The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	11968	43222	4082971	integrase,transposase	Pseudomonas_phage(20.0%)	31	3542:3559	39860:39877
3542:3559	attL	GATTGTGTTGAAAAACTC	NA	NA	NA	NA
WP_042464324.1|11968_12787_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_063490860.1|13007_13214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734681.1|13216_13366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456283.1|13513_14119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456285.1|14291_14720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456288.1|14716_14908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072071626.1|15028_15229_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072071731.1|15264_16188_-	Abi family protein	NA	NA	NA	NA	NA
WP_052677871.1|16616_17726_-	hypothetical protein	NA	A0A1B0YZU0	Pseudomonas_phage	37.3	9.8e-39
WP_072071628.1|17503_18100_-	hypothetical protein	NA	I7GSL3	Xanthomonas_virus	41.3	1.4e-07
WP_042456291.1|18200_18551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456294.1|18805_19855_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	33.7	3.9e-29
WP_155734682.1|19832_20009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456297.1|20551_22549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456300.1|22551_23466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081251712.1|23464_24973_+	hypothetical protein	NA	G8DGC0	Emiliania_huxleyi_virus	58.9	1.5e-146
WP_052677874.1|25605_25908_+	hypothetical protein	NA	A0A291AUP9	Sinorhizobium_phage	56.3	3.8e-22
WP_042456306.1|26257_27277_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042456309.1|27977_28412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456312.1|28483_28915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063490861.1|28995_30018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456319.1|30022_31204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734684.1|31708_32323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|32677_33697_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042456322.1|35713_36076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155735146.1|36838_38167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456325.1|38698_39718_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155734686.1|40455_40602_+	hypothetical protein	NA	NA	NA	NA	NA
39860:39877	attR	GATTGTGTTGAAAAACTC	NA	NA	NA	NA
WP_042456331.1|40683_42120_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_052677875.1|42197_42668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071630.1|42958_43222_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	167523	174925	4082971	integrase	Rhodobacter_phage(37.5%)	16	159989:160008	174591:174610
159989:160008	attL	GGCGCGGGCGGCCAGCGCCG	NA	NA	NA	NA
WP_042456610.1|167523_168624_-|integrase	tyrosine-type recombinase/integrase	integrase	G8DH71	Emiliania_huxleyi_virus	27.7	7.0e-13
WP_072071631.1|168593_168827_-	helix-turn-helix domain-containing protein	NA	I3UM25	Rhodobacter_phage	74.2	9.9e-18
WP_042456614.1|168813_169371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734873.1|169367_170081_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.2	3.9e-81
WP_042456623.1|170334_170562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734691.1|170561_170714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456625.1|170771_171044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456628.1|171269_171542_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	61.4	9.1e-23
WP_042464351.1|171501_171744_+	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	50.0	2.4e-06
WP_155735147.1|171769_172453_-	phage repressor protein	NA	NA	NA	NA	NA
WP_042456633.1|172498_172714_+	hypothetical protein	NA	I3UM51	Rhodobacter_phage	69.4	5.9e-17
WP_042456636.1|172779_173061_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	58.9	7.0e-26
WP_155734692.1|173057_173198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456639.1|173194_173473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456642.1|173465_173786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081251720.1|173791_174925_+	hypothetical protein	NA	I3UM61	Rhodobacter_phage	52.1	1.2e-89
174591:174610	attR	CGGCGCTGGCCGCCCGCGCC	NA	NA	NA	NA
>prophage 3
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	182683	192795	4082971	integrase	Burkholderia_phage(22.22%)	17	187579:187595	194704:194720
WP_042456669.1|182683_183910_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	56.9	1.6e-122
WP_072071632.1|183902_184379_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	55.0	2.8e-43
WP_042456672.1|184375_185746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456675.1|186238_186475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456677.1|186471_186711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052677880.1|186698_187523_+	ERF family protein	NA	B5WZW4	Pseudomonas_phage	40.3	1.2e-30
187579:187595	attL	CGCGCCGTGATCGGCGG	NA	NA	NA	NA
WP_081252013.1|187719_188259_+	hypothetical protein	NA	A0A088F866	Sulfitobacter_phage	63.7	6.2e-23
WP_155734693.1|188258_188435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456682.1|188431_188617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081252014.1|188616_189006_+	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	32.5	2.4e-08
