The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	329962	337127	7021552	integrase,coat	Pseudomonas_phage(100.0%)	10	329606:329636	340955:340985
329606:329636	attL	AGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
WP_023090792.1|329962_330958_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.9	2.8e-93
WP_003115206.1|330957_332250_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_023092200.1|332479_333754_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.5	1.1e-200
WP_003114150.1|333757_334114_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_049875594.1|334118_335399_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	56.7	2.1e-48
WP_003125072.1|335546_335795_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|335807_336059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|336071_336164_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003115097.1|336180_336615_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	1.2e-61
WP_031687635.1|336749_337127_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	83.2	5.1e-48
340955:340985	attR	AGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
>prophage 2
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	803142	833484	7021552	bacteriocin,integrase,transposase	Salmonella_phage(50.0%)	28	808195:808211	812300:812316
WP_023095640.1|803142_803400_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_023980443.1|803402_804350_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_023095638.1|806083_806659_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	8.9e-44
WP_023095637.1|806639_808301_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
808195:808211	attL	CCTACATCGACCAGGTG	NA	NA	NA	NA
WP_023095636.1|808290_809268_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023980678.1|809594_809858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111051.1|809854_810856_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003111050.1|811036_812008_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111049.1|812037_812781_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
812300:812316	attR	CCTACATCGACCAGGTG	NA	NA	NA	NA
WP_003111048.1|812802_814119_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_012075823.1|814530_815940_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111046.1|815955_816684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120172.1|816680_817586_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003120171.1|817593_818058_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003111043.1|818237_818600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111042.1|818596_821611_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	1.7e-72
WP_016851620.1|821820_822285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003957.1|822287_822848_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_011005944.1|822851_825818_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.6	0.0e+00
WP_019484422.1|827044_827476_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_019484421.1|827475_828414_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_033983604.1|828431_829814_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_015503619.1|829813_830131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111830.1|830127_831663_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_015503621.1|831692_832046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023111831.1|832164_832437_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_023111832.1|832440_832791_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015503624.1|833190_833484_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	1541364	1625492	7021552	tRNA,portal,protease,plate,tail,capsid,head,terminase,integrase,holin	Pseudomonas_virus(75.0%)	92	1572053:1572069	1633756:1633772
WP_003096011.1|1541364_1542819_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003096016.1|1543155_1544565_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003096019.1|1544712_1545117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096022.1|1545113_1547321_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003096024.1|1547608_1548130_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_023092716.1|1548126_1548699_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_003096033.1|1548969_1550046_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.4e-05
WP_003104661.1|1550048_1551479_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_003096038.1|1552435_1552903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003096047.1|1552901_1553363_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|1553421_1553913_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003096057.1|1553949_1554204_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	1.6e-13
WP_003096058.1|1554205_1554625_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003096060.1|1554949_1556497_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004365496.1|1556809_1557628_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063456080.1|1557777_1559064_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003096067.1|1559092_1560403_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
WP_021263278.1|1560402_1561176_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023092718.1|1561244_1562726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|1562762_1563518_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|1563667_1564420_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023092719.1|1564510_1565257_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|1565428_1566199_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|1566209_1566947_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003111635.1|1566995_1567256_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_023092720.1|1567259_1567898_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|1567897_1568491_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_009878269.1|1568651_1569050_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_009314450.1|1569086_1569323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023092721.1|1569319_1570426_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023092722.1|1570519_1572772_+	AsmA family protein	NA	NA	NA	NA	NA
1572053:1572069	attL	AAGGCCAACCTCGACGT	NA	NA	NA	NA
WP_003110600.1|1572768_1573836_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|1573879_1574152_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_023092723.1|1574179_1575262_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003096148.1|1575507_1576245_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003135910.1|1576402_1577092_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096153.1|1577340_1578114_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003096156.1|1578128_1578881_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023980286.1|1578942_1579638_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096163.1|1579634_1580327_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023092724.1|1580395_1581616_+	methyltransferase	NA	NA	NA	NA	NA
WP_003110596.1|1582019_1582490_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003118019.1|1582493_1583972_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003110594.1|1583986_1585171_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003146487.1|1585181_1586711_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_074198630.1|1587723_1588266_+	ImmA/IrrE family metallo-endopeptidase	NA	Q332A2	Clostridium_botulinum_C_phage	37.9	9.7e-08
