1008874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060833355.1|1008985_1009219_+	hypothetical protein	NA	I3UM25	Rhodobacter_phage	49.3	4.9e-09
WP_168161813.1|1009479_1010295_+|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	45.9	1.6e-51
1010322:1010340	attR	GTGGTGACCCCGGCAGGAC	NA	NA	NA	NA
>prophage 5
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	1927030	1939988	4132586	capsid,tail,head,protease,portal	Roseobacter_phage(33.33%)	16	NA	NA
WP_042460578.1|1927030_1928206_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.2	3.9e-62
WP_042460581.1|1928208_1928451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042460584.1|1928471_1929038_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	46.3	7.0e-33
WP_042460587.1|1929081_1930269_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.9	8.0e-63
WP_042460589.1|1930431_1931031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042460592.1|1931027_1931369_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_042460594.1|1931365_1931776_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_042460596.1|1931799_1932213_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_042460599.1|1932215_1932548_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_042460602.1|1932537_1932732_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_042460605.1|1932735_1933404_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	32.7	1.2e-07
WP_042460609.1|1933419_1934052_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.0	2.8e-59
WP_042460612.1|1934051_1934939_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.8	1.7e-57
WP_042460614.1|1934935_1935379_+	peptidase	NA	F4YXU4	Roseobacter_phage	45.8	1.1e-30
WP_042460617.1|1935382_1939282_+	phage host specificity protein	NA	F4YXU5	Roseobacter_phage	37.4	4.4e-227
WP_042460620.1|1939274_1939988_+	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	35.4	1.3e-31
>prophage 6
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	2468700	2476113	4132586		Rhodobacter_phage(16.67%)	11	NA	NA
WP_042461669.1|2468700_2469210_-	lysozyme	NA	A0A0K1Y6F2	Rhodobacter_phage	53.3	4.8e-33
WP_042461671.1|2469214_2469427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461673.1|2469451_2469739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042462587.1|2469773_2470583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063490916.1|2470590_2473230_-	hypothetical protein	NA	A0A2L0V157	Salmonella_phage	25.6	3.6e-31
WP_042461678.1|2473214_2473622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461680.1|2473618_2474143_-	hypothetical protein	NA	A0A2P1CL89	Pantoea_phage	26.8	5.1e-06
WP_042464994.1|2474239_2474422_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	47.4	5.9e-10
WP_042461682.1|2474438_2474831_+	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	35.2	1.1e-08
WP_063490917.1|2474839_2475430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052678017.1|2475429_2476113_-	hypothetical protein	NA	G8DH54	Emiliania_huxleyi_virus	49.4	2.6e-10
>prophage 7
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	2497258	2504733	4132586	capsid,tail,terminase,head,protease,portal	Paracoccus_phage(28.57%)	10	NA	NA
WP_042461714.1|2497258_2497720_-	hypothetical protein	NA	A0A0U2C0P4	Paracoccus_phage	41.5	7.0e-15
WP_042461715.1|2497716_2498058_-|head,tail	head-tail adaptor protein	head,tail	A0A0U2BXJ0	Paracoccus_phage	45.6	1.1e-14
WP_042461716.1|2498057_2498351_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_042461717.1|2498347_2498560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465014.1|2498629_2499937_-|capsid	phage major capsid protein	capsid	C4ML06	Xanthomonas_virus	39.5	5.5e-65
WP_042461719.1|2499996_2500845_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	54.2	1.1e-69
WP_042461721.1|2500841_2502077_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	40.7	8.0e-66
WP_042461723.1|2502073_2503807_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	43.1	5.5e-121
WP_042461724.1|2503803_2504274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461726.1|2504364_2504733_-	endonuclease	NA	M4QRD8	Tetraselmis_viridis_virus	44.4	1.7e-08
>prophage 8
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	3864625	3943300	4132586	transposase	Leptospira_phage(20.0%)	49	NA	NA
WP_155734842.1|3864625_3866308_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	34.8	3.4e-19
WP_155734903.1|3866500_3866728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491328.1|3867200_3869651_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	35.6	1.4e-69
WP_063491330.1|3869644_3870883_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_063491331.1|3870927_3873996_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	6.9e-58
WP_063490947.1|3873982_3874723_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_155734843.1|3874982_3876141_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.6	2.3e-46
WP_042463990.1|3876223_3877312_-	AAA family ATPase	NA	A0A1V0CP82	Kaumoebavirus	24.0	1.3e-06
WP_155734904.1|3877313_3877622_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_042463994.1|3877684_3878089_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_042465375.1|3879165_3880719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.2e-12