WP_052677882.1|189002_189359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456685.1|189355_189676_+	hypothetical protein	NA	A0A1P8D5Q7	Corynebacterium_phage	29.3	4.5e-05
WP_042456688.1|189668_190469_+	DUF2303 family protein	NA	A0A0A8IL76	Aurantimonas_phage	25.1	5.1e-13
WP_042456691.1|190590_191292_+	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.7	1.6e-79
WP_042456694.1|191291_191525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456697.1|191524_191716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456700.1|191685_192795_+|integrase	tyrosine-type recombinase/integrase	integrase	H6WBN7	Rhodobacter_phage	54.1	1.7e-91
194704:194720	attR	CCGCCGATCACGGCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	968180	974415	4082971	integrase	Rhodobacter_phage(50.0%)	9	961609:961627	974442:974460
961609:961627	attL	GTGGTGACCCCGGCAGGAC	NA	NA	NA	NA
WP_042464563.1|968180_968987_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	60.2	1.7e-85
WP_042456270.1|969146_969488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045291834.1|969484_969997_-	glycoside hydrolase family protein	NA	A0A0K1Y6F2	Rhodobacter_phage	59.7	4.8e-17
WP_042458581.1|970116_970500_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	41.6	1.6e-17
WP_081251777.1|971038_971671_-	SocA family protein	NA	NA	NA	NA	NA
WP_042458587.1|971813_972473_-	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	37.4	3.4e-23
WP_052677927.1|972469_972994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060833355.1|973105_973339_+	hypothetical protein	NA	I3UM25	Rhodobacter_phage	49.3	4.9e-09
WP_072071651.1|973305_974415_+|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	44.3	1.5e-63
974442:974460	attR	GTGGTGACCCCGGCAGGAC	NA	NA	NA	NA
>prophage 5
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	1891151	1904109	4082971	capsid,protease,head,portal,tail	Roseobacter_phage(33.33%)	16	NA	NA
WP_042460578.1|1891151_1892327_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.2	3.9e-62
WP_042460581.1|1892329_1892572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042460584.1|1892592_1893159_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	46.3	7.0e-33
WP_042460587.1|1893202_1894390_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.9	8.0e-63
WP_042460589.1|1894552_1895152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042460592.1|1895148_1895490_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_042460594.1|1895486_1895897_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_042460596.1|1895920_1896334_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_042460599.1|1896336_1896669_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_042460602.1|1896658_1896853_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_042460605.1|1896856_1897525_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	32.7	1.2e-07
WP_042460609.1|1897540_1898173_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.0	2.8e-59
WP_042460612.1|1898172_1899060_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.8	1.7e-57
WP_042460614.1|1899056_1899500_+	peptidase	NA	F4YXU4	Roseobacter_phage	45.8	1.1e-30
WP_042460617.1|1899503_1903403_+	phage host specificity protein	NA	F4YXU5	Roseobacter_phage	37.4	4.4e-227
WP_042460620.1|1903395_1904109_+	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	35.4	1.3e-31
>prophage 6
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	2433172	2440585	4082971		Rhodobacter_phage(16.67%)	11	NA	NA
WP_042461669.1|2433172_2433682_-	lysozyme	NA	A0A0K1Y6F2	Rhodobacter_phage	53.3	4.8e-33
WP_042461671.1|2433686_2433899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461673.1|2433923_2434211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042462587.1|2434245_2435055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063490916.1|2435062_2437702_-	hypothetical protein	NA	A0A2L0V157	Salmonella_phage	25.6	3.6e-31
WP_042461678.1|2437686_2438094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461680.1|2438090_2438615_-	hypothetical protein	NA	A0A2P1CL89	Pantoea_phage	26.8	5.1e-06
WP_042464994.1|2438711_2438894_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	47.4	5.9e-10
WP_042461682.1|2438910_2439303_+	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	35.2	1.1e-08
WP_063490917.1|2439311_2439902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052678017.1|2439901_2440585_-	hypothetical protein	NA	G8DH54	Emiliania_huxleyi_virus	49.4	2.6e-10
>prophage 7
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	2461730	2469205	4082971	capsid,head,protease,portal,terminase,tail	Paracoccus_phage(28.57%)	10	NA	NA
WP_042461714.1|2461730_2462192_-	hypothetical protein	NA	A0A0U2C0P4	Paracoccus_phage	41.5	7.0e-15
WP_042461715.1|2462188_2462530_-|head,tail	head-tail adaptor protein	head,tail	A0A0U2BXJ0	Paracoccus_phage	45.6	1.1e-14
WP_042461716.1|2462529_2462823_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_042461717.1|2462819_2463032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465014.1|2463101_2464409_-|capsid	phage major capsid protein	capsid	C4ML06	Xanthomonas_virus	39.5	5.5e-65
WP_042461719.1|2464468_2465317_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	54.2	1.1e-69
WP_042461721.1|2465313_2466549_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	40.7	8.0e-66
WP_042461723.1|2466545_2468279_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	43.1	5.5e-121