WP_132595897.1|1588266_1588863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456081.1|1588899_1589946_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	95.7	5.5e-193
WP_063456208.1|1589945_1591706_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.7	0.0e+00
WP_154021675.1|1591861_1592671_+|capsid	phage capsid protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	9.7e-121
WP_023093064.1|1592717_1593734_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.7	3.5e-192
WP_016852025.1|1593739_1594441_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	99.1	4.8e-124
WP_016852026.1|1594544_1595006_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	3.1e-79
WP_003098378.1|1595005_1595218_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|1595242_1595596_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_015967189.1|1595597_1595870_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	100.0	2.4e-39
WP_058177793.1|1595866_1596673_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	99.6	1.8e-151
WP_063456082.1|1596669_1597131_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	97.4	9.9e-70
WP_023116064.1|1597208_1597745_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	99.4	1.2e-95
WP_058202152.1|1597737_1598196_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	9.2e-68
WP_016852033.1|1598265_1598838_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
WP_023093071.1|1598834_1599179_+	hypothetical protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
WP_023116819.1|1599175_1600090_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	99.7	5.6e-165
WP_058202153.1|1600089_1600626_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	98.3	3.4e-98
WP_079770987.1|1600627_1602973_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	64.9	8.1e-269
WP_058202154.1|1602972_1603434_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	63.8	5.3e-47
WP_023083451.1|1603524_1604700_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.2	1.1e-218
WP_016852040.1|1604756_1605272_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.7	7.4e-90
WP_023083449.1|1605326_1605656_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_003098394.1|1605664_1605784_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_058202155.1|1605773_1608533_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.3	0.0e+00
WP_015967206.1|1608538_1608979_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_063456083.1|1608975_1610238_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	98.1	1.6e-234
WP_074198632.1|1610413_1611274_+	DNA adenine methylase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	27.9	2.5e-13
WP_132595956.1|1611275_1612670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071536765.1|1612917_1613307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020750421.1|1613422_1613653_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031637512.1|1613682_1614156_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
WP_023091244.1|1614163_1614382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023876137.1|1614380_1614572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127762.1|1614574_1614868_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	97.9	3.2e-50
WP_033936702.1|1614864_1615215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|1615286_1615520_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_063456084.1|1615516_1618237_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.3	0.0e+00
WP_022580407.1|1618281_1618635_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	94.9	3.2e-60
WP_074198633.1|1618646_1618853_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	97.1	3.6e-32
WP_063456085.1|1619156_1621067_+	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	95.1	8.9e-282
WP_063456086.1|1621063_1622296_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.1	3.4e-173
WP_049270657.1|1622306_1622495_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.9e-05
WP_022580401.1|1622491_1622707_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_063456087.1|1622703_1623846_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	40.2	1.8e-72
WP_023092725.1|1624172_1625492_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.8	6.3e-69
1633756:1633772	attR	AAGGCCAACCTCGACGT	NA	NA	NA	NA
>prophage 4
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	2080717	2154920	7021552	transposase,tRNA,holin	uncultured_virus(20.0%)	58	NA	NA
WP_023092813.1|2080717_2082610_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003136524.1|2083083_2083467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023092814.1|2083790_2085158_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003097255.1|2085228_2086965_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_023092815.1|2087205_2087613_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003100258.1|2087627_2087762_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_023083824.1|2088287_2089832_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003097262.1|2089860_2090964_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	36.1	6.7e-56
WP_003097265.1|2090973_2092083_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003097268.1|2092079_2094500_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.9	3.1e-114
WP_088169868.1|2094709_2095848_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	1.9e-45
WP_049311444.1|2095958_2098376_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.6	7.6e-44
WP_033983075.1|2098844_2100356_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023980255.1|2100419_2100755_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_033983075.1|2100983_2102495_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023980255.1|2102558_2102894_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079388890.1|2102890_2103289_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_016852303.1|2105920_2106136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019485165.1|2106353_2107127_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_023092222.1|2107138_2107675_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_019485166.1|2108006_2109713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023980069.1|2109769_2111824_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003097276.1|2111823_2112771_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003097280.1|2112875_2113427_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003097282.1|2113571_2114459_+	lysophospholipid acyltransferase	NA	NA	NA	NA	NA
WP_003114645.1|2114543_2114810_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_003097286.1|2114956_2115610_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.1	2.6e-55
WP_003142201.1|2115670_2115943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003097288.1|2116257_2116575_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111375.1|2116723_2118097_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_023092224.1|2118123_2119428_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_009316076.1|2119424_2120369_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_003097293.1|2120423_2120930_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.2	4.3e-18
WP_003097294.1|2121068_2122094_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023092225.1|2122228_2123317_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.5	3.0e-24