WP_052678109.1|3880712_3881522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042463997.1|3881525_3882527_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155734844.1|3882523_3884044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081257628.1|3884175_3885030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042464001.1|3885217_3887140_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042464003.1|3887177_3887888_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168161853.1|3887802_3888300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168161839.1|3888843_3890475_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_081257630.1|3890474_3892640_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	24.6	7.6e-11
WP_042464008.1|3892639_3893965_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155734845.1|3894409_3897424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464015.1|3897436_3898639_+	SpoIIE family protein phosphatase	NA	W8CYM9	Bacillus_phage	40.5	7.7e-13
WP_042464017.1|3898635_3898971_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_162107041.1|3898983_3899379_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_052678111.1|3899491_3903148_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.3	6.1e-53
WP_042464023.1|3903603_3903870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042464029.1|3905342_3906170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464032.1|3906166_3906715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464035.1|3906738_3907677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155735157.1|3907669_3908104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464038.1|3908129_3908798_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_042464039.1|3908794_3909205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464040.1|3909201_3909993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465382.1|3910006_3910303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052678114.1|3910744_3913048_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	3.6e-43
WP_155734847.1|3913812_3915780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464045.1|3915752_3917378_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042464047.1|3917385_3917685_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_042464050.1|3917702_3930656_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_168161840.1|3930719_3931811_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_042464054.1|3931800_3932724_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042464057.1|3932723_3934208_-	TolC family protein	NA	NA	NA	NA	NA
WP_042458151.1|3934657_3934960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|3936461_3937481_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155734683.1|3938918_3939734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071726.1|3939985_3940873_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_042465387.1|3941653_3942097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|3942280_3943300_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015418	Rhodovulum sulfidophilum DSM 1374 chromosome, complete genome	4132586	4079001	4098225	4132586	capsid,terminase,integrase,holin,portal	Ruegeria_phage(15.38%)	28	4069981:4069998	4089517:4089534
4069981:4069998	attL	TCGCGGTCGAGGCGCTGG	NA	NA	NA	NA
WP_042464264.1|4079001_4079754_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_042464266.1|4079770_4080439_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	34.2	5.7e-10
WP_042464268.1|4080514_4080961_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464270.1|4081292_4081649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464273.1|4082124_4083174_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	34.1	1.3e-29
WP_155734682.1|4083151_4083328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464275.1|4083429_4083951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464276.1|4083943_4084378_-	hypothetical protein	NA	W6MW33	Pseudomonas_phage	49.0	1.6e-13
WP_042464278.1|4084377_4085091_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.7	1.2e-82
WP_042465411.1|4085087_4085918_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.2	1.1e-71
WP_042464280.1|4085929_4086157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734691.1|4086156_4086309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464281.1|4086366_4086648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464283.1|4086870_4087506_-	phage repressor protein	NA	NA	NA	NA	NA
WP_042456636.1|4087871_4088153_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	58.9	7.0e-26
WP_155734865.1|4088149_4088290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052678121.1|4088286_4088568_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	39.8	5.5e-07
WP_042462574.1|4088567_4089110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042462576.1|4089146_4089764_+	hypothetical protein	NA	NA	NA	NA	NA
4089517:4089534	attR	TCGCGGTCGAGGCGCTGG	NA	NA	NA	NA
WP_063491335.1|4090022_4090595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042461730.1|4090591_4091239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464288.1|4091235_4091895_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	35.0	2.4e-24
