The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	511274	531185	4692801	holin,tail,plate	Clostridium_phage(47.37%)	25	NA	NA
WP_139015319.1|511274_511817_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.6	1.0e-28
WP_012293465.1|511891_512248_-	helix-turn-helix domain-containing protein	NA	S5MUA5	Brevibacillus_phage	36.6	2.0e-06
WP_099805129.1|512432_512702_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012293467.1|513028_514057_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	46.8	1.8e-50
WP_012293468.1|514335_514668_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	33.9	5.2e-12
WP_012293469.1|515464_515923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015320.1|515894_516107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293471.1|516108_517431_+	hypothetical protein	NA	X5JAJ1	Clostridium_phage	51.6	2.5e-126
WP_012293472.1|517446_517962_+|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	58.4	4.5e-47
WP_012293473.1|518022_518457_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	45.9	5.7e-27
WP_008174525.1|518486_518651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293474.1|518865_520788_+	hypothetical protein	NA	A0A0A8WJT6	Clostridium_phage	23.8	3.7e-17
WP_036161043.1|520780_521464_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WFE5	Clostridium_phage	47.9	4.9e-41
WP_139015321.1|521456_522419_+	hydrolase	NA	H7BVH4	unidentified_phage	50.6	3.8e-87
WP_012293477.1|522420_522735_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	30.8	3.9e-09
WP_012293478.1|522734_523139_+	DUF2634 domain-containing protein	NA	A0A0A8WFW6	Clostridium_phage	52.8	4.7e-31
WP_012293479.1|523138_524224_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WJT7	Clostridium_phage	48.4	1.4e-85
WP_012293480.1|524216_524765_+	DUF2313 domain-containing protein	NA	A0A0A8WII4	Clostridium_phage	32.9	2.6e-16
WP_012293481.1|524764_526390_+	hypothetical protein	NA	S6B1J7	Thermus_phage	50.7	1.2e-24
WP_012293482.1|526403_526823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563194.1|526997_527303_+	hypothetical protein	NA	A0A0H3UZE6	Geobacillus_virus	38.6	1.3e-09
WP_012293484.1|527315_527582_+|holin	holin	holin	A0A2H4JAH4	uncultured_Caudovirales_phage	53.6	4.0e-15
WP_012293485.1|527578_528301_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	49.1	2.9e-44
WP_012293486.1|528730_530143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293487.1|530357_531185_+	M23 family metallopeptidase	NA	D6QWN5	uncultured_phage	38.4	4.3e-15
>prophage 2
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	1431780	1481807	4692801	transposase,integrase,protease,tRNA	Paenibacillus_phage(16.67%)	44	1424508:1424524	1482566:1482582
1424508:1424524	attL	AAAAATCCTCTACCCAA	NA	NA	NA	NA
WP_012294431.1|1431780_1432404_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_036161646.1|1432722_1433145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294433.1|1433452_1434415_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.0	4.7e-13
WP_012294434.1|1434491_1435124_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155729467.1|1435183_1435429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081112813.1|1435340_1435712_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012294436.1|1435715_1436042_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	62.3	3.0e-28
WP_012294437.1|1436007_1436151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012294438.1|1436254_1436911_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080695198.1|1438560_1439001_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_012294440.1|1439499_1440480_+	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	28.0	7.6e-19
WP_012294441.1|1440640_1440970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563241.1|1440994_1441327_+	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_036161659.1|1442357_1442795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012294444.1|1442791_1443973_+	glucosyltransferase	NA	Q6QXI9	Agrotis_segetum_granulosis_virus	27.0	9.5e-08
WP_031415857.1|1444879_1445902_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	26.3	1.3e-16
WP_036161662.1|1446191_1447118_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012294449.1|1447732_1449232_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	9.9e-10
WP_139015334.1|1450275_1451424_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012294451.1|1451622_1451763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294452.1|1452353_1454240_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012294454.1|1454681_1456355_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.5	1.4e-73
WP_036161666.1|1456455_1457631_+	MFS transporter	NA	NA	NA	NA	NA