WP_003097300.1|2123357_2123915_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_023092226.1|2123924_2124902_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_003097311.1|2125092_2126010_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_003097314.1|2126067_2126892_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003097316.1|2127002_2127989_+	phospholipase	NA	NA	NA	NA	NA
WP_023092227.1|2127969_2129256_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_023092228.1|2129252_2129855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023092229.1|2129858_2131412_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.3	2.9e-20
WP_003097322.1|2131416_2132340_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003097323.1|2132356_2133868_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_003122286.1|2133980_2134895_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114635.1|2134905_2135283_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_003097330.1|2135261_2135627_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003111192.1|2135634_2136258_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003120671.1|2136443_2137250_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003097340.1|2137246_2138455_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003122282.1|2138557_2139445_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003097345.1|2139545_2139761_+	dodecin family protein	NA	NA	NA	NA	NA
WP_003097347.1|2139944_2140172_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_023092230.1|2140468_2142157_+	two-partner secretion system transporter TpsB2	NA	NA	NA	NA	NA
WP_034059389.1|2152885_2153206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153514935.1|2153845_2154121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023092233.1|2154227_2154920_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	2721953	2809611	7021552	tRNA,tail,transposase,plate,holin	Pseudomonas_phage(37.5%)	87	NA	NA
WP_003109020.1|2721953_2722979_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|2723057_2723627_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|2723710_2724064_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|2724054_2724597_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|2724569_2725802_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|2725845_2726352_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|2726445_2727999_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|2727995_2729267_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|2729367_2731290_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|2731567_2731900_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003085085.1|2732793_2733174_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003113212.1|2733210_2734017_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003109023.1|2734132_2735119_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|2735115_2736408_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_023092353.1|2736388_2739181_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|2739313_2741026_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_003137370.1|2742298_2743315_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|2743311_2743986_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_033983075.1|2744632_2746144_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023980255.1|2746207_2746543_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079388890.1|2746539_2746938_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021263061.1|2747121_2748183_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_023092354.1|2748334_2750728_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|2750773_2751406_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023092355.1|2751534_2752569_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|2752802_2753912_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|2753967_2755014_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|2755128_2756376_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023092356.1|2756481_2757312_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|2757435_2758110_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|2758109_2758928_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_023092357.1|2758996_2760475_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_023092358.1|2760792_2761107_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_023092359.1|2761206_2761977_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.0e-71
WP_023092361.1|2762434_2762635_+	hypothetical protein	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_023092362.1|2762682_2763042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073647038.1|2763404_2763854_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	6.5e-26
WP_021263056.1|2763875_2764391_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	6.3e-33
WP_003121844.1|2764387_2764945_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|2765097_2765424_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_023092363.1|2765420_2766308_+|plate	phage baseplate assembly protein	plate	S4TNY7	Salmonella_phage	59.5	1.6e-87
WP_023092364.1|2766300_2766834_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	1.1e-61
WP_023092365.1|2766835_2768953_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	1.9e-224
WP_016852415.1|2768960_2769401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023092366.1|2769443_2770604_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	4.5e-188
WP_023092367.1|2770616_2771120_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	1.4e-64
WP_003085178.1|2771134_2771479_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023092368.1|2771648_2773886_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_023092369.1|2773895_2774768_+	hypothetical protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|2774742_2774949_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_023092370.1|2775006_2775996_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.7e-106
WP_003117966.1|2776028_2776658_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	4.2e-87
WP_023092371.1|2776654_2777017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137395.1|2777013_2777271_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_003113190.1|2777586_2778081_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|2778092_2778440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|2778469_2778724_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023092372.1|2778770_2780609_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|2780601_2780943_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|2780950_2781646_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|2781648_2782419_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003117974.1|2782473_2783076_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_023092373.1|2783134_2786749_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	54.7	0.0e+00
WP_031627675.1|2786984_2787773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023085656.1|2788886_2789222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118928.1|2789202_2789433_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	65.3	6.7e-19
WP_009315200.1|2789528_2790581_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_003113177.1|2790580_2790883_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003113176.1|2790879_2791110_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	8.2e-25
WP_023092374.1|2791528_2792134_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	4.6e-75