WP_042464290.1|4091994_4092378_+	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	41.6	1.6e-17
WP_042464292.1|4092509_4092947_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_042464294.1|4092933_4094595_+|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	34.8	6.7e-84
WP_081257631.1|4094591_4095905_+|portal	phage portal protein	portal	H9YSG7	environmental_Halophage	27.8	1.8e-23
WP_042464296.1|4095904_4096822_+	peptidase S49	NA	A0A0K2FI53	Enterobacteria_phage	38.2	7.1e-11
WP_042464297.1|4096902_4098225_+|capsid	phage major capsid protein	capsid	Q7Y410	Yersinia_phage	38.9	3.5e-51
>prophage 1
NZ_CP015419	Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence	113163	1090	9631	113163		Ochrobactrum_phage(33.33%)	6	NA	NA
WP_081252070.1|1090_2428_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	32.7	6.7e-10
WP_042465500.1|2605_3547_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	33.8	4.0e-41
WP_042465503.1|3548_4727_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	61.2	2.0e-135
WP_052678173.1|5111_6968_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	6.0e-33
WP_042465506.1|6964_8773_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	1.1e-31
WP_081252071.1|8773_9631_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	6.6e-19
>prophage 1
NZ_CP015420	Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence	102180	0	39299	102180		Staphylococcus_phage(40.0%)	32	NA	NA
WP_168161855.1|999_2253_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_042465782.1|2252_3995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465785.1|3981_5013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491339.1|5054_6080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465791.1|6646_8176_-	tricarboxylate transporter	NA	NA	NA	NA	NA
WP_042465794.1|8177_8666_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_052678185.1|8790_9774_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_168161856.1|9909_11631_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_042465799.1|11890_12577_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465801.1|12564_13485_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465804.1|13823_15029_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_052678175.1|15025_15694_+	RraA family protein	NA	NA	NA	NA	NA
WP_042465807.1|15741_16689_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_052678176.1|16707_17160_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_042465928.1|17167_18667_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
WP_042465810.1|18739_19654_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465812.1|19727_22541_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_042465814.1|22568_23258_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465817.1|23437_24433_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_042465819.1|24538_25738_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042465822.1|25956_26841_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_081257635.1|26851_28684_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	8.1e-14
WP_042465827.1|28670_29375_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	6.1e-10
WP_042465932.1|29377_30178_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_042465830.1|30186_30996_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_042465832.1|31007_32621_+	FAD-binding protein	NA	A0A1V0SI18	Klosneuvirus	30.4	1.1e-51
WP_042465935.1|32648_34079_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042465833.1|34218_34629_-	GFA family protein	NA	NA	NA	NA	NA
WP_042465835.1|34625_35330_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465837.1|35555_36332_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	1.8e-15
WP_042465838.1|36342_37083_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042465840.1|37106_39299_+	alpha-ketoacid dehydrogenase subunit alpha/beta	NA	E3SJ83	Synechococcus_phage	29.4	1.4e-12
>prophage 2
NZ_CP015420	Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence	102180	49512	56818	102180		Escherichia_phage(50.0%)	4	NA	NA
WP_042465859.1|49512_51972_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	6.5e-75
WP_042465861.1|51983_52634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465862.1|52630_54256_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_052678179.1|54451_56818_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	3.4e-12
>prophage 3
NZ_CP015420	Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence	102180	61192	65760	102180		Brevibacillus_phage(50.0%)	3	NA	NA
WP_042465875.1|61192_62596_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	28.0	1.0e-08
WP_042465877.1|62597_63692_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042465879.1|63816_65760_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	2.6e-47
>prophage 4
NZ_CP015420	Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence	102180	75296	80813	102180		Enterobacteria_phage(50.0%)	3	NA	NA
WP_042465894.1|75296_78035_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.9	1.2e-85
WP_042465896.1|78031_79066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052678182.1|79076_80813_-	hypothetical protein	NA	A0A0K2QJE7	Achromobacter_phage	42.1	7.2e-20