WP_012294457.1|1457887_1458988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036161669.1|1458995_1460768_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	3.5e-70
WP_012294459.1|1460845_1461367_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012294460.1|1461543_1462494_+	LCP family protein	NA	NA	NA	NA	NA
WP_012294461.1|1462558_1463758_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012294462.1|1464236_1465412_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012294463.1|1465723_1466539_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_031415877.1|1466789_1467110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294465.1|1467368_1468163_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012294466.1|1468524_1469400_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012294467.1|1469452_1470307_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_080695199.1|1470368_1471334_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_012294469.1|1471287_1472775_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_036161672.1|1472853_1473267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294471.1|1473606_1474569_+	tyrosine recombinase XerC	NA	A0A160DCT0	Gordonia_phage	29.6	8.5e-15
WP_012294472.1|1474622_1475120_+	DinB family protein	NA	NA	NA	NA	NA
WP_004230023.1|1475714_1475864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294474.1|1476067_1476238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294475.1|1476615_1478337_+	phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	2.6e-14
WP_036161675.1|1478669_1480106_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	38.8	4.9e-99
WP_012294477.1|1480637_1481807_-|transposase	transposase	transposase	D2XQ03	Bacillus_virus	49.7	1.8e-96
1482566:1482582	attR	TTGGGTAGAGGATTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	1692066	1698078	4692801		Pneumococcus_phage(50.0%)	6	NA	NA
WP_012294683.1|1692066_1692606_-	hypothetical protein	NA	E7DND6	Pneumococcus_phage	27.0	1.0e-04
WP_036161829.1|1692651_1693380_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	43.4	4.7e-50
WP_012294685.1|1693372_1693846_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	72.2	3.3e-60
WP_012294686.1|1693848_1694508_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.3	6.6e-67
WP_031418567.1|1694627_1695128_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.1	4.4e-47
WP_012294688.1|1695723_1698078_+	peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.0	6.4e-72
>prophage 4
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	2264392	2337771	4692801	transposase,integrase,plate,protease,portal,head,tRNA,holin,tail,capsid,terminase,coat	Vibrio_phage(18.92%)	89	2303248:2303270	2328270:2328292
WP_080695219.1|2264392_2264635_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	62.9	9.0e-14
WP_012295236.1|2264761_2264986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295237.1|2265001_2266123_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_031417022.1|2266123_2266816_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_012295240.1|2266980_2267340_-	cytochrome c	NA	NA	NA	NA	NA
WP_036162150.1|2267653_2268217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295242.1|2268449_2269577_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
WP_012295243.1|2269609_2271442_-	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	34.8	6.6e-48
WP_008178459.1|2271649_2272462_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_008178461.1|2272479_2273112_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012295244.1|2273791_2275177_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	31.1	2.2e-48
WP_031417025.1|2275227_2276946_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_036162156.1|2277695_2279099_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_036162158.1|2279123_2279912_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_036162160.1|2280103_2281021_-	GTPase Era	NA	NA	NA	NA	NA
WP_008179431.1|2281007_2281421_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_012295251.1|2281486_2281837_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_012295252.1|2281837_2282311_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012295253.1|2282319_2284440_-	HD family phosphohydrolase	NA	NA	NA	NA	NA
WP_031417032.1|2284663_2285620_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.9	3.2e-46
WP_012295255.1|2285622_2286735_-	stage IV sporulation protein	NA	NA	NA	NA	NA
WP_012295256.1|2286736_2286985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295257.1|2287040_2287520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008179446.1|2287545_2288550_-	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_031417037.1|2288553_2289882_-	membrane protein	NA	NA	NA	NA	NA