WP_003085203.1|2792135_2793185_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|2793181_2794018_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085214.1|2794079_2794724_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|2794994_2795417_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085224.1|2796584_2797232_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003121853.1|2797747_2799229_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
WP_023092375.1|2799268_2800069_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003085240.1|2800129_2801212_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085244.1|2801333_2802302_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|2802318_2802741_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003101649.1|2803031_2804066_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|2804065_2804785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|2804785_2805208_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|2805285_2805636_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003085271.1|2805689_2806781_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_073668220.1|2806783_2808127_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_023092377.1|2808411_2809611_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	3513085	3628108	7021552	tRNA,portal,protease,tail,capsid,head,lysis,terminase,integrase,holin	Pseudomonas_phage(53.23%)	117	3533647:3533665	3581693:3581711
WP_023092567.1|3513085_3513766_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003098661.1|3513839_3514187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129902.1|3514205_3515072_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	50.8	1.5e-26
WP_021265168.1|3515144_3515969_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_019484555.1|3515973_3516669_+	extensin	NA	NA	NA	NA	NA
WP_009876931.1|3516724_3517510_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003137978.1|3517538_3518816_+	cytochrome P450	NA	NA	NA	NA	NA
WP_003098648.1|3518822_3519461_-	efflux system transcriptional repressor MexL	NA	NA	NA	NA	NA
WP_003129909.1|3519556_3520660_+	multidrug efflux RND transporter periplasmic adaptor subunit MexJ	NA	NA	NA	NA	NA
WP_023092568.1|3520664_3523742_+	multidrug efflux RND transporter permease subunit MexK	NA	S5VL66	Leptospira_phage	20.0	9.7e-28
WP_003111961.1|3523782_3524463_-	DUF4197 domain-containing protein	NA	NA	NA	NA	NA
WP_003092458.1|3524599_3524998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063456110.1|3525140_3527645_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_003109350.1|3527928_3528852_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	1.2e-21
WP_003117479.1|3528848_3529583_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023092570.1|3531443_3532424_+	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_003092439.1|3532430_3532853_-	SufE family protein	NA	NA	NA	NA	NA
WP_003109345.1|3532849_3534055_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.2	2.3e-73
3533647:3533665	attL	CCAGGCCGCGGCGCAGGGC	NA	NA	NA	NA
WP_003092431.1|3534149_3535184_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_003092427.1|3535213_3535837_-	LysE family translocator	NA	NA	NA	NA	NA
WP_003109343.1|3535849_3536197_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_063456111.1|3536263_3537367_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	98.9	8.7e-205
WP_071534497.1|3537347_3537590_-	excisionase	NA	NA	NA	NA	NA
WP_043227123.1|3537806_3538124_-	hypothetical protein	NA	A0A0U4JNZ9	Pseudomonas_phage	92.4	1.4e-51
WP_031276825.1|3538168_3538357_-	hypothetical protein	NA	A0A1B0YZX4	Pseudomonas_phage	100.0	4.2e-27
WP_015648583.1|3539113_3539323_-	hypothetical protein	NA	D4FUN0	Pseudomonas_phage	91.7	3.2e-28
WP_079770992.1|3540576_3540825_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	90.2	3.8e-36
WP_079770993.1|3540836_3541868_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.7	1.5e-113
WP_023980134.1|3542421_3542799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023980133.1|3542865_3543168_-	hypothetical protein	NA	A0A1B0YZY4	Pseudomonas_phage	98.0	9.7e-42
WP_023980132.1|3543375_3543624_-	hypothetical protein	NA	A0A1B0YZY1	Pseudomonas_phage	95.1	6.5e-36
WP_063456112.1|3543634_3544021_-	helix-turn-helix transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	99.2	4.0e-64
WP_031278712.1|3544330_3545197_-	ParB N-terminal domain-containing protein	NA	A0A0U4JP11	Pseudomonas_phage	98.6	6.9e-157
WP_063456113.1|3545435_3546221_-	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	91.2	2.8e-133
WP_016852544.1|3546554_3547316_-	LexA family transcriptional regulator	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	59.0	3.6e-40
WP_079770994.1|3547879_3548686_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	83.7	1.4e-74
WP_023980127.1|3548682_3549366_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	99.6	1.1e-125
WP_003159465.1|3549362_3549569_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	94.1	3.1e-31
WP_023980126.1|3549565_3550147_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	95.9	2.3e-103
WP_023980125.1|3550143_3550440_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	82.7	1.4e-40
WP_023980124.1|3550441_3550816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023517910.1|3551359_3551674_+|holin	phage holin, lambda family	holin	A0A0A0YUH2	Pseudomonas_phage	99.0	9.8e-53
WP_023980122.1|3551673_3552291_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	92.2	7.0e-103
WP_023980121.1|3552290_3552764_+|lysis	lysis protein Rz	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	2.5e-68
WP_023980120.1|3552763_3553093_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	54.8	1.9e-27
WP_023980119.1|3553208_3553700_+	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	1.9e-10
WP_031276790.1|3553703_3555383_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.8	2.1e-194
WP_031276789.1|3555385_3556603_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.2	3.1e-171
WP_015649331.1|3556586_3557231_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_063456114.1|3557227_3558442_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.3	4.1e-155
WP_023111185.1|3558493_3558697_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	3.1e-07
WP_003085762.1|3558696_3559020_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_022580265.1|3559019_3559346_+|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_071556460.1|3559351_3559546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031276786.1|3559549_3560122_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	49.5	5.9e-40
WP_015649327.1|3560114_3560501_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	64.6	5.8e-39
WP_023980115.1|3560532_3561039_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	73.5	1.5e-58
WP_023980114.1|3561109_3561454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023980113.1|3561716_3564971_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	33.6	1.8e-72
WP_015649322.1|3564970_3565309_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	53.6	3.0e-31
WP_023980112.1|3565305_3566052_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	79.1	3.8e-119
WP_023980111.1|3566054_3566813_+	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	75.3	1.8e-116
WP_015649319.1|3566859_3567102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154021677.1|3567098_3567515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456115.1|3567563_3568136_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	64.0	1.1e-57
WP_023980109.1|3568192_3571858_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	75.1	0.0e+00