WP_042461724.1|2468275_2468746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042461726.1|2468836_2469205_-	endonuclease	NA	M4QRD8	Tetraselmis_viridis_virus	44.4	1.7e-08
>prophage 8
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	3829123	3901449	4082971	transposase	Leptospira_phage(25.0%)	37	NA	NA
WP_155734842.1|3829123_3830806_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	34.8	3.4e-19
WP_155734903.1|3830998_3831226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081251990.1|3831698_3833960_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	35.6	1.3e-69
WP_063490956.1|3834004_3837073_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	6.9e-58
WP_042463984.1|3837059_3837800_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_155734843.1|3838059_3839218_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.6	2.3e-46
WP_042463990.1|3839300_3840389_-	AAA family ATPase	NA	A0A1V0CP82	Kaumoebavirus	24.0	1.3e-06
WP_155734904.1|3840390_3840699_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_042463994.1|3840761_3841166_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081251991.1|3842388_3842874_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_063490958.1|3843441_3855573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464015.1|3855585_3856788_+	SpoIIE family protein phosphatase	NA	W8CYM9	Bacillus_phage	40.5	7.7e-13
WP_042464017.1|3856784_3857120_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042464020.1|3857123_3857528_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_052678111.1|3857640_3861297_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.3	6.1e-53
WP_081251993.1|3861731_3862019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042464029.1|3863491_3864319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464032.1|3864315_3864864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734846.1|3864887_3865865_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_155735157.1|3865818_3866253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081251994.1|3866278_3867391_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_042464040.1|3867350_3868142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465382.1|3868155_3868452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052678114.1|3868893_3871197_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	3.6e-43
WP_155734847.1|3871961_3873929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464045.1|3873901_3875527_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_081251995.1|3875534_3875855_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_042464050.1|3875851_3888805_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_081251996.1|3888868_3889978_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_042464054.1|3889949_3890873_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042464057.1|3890872_3892357_-	TolC family protein	NA	NA	NA	NA	NA
WP_042458151.1|3892806_3893109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|3894610_3895630_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155734683.1|3897067_3897883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071726.1|3898134_3899022_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_042465387.1|3899802_3900246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042456306.1|3900429_3901449_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015421	Rhodovulum sulfidophilum strain SNK001, complete genome	4082971	4040273	4047207	4082971	integrase	Azospirillum_phage(16.67%)	13	4029391:4029406	4048830:4048845
4029391:4029406	attL	CGGCCCGCGCCGCCGA	NA	NA	NA	NA
WP_042464273.1|4040273_4041323_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	34.1	1.3e-29
WP_155734682.1|4041300_4041477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464275.1|4041578_4042100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464276.1|4042092_4042527_-	hypothetical protein	NA	W6MW33	Pseudomonas_phage	49.0	1.6e-13
WP_042464278.1|4042526_4043240_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.7	1.2e-82
WP_042465411.1|4043236_4044067_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.2	1.1e-71
WP_042464280.1|4044078_4044306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734691.1|4044305_4044458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464281.1|4044515_4044797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464283.1|4045019_4045655_-	phage repressor protein	NA	NA	NA	NA	NA
WP_042456636.1|4046020_4046302_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	58.9	7.0e-26
WP_155734865.1|4046298_4046439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081252004.1|4046499_4047207_+	hypothetical protein	NA	A0A0K2FI53	Enterobacteria_phage	37.6	5.9e-05
4048830:4048845	attR	CGGCCCGCGCCGCCGA	NA	NA	NA	NA
>prophage 1
NZ_CP015422	Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence	113522	990	9531	113522		Ochrobactrum_phage(33.33%)	6	NA	NA
WP_081252070.1|990_2328_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	32.7	6.7e-10
WP_042465500.1|2505_3447_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	33.8	4.0e-41
WP_042465503.1|3448_4627_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	61.2	2.0e-135
WP_052678173.1|5011_6868_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	6.0e-33
WP_042465506.1|6864_8673_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	1.1e-31
WP_081252071.1|8673_9531_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	6.6e-19