WP_063456116.1|3572816_3573893_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	42.4	3.4e-60
WP_031276784.1|3573889_3574204_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	87.4	1.8e-46
WP_023980106.1|3574448_3574652_-	hypothetical protein	NA	W6MW53	Pseudomonas_phage	98.5	2.0e-30
WP_023980105.1|3574761_3575436_-	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	89.2	3.8e-118
WP_023109386.1|3575503_3575776_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	97.8	4.5e-46
WP_003092421.1|3576255_3576609_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003109342.1|3576623_3576917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003092416.1|3577238_3577598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079770996.1|3577835_3579581_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_003092403.1|3579630_3580839_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_003113862.1|3580856_3583559_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
3581693:3581711	attR	CCAGGCCGCGGCGCAGGGC	NA	NA	NA	NA
WP_003092395.1|3583725_3584511_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003092394.1|3584775_3585516_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003092393.1|3585646_3586516_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003092391.1|3586714_3587452_+	UMP kinase	NA	NA	NA	NA	NA
WP_003092390.1|3587454_3588012_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003113863.1|3588027_3588783_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.8	1.2e-19
WP_003092388.1|3588776_3589592_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003109337.1|3589588_3590779_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_009313536.1|3590804_3592157_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_003098590.1|3592227_3594612_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003098586.1|3594662_3595169_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_003098585.1|3595168_3596230_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003092375.1|3596275_3596716_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003092373.1|3596712_3597489_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003092372.1|3597492_3598629_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_003092371.1|3598628_3599234_+	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	35.8	1.6e-19
WP_003092370.1|3599450_3600866_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_003098578.1|3600995_3604517_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	37.7	1.7e-198
WP_003109333.1|3604666_3605617_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_023092573.1|3605686_3607015_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	5.9e-06
WP_003092366.1|3607185_3608814_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_003092365.1|3608816_3609662_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-48
WP_003092364.1|3609707_3610997_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_003098569.1|3611061_3611346_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003092359.1|3611365_3612070_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003092358.1|3612130_3612379_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003092355.1|3612344_3613571_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003098564.1|3613646_3614555_-	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092351.1|3614686_3615799_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_003117489.1|3615852_3616704_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003092346.1|3616774_3617248_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003092343.1|3617244_3618312_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|3618299_3619049_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|3619081_3619717_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_023092574.1|3619762_3620656_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|3620760_3621765_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|3622191_3622515_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079770997.1|3622581_3625149_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092262.1|3626428_3626935_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_063456118.1|3627067_3628108_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.1e-113
>prophage 7
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	3715766	3763811	7021552	portal,protease,tail,capsid,head,transposase,terminase,integrase,holin	Pseudomonas_phage(85.71%)	66	3720991:3721049	3764430:3764488
WP_003110461.1|3715766_3717077_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	O41091	Paramecium_bursaria_Chlorella_virus	29.6	1.1e-36
WP_003092094.1|3717979_3718759_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003092092.1|3718865_3719948_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_003092090.1|3719952_3720870_-	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	27.6	2.0e-21
3720991:3721049	attL	ATAAGGAAATGTCGCGGAAACACAAGGAGGGGCTTGGAAGGCGCGGGTTACGGGGTTTT	NA	NA	NA	NA
WP_023981203.1|3721051_3722218_-|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	98.7	3.1e-221
WP_031691834.1|3722612_3722936_-	hypothetical protein	NA	A0A0U4JVQ0	Pseudomonas_phage	89.7	1.1e-48
WP_023981202.1|3722980_3723394_-	hypothetical protein	NA	A0A218M341	Acidovorax_phage	62.9	3.4e-05
WP_023981201.1|3723390_3723882_-	hypothetical protein	NA	A0A1B0YZW8	Pseudomonas_phage	50.7	2.4e-21
WP_023981200.1|3723874_3724048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078452301.1|3724047_3725319_-	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	51.3	1.6e-48
WP_023103693.1|3725315_3725522_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	85.5	3.5e-27
WP_023981198.1|3725485_3725734_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	95.1	3.7e-39
WP_023981197.1|3725816_3726167_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	89.7	1.1e-57
WP_023981196.1|3726283_3726640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023981194.1|3727177_3728617_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	46.0	1.2e-100
WP_012613688.1|3728680_3728983_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	98.0	2.8e-41
WP_023981193.1|3728982_3729657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023981192.1|3729870_3730119_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	93.9	4.2e-35
WP_023981191.1|3730129_3730516_-	helix-turn-helix transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	97.6	8.9e-64
WP_031278712.1|3730825_3731692_-	ParB N-terminal domain-containing protein	NA	A0A0U4JP11	Pseudomonas_phage	98.6	6.9e-157
WP_023980498.1|3731930_3732716_-	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	90.8	8.2e-133
WP_023980904.1|3733175_3733433_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	68.7	1.4e-25
WP_079391010.1|3733478_3733880_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_079388890.1|3733849_3734248_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_023980255.1|3734244_3734580_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_033983075.1|3734643_3736155_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023980590.1|3736742_3737498_-	helix-turn-helix transcriptional regulator	NA	L7TH81	Pseudomonas_virus	74.7	2.6e-75
WP_031691842.1|3738094_3738856_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	84.7	2.8e-77
WP_023981189.1|3738852_3739536_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	91.6	3.0e-115
WP_003159465.1|3739532_3739739_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	94.1	3.1e-31
WP_023981188.1|3739735_3740317_+	ninG protein	NA	A0A0U4KL68	Pseudomonas_phage	95.9	4.3e-102
WP_023981187.1|3740313_3740610_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	94.9	1.5e-47
WP_023981186.1|3740611_3740986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071537902.1|3741194_3741734_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	83.2	8.3e-76
WP_023981185.1|3741913_3742246_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	99.1	2.0e-43
WP_023981184.1|3742242_3742860_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	93.6	2.1e-107
WP_023981183.1|3742829_3743309_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	86.2	2.5e-52
WP_023981182.1|3743445_3743850_+	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	52.7	3.7e-28
WP_014602593.1|3743931_3744414_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	74.4	1.4e-61
WP_023127397.1|3744417_3746145_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	76.3	5.4e-270
WP_023092517.1|3746144_3747368_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	81.0	1.9e-189
WP_023092518.1|3747345_3747999_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	82.6	2.6e-100
WP_023092519.1|3748009_3749212_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	76.8	9.9e-178
WP_023092520.1|3749257_3749536_+	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	40.9	4.2e-15
WP_023092521.1|3749528_3749849_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	57.1	4.1e-30
WP_023092522.1|3749871_3750054_+	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	55.9	9.1e-11
WP_023981180.1|3750063_3750615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098513.1|3750611_3751205_+	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	98.0	1.3e-101
WP_023981179.1|3751217_3751655_+	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	94.5	1.0e-71
WP_023092525.1|3751678_3752464_+	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	94.6	1.4e-140
WP_063456121.1|3752519_3752885_+	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	97.5	1.5e-57
WP_124128807.1|3752890_3753070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023981177.1|3753068_3755210_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	98.7	0.0e+00
WP_003098501.1|3755219_3755723_+	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	100.0	1.8e-93
WP_023981176.1|3755724_3757428_+	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	92.8	2.6e-301
WP_023093251.1|3757430_3757841_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	95.6	2.5e-56
WP_023092530.1|3757840_3758386_+	hypothetical protein	NA	A0A1W6JT85	Pseudomonas_phage	100.0	1.7e-100
WP_023092531.1|3758396_3758801_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	98.5	7.6e-66
WP_023981175.1|3758797_3760456_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	97.4	0.0e+00
WP_023093253.1|3760485_3761073_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	94.4	2.8e-101
WP_023092534.1|3761065_3761257_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	96.8	8.6e-28
WP_023981174.1|3761261_3761822_+	hypothetical protein	NA	A0A1W6JT84	Pseudomonas_phage	98.9	4.2e-99
WP_023981173.1|3761822_3762104_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	1.5e-44
WP_031278687.1|3762683_3762998_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	93.3	1.4e-51
WP_023981171.1|3763037_3763316_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	98.9	1.9e-47
WP_023118775.1|3763376_3763811_-	transcriptional regulator	NA	A0A1B0VMC9	Pseudomonas_phage	41.9	2.7e-16
3764430:3764488	attR	ATAAGGAAATGTCGCGGAAACACAAGGAGGGGCTTGGAAGGCGCGGGTTACGGGGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	4892842	4899736	7021552	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|4892842_4894123_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_023091681.1|4894124_4895522_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|4895526_4896501_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|4896588_4897572_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|4897568_4897904_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|4897900_4898206_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|4898205_4898565_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_019485635.1|4898561_4898957_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	70.5	2.9e-46
WP_003090386.1|4899067_4899736_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 9
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	4926729	4985397	7021552	terminase,integrase,holin,tail	Pseudomonas_phage(73.44%)	71	4930649:4930708	4985624:4985715
WP_023875222.1|4926729_4929708_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	2.0e-33
WP_003090076.1|4929798_4930332_+	hypothetical protein	NA	NA	NA	NA	NA
4930649:4930708	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_003099003.1|4930794_4931832_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	1.1e-111
WP_003158549.1|4931860_4932094_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_063456140.1|4932150_4932537_-	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	99.2	1.0e-64
WP_063456213.1|4932652_4933699_-	hypothetical protein	NA	A0A127KN88	Pseudomonas_phage	95.7	4.2e-124
WP_063456141.1|4933796_4934303_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	93.5	2.0e-84
WP_034027053.1|4934299_4934665_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	93.7	2.4e-58
WP_063456142.1|4934661_4935444_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	94.1	8.8e-135
WP_003116728.1|4935440_4935764_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	99.0	4.4e-56
WP_063456214.1|4935760_4936255_-	DUF550 domain-containing protein	NA	H2BD43	Pseudomonas_phage	93.3	3.9e-88
WP_063456143.1|4936404_4936833_-	hypothetical protein	NA	H2BD44	Pseudomonas_phage	98.6	3.6e-74
WP_063456144.1|4936829_4938515_-	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	96.0	1.4e-302
WP_079770999.1|4938511_4939687_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	33.8	1.5e-45
WP_063456147.1|4939891_4940248_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_063456148.1|4940300_4940909_-	DUF1566 domain-containing protein	NA	A0A2I6PHV1	Pseudomonas_phage	32.4	7.1e-07
WP_063456149.1|4940996_4941620_-	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	38.1	1.5e-07
WP_063456150.1|4941645_4943391_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	92.6	1.6e-293
WP_063456151.1|4943394_4944156_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.4	1.9e-105
WP_003116739.1|4944167_4944368_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_034051633.1|4944374_4945313_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	99.6	1.2e-151
WP_033945330.1|4945309_4945525_-	hypothetical protein	NA	J7I4L3	Pseudomonas_phage	100.0	1.4e-34
WP_063456152.1|4946461_4946653_-	hypothetical protein	NA	H2BD52	Pseudomonas_phage	95.2	4.7e-26
WP_003099037.1|4946649_4946871_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_063456153.1|4947582_4947954_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	92.7	2.8e-59
WP_063456154.1|4947986_4948250_-	hypothetical protein	NA	H2BD57	Pseudomonas_phage	98.9	6.3e-45
WP_063456155.1|4948840_4949173_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	95.5	8.2e-50
WP_023113725.1|4949528_4950398_-	hypothetical protein	NA	F5A3D6	Riemerella_phage	41.8	7.9e-52
WP_079771000.1|4950466_4951339_-	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	97.9	1.3e-155
WP_016046666.1|4951393_4951606_+	transcriptional regulator	NA	H2BD64	Pseudomonas_phage	100.0	7.1e-31
WP_023096627.1|4951642_4952215_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	99.5	1.2e-101
WP_063456156.1|4952217_4953102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456157.1|4953151_4953760_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	50.6	1.8e-42
WP_031641998.1|4953752_4954196_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	1.4e-76
WP_033987542.1|4954224_4954911_+	hypothetical protein	NA	H2BD72	Pseudomonas_phage	99.1	3.7e-129
WP_004349441.1|4955026_4955416_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_003116758.1|4955408_4955693_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	100.0	1.2e-41
WP_063456158.1|4955701_4956301_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	60.5	7.6e-46
WP_063456159.1|4956284_4957580_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.0	1.2e-144
WP_063456160.1|4957582_4958938_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.6	4.8e-96
WP_063456161.1|4958934_4960014_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.6	3.0e-202
WP_063456162.1|4960889_4961861_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.3	8.4e-111
WP_063456163.1|4961903_4962389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456164.1|4962372_4962837_+	hypothetical protein	NA	H9EB35	Vibrio_phage	35.7	2.6e-09
WP_019396738.1|4962836_4963226_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.8	1.3e-33
WP_058018019.1|4963229_4963904_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	7.8e-116
WP_049308163.1|4963926_4964340_+	hypothetical protein	NA	A0A0S2SYM4	Pseudomonas_phage	93.4	1.1e-67
WP_049308165.1|4964393_4965050_+|tail	phage tail protein	tail	A0A0S2SYG8	Pseudomonas_phage	95.4	1.3e-110
WP_049308168.1|4965059_4965377_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	97.1	8.9e-54
WP_031300032.1|4965394_4965685_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	90.5	6.5e-35
WP_049308170.1|4965688_4968706_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	92.9	0.0e+00
WP_033946792.1|4968708_4969047_+|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	58.9	5.2e-36
WP_031634958.1|4969043_4969793_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.4	4.3e-147
WP_063456165.1|4969795_4970557_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	95.5	1.0e-143
WP_010793125.1|4970581_4970824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456166.1|4970804_4971038_-	hypothetical protein	NA	A0A0S2SY71	Pseudomonas_phage	90.7	6.0e-15
WP_154021681.1|4971074_4971449_-	hypothetical protein	NA	A0A0S2SYA2	Pseudomonas_phage	97.6	2.7e-41
WP_063456168.1|4971606_4971936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079771001.1|4972025_4972427_-	Arc family DNA-binding protein	NA	A0A0P0IVR2	Acinetobacter_phage	57.1	9.7e-05
WP_063456172.1|4973616_4974192_+	hypothetical protein	NA	G1D3R9	Mycobacterium_virus	36.9	2.1e-32
WP_063456173.1|4974184_4974643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078459361.1|4975115_4975703_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	79.0	1.3e-87
WP_063456174.1|4975766_4976378_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	83.3	5.3e-87
WP_031688063.1|4976701_4977202_+	DNA-binding protein	NA	Q9XJS9	Pseudomonas_phage	65.9	2.2e-59
WP_063456175.1|4977260_4980923_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	86.6	0.0e+00
WP_063456116.1|4981881_4982958_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	42.4	3.4e-60
WP_063456216.1|4982954_4983269_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	88.5	1.1e-48
WP_063456176.1|4983953_4984322_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	80.3	2.6e-44
WP_063456177.1|4984318_4984582_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	88.5	2.4e-36
WP_058130255.1|4984617_4984881_+	hypothetical protein	NA	A0A0U4JX18	Pseudomonas_phage	97.7	1.1e-44
WP_063456178.1|4984884_4985397_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	92.9	4.6e-92
4985624:4985715	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAGTGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 10
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	5763614	5783858	7021552	tail	Pseudomonas_phage(76.92%)	30	NA	NA
WP_034063464.1|5763614_5765714_-	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	97.0	0.0e+00
WP_017001675.1|5765713_5766178_-	hypothetical protein	NA	W6MVK9	Pseudomonas_phage	97.4	1.1e-73
WP_153574196.1|5766201_5766666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456186.1|5766622_5768962_-	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	98.3	0.0e+00
WP_034063461.1|5768958_5769588_-	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	98.1	1.8e-114
WP_023085182.1|5769642_5769885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031675655.1|5769895_5770342_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	67.4	4.6e-40
WP_063456187.1|5770373_5771366_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	56.1	3.2e-105
WP_034063460.1|5771372_5771993_-	peptidase	NA	W6MWW5	Pseudomonas_phage	94.1	8.1e-75
WP_023465466.1|5771989_5772301_-	hypothetical protein	NA	W6MVD5	Pseudomonas_phage	94.2	1.4e-48
WP_031278275.1|5772301_5773990_-|tail	tail protein	tail	W6MYA0	Pseudomonas_phage	99.6	0.0e+00
WP_023465464.1|5773991_5774246_-	hypothetical protein	NA	W6MVK3	Pseudomonas_phage	98.8	2.5e-35
WP_031278272.1|5774257_5775718_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	73.8	1.5e-204
WP_023980921.1|5775695_5776160_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	51.5	9.1e-31
WP_023835969.1|5776163_5776394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079383650.1|5776390_5776834_-	hypothetical protein	NA	W6MYB3	Pseudomonas_phage	93.9	2.6e-67
WP_023980919.1|5776830_5777283_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	74.6	5.7e-54
WP_049878428.1|5777279_5777480_-	hypothetical protein	NA	Q3HQU8	Burkholderia_phage	59.6	6.3e-05
WP_063456218.1|5777695_5778070_-	hypothetical protein	NA	W6MVN8	Pseudomonas_phage	99.2	1.7e-64
WP_023093573.1|5778140_5778299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042939642.1|5778295_5778904_-	hypothetical protein	NA	A0A125RNK9	Pseudomonas_phage	68.2	1.1e-68
WP_023093576.1|5779120_5779390_-	hypothetical protein	NA	B5WZY5	Pseudomonas_phage	50.0	1.7e-13
WP_031684207.1|5779386_5779803_-	hypothetical protein	NA	A0A0S2SYC1	Pseudomonas_phage	96.4	2.1e-74
WP_058130656.1|5779795_5780011_-	hypothetical protein	NA	W6MW49	Pseudomonas_phage	97.1	1.2e-33
WP_033991549.1|5780152_5780968_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	54.0	5.6e-76
WP_024007930.1|5780957_5781764_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	90.2	1.2e-142
WP_024007929.1|5781763_5782516_-	hypothetical protein	NA	A0A059VF66	Pseudomonas_phage	56.4	6.8e-68
WP_023099006.1|5782591_5782903_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	50.6	1.8e-14
WP_031759128.1|5782905_5783103_-	hypothetical protein	NA	A0A1B0Z2M2	Pseudomonas_phage	86.2	1.6e-24
WP_023110769.1|5783192_5783858_+	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	40.6	7.9e-44
>prophage 11
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	5787120	5803700	7021552	integrase	Pseudomonas_phage(63.64%)	25	5788548:5788563	5805553:5805568
WP_063456188.1|5787120_5787612_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	85.1	6.6e-72
WP_031278257.1|5787710_5787920_+	DUF551 domain-containing protein	NA	B5WZX3	Pseudomonas_phage	84.1	1.8e-31
WP_023980911.1|5787936_5788221_+	hypothetical protein	NA	B5WZX2	Pseudomonas_phage	35.3	6.6e-08
WP_023980910.1|5788253_5788580_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
5788548:5788563	attL	TGGCAGCCGCTACCAG	NA	NA	NA	NA
WP_023980909.1|5788723_5788948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071557630.1|5789243_5789720_+	DUF2591 family protein	NA	A0A2H4J8F6	uncultured_Caudovirales_phage	33.5	2.0e-12
WP_034063452.1|5789758_5790124_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	95.9	1.3e-64
WP_052155940.1|5790120_5790636_+	hypothetical protein	NA	A0A0S2SY59	Pseudomonas_phage	45.4	3.8e-30
WP_034063451.1|5790632_5791022_+	hypothetical protein	NA	A0A125RNR7	Pseudomonas_phage	99.2	1.1e-69
WP_071557631.1|5791141_5791819_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	72.0	8.8e-91
WP_033989636.1|5792122_5792413_+	hypothetical protein	NA	U6C867	Ralstonia_phage	36.3	1.8e-05
WP_023102230.1|5792475_5793237_+	ERF family protein	NA	A0A1B0VMB2	Pseudomonas_phage	44.4	1.2e-35
WP_023102231.1|5793233_5793878_+	hypothetical protein	NA	F8TUK8	EBPR_podovirus	35.5	1.0e-24
WP_058127830.1|5793874_5794210_+	LytTR family transcriptional regulator	NA	Q9MC72	Pseudomonas_phage	82.0	6.1e-45
WP_071535181.1|5794573_5794780_+	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	82.6	2.3e-26
WP_154021682.1|5794776_5797347_+	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	50.5	9.3e-141
WP_063456190.1|5797339_5797768_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	91.1	9.3e-22
WP_031629755.1|5797764_5798148_+	HNH endonuclease	NA	A0A0U4IIE4	Pseudomonas_phage	98.8	2.2e-46
WP_031278131.1|5798455_5798743_+	hypothetical protein	NA	Q9MC81	Pseudomonas_phage	71.8	5.4e-34
WP_023835944.1|5798743_5798926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023980869.1|5799221_5799575_+	hypothetical protein	NA	A0A0S2SY48	Pseudomonas_phage	56.7	3.0e-18
WP_034063269.1|5800002_5800242_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	65.0	1.3e-17
WP_023835949.1|5800238_5800583_+	hypothetical protein	NA	B5WZV0	Pseudomonas_phage	61.1	1.8e-12
WP_023980871.1|5800862_5802080_+|integrase	site-specific integrase	integrase	A0A125RNP5	Pseudomonas_phage	99.0	5.0e-230
WP_003111315.1|5802110_5803700_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
5805553:5805568	attR	TGGCAGCCGCTACCAG	NA	NA	NA	NA
>prophage 12
NZ_CP015377	Pseudomonas aeruginosa strain BAMCPA07-48, complete genome	7021552	6022157	6074515	7021552	terminase,integrase,tRNA	Pseudomonas_phage(57.45%)	54	6005223:6005239	6069301:6069317
6005223:6005239	attL	TGGTGCGGACGGAGAGA	NA	NA	NA	NA
WP_023091950.1|6022157_6024050_-	hypothetical protein	NA	L7THA5	Pseudomonas_virus	98.8	1.0e-181
WP_004349225.1|6024049_6024655_-	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	100.0	2.2e-109
WP_004349223.1|6025205_6027713_-	hypothetical protein	NA	Q5QF48	Pseudomonas_virus	99.4	0.0e+00
WP_004349221.1|6027807_6028398_-	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	100.0	1.3e-101
WP_004349219.1|6028465_6029656_-	hypothetical protein	NA	A0A0U1UNT0	Pseudomonas_phage	100.0	7.4e-226
WP_004349217.1|6029655_6032619_-	hypothetical protein	NA	A0A0U1W084	Pseudomonas_phage	100.0	0.0e+00
WP_004349215.1|6032621_6033479_-	hypothetical protein	NA	Q5QF52	Pseudomonas_virus	100.0	1.2e-156
WP_023091954.1|6033797_6034193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349209.1|6034218_6034626_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_004349207.1|6034606_6034813_-	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_004349205.1|6034809_6035487_-	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	99.6	4.3e-130
WP_004349203.1|6035483_6036356_-	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.7	2.4e-165
WP_004349201.1|6036420_6036900_-	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	99.4	8.4e-80
WP_004349199.1|6036958_6038251_-	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
WP_063456221.1|6038263_6039394_-	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	97.9	2.2e-179
WP_023091956.1|6039555_6040467_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	96.0	3.6e-164
WP_004349195.1|6040545_6042867_-	hypothetical protein	NA	L7TJP4	Pseudomonas_virus	99.0	0.0e+00
WP_023082374.1|6042876_6044160_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	1.2e-258
WP_004349191.1|6044156_6044723_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	4.2e-94
WP_023980885.1|6044875_6045100_+	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	98.6	2.7e-33
WP_004349189.1|6045102_6045597_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	3.2e-82
WP_023082373.1|6045675_6046290_-	hypothetical protein	NA	A0A0U1VZM0	Pseudomonas_phage	98.5	9.0e-111
WP_004349186.1|6046345_6046897_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	98.9	4.9e-100
WP_004349183.1|6046889_6047747_-	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	99.3	1.4e-146
WP_004349179.1|6048780_6048981_-	Cro/Cl family transcriptional regulator	NA	A0A2K8HL98	Pseudomonas_phage	100.0	1.8e-28
WP_004349176.1|6049088_6049886_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	99.6	5.4e-148
WP_004349174.1|6049922_6050189_-	DUF1654 domain-containing protein	NA	A0A2K8HZW3	Pseudomonas_phage	100.0	2.3e-42
WP_004349170.1|6050823_6051030_+	hypothetical protein	NA	Q5QF70	Pseudomonas_virus	97.1	3.3e-33
WP_004349169.1|6051094_6051307_+	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	94.3	4.9e-32
WP_004349168.1|6051341_6051713_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	77.2	2.9e-48
WP_034058628.1|6051769_6052339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023091958.1|6052607_6052829_+	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	95.9	7.1e-34
WP_023091959.1|6052825_6053197_+	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	98.4	1.3e-59
WP_063456193.1|6053467_6054151_+	hypothetical protein	NA	A0A1Y0T023	Pseudomonas_phage	54.3	1.2e-31
WP_023091961.1|6054161_6055799_+	hypothetical protein	NA	A0A2H4J6F0	uncultured_Caudovirales_phage	63.1	5.5e-139
WP_004349164.1|6055920_6056526_+	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	100.0	7.3e-113
WP_023091962.1|6056529_6057027_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	98.8	4.9e-91
WP_023091963.1|6057053_6058274_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	97.7	1.7e-161
WP_004355019.1|6058379_6058694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124117754.1|6058983_6059310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349415.1|6059426_6060227_+	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	47.4	8.6e-45
WP_023980880.1|6060226_6061996_+	DNA methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	94.0	1.5e-286
WP_023091964.1|6062177_6063242_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003451766.1|6063245_6063569_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_023091965.1|6064235_6064610_+	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	96.8	2.2e-67
WP_004349158.1|6064804_6065311_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	94.6	1.8e-85
WP_004349157.1|6065408_6066083_+	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	88.4	2.6e-26
WP_004349155.1|6067163_6067397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349153.1|6067667_6067901_+	AlpA family phage regulatory protein	NA	A0A0U1W0F1	Pseudomonas_phage	100.0	2.4e-40
WP_004349150.1|6067901_6069137_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	98.8	8.4e-233
WP_003087898.1|6069921_6070776_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
6069301:6069317	attR	TGGTGCGGACGGAGAGA	NA	NA	NA	NA
WP_003120296.1|6070832_6072215_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_003139945.1|6072224_6073895_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.3	4.8e-199
WP_003087890.1|6074017_6074515_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