WP_004227078.1|2290183_2290357_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_036162163.1|2290866_2292204_+	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_012295261.1|2292230_2292887_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_031417041.1|2292934_2293504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295262.1|2293528_2293792_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_036162165.1|2293788_2294013_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_012295263.1|2294139_2294811_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_012295264.1|2295335_2295875_-	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	67.9	2.0e-21
WP_051563278.1|2295875_2296475_-	hypothetical protein	NA	A0A1S5QTS6	Bacillus_phage	48.7	2.0e-46
WP_036162167.1|2296416_2297712_-	cell division protein FtsK	NA	A0A2H4J9G1	uncultured_Caudovirales_phage	57.5	4.7e-133
WP_036162170.1|2298094_2298988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012295268.1|2299161_2299365_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	45.5	8.6e-10
WP_012295269.1|2299473_2299944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036162175.1|2300049_2300388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036162852.1|2300381_2300606_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080695220.1|2300748_2301444_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	50.3	1.1e-43
WP_012295273.1|2301440_2301830_-|holin	holin	holin	Q8SBN5	Clostridium_phage	52.1	2.9e-22
WP_012295274.1|2301882_2303139_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	60.5	2.4e-134
2303248:2303270	attL	TTCAAATTCCCAAGCGTTTGGGA	NA	NA	NA	NA
WP_012295275.1|2303417_2303858_-	hypothetical protein	NA	S5MUI6	Brevibacillus_phage	29.7	3.0e-07
WP_012295276.1|2303876_2305211_-|tail	phage tail protein	tail	A0A2H4J194	uncultured_Caudovirales_phage	53.4	1.0e-42
WP_012295277.1|2305212_2305860_-|tail	phage tail protein I	tail	A0A059WLJ8	Vibrio_phage	31.1	5.0e-19
WP_012295278.1|2305852_2306983_-|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	38.8	2.4e-69
WP_036162860.1|2306972_2307257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051563280.1|2307275_2307950_-	SH3 domain-containing protein	NA	A0A067ZI88	Vibrio_phage	40.9	3.6e-20
WP_012295281.1|2307960_2308152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295282.1|2308151_2309168_-	bacteriophage regulatory protein	NA	A0A0C5AJ59	Bacteriophage	33.3	4.2e-44
WP_036162178.1|2309164_2309380_-	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	37.5	6.1e-06
WP_051563282.1|2309372_2312324_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	62.4	1.7e-98
WP_012295285.1|2312323_2312479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295286.1|2312472_2312871_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012295287.1|2312898_2313420_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	33.5	3.8e-25
WP_036162181.1|2313437_2314868_-	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	41.5	2.0e-100
WP_012295288.1|2314869_2315175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295289.1|2315164_2315656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295290.1|2315655_2316207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295291.1|2316219_2316552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295292.1|2316544_2316910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295293.1|2316921_2317947_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	38.1	1.1e-57
WP_012295294.1|2317950_2318316_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012295295.1|2318316_2319384_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	49.0	1.8e-45
WP_012295296.1|2319370_2320948_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	58.3	2.4e-155
WP_036162184.1|2320963_2321197_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	49.4	1.1e-13
WP_036162186.1|2321172_2323008_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.6	3.5e-174
WP_012295298.1|2322967_2323546_-	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	28.0	4.2e-09
WP_012295299.1|2323695_2323890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295301.1|2324284_2324866_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.1	5.6e-46
WP_012295302.1|2324862_2325330_-	hypothetical protein	NA	A0A1B1P7B2	Bacillus_phage	36.2	5.4e-15
WP_012295303.1|2325335_2325671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295304.1|2325765_2325924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295306.1|2326306_2327026_-	hypothetical protein	NA	A0A068EMK6	Bacillus_phage	30.7	3.9e-20
WP_012295307.1|2327100_2327469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295308.1|2327458_2327665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295309.1|2327664_2328522_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	45.6	3.3e-18
2328270:2328292	attR	TCCCAAACGCTTGGGAATTTGAA	NA	NA	NA	NA
WP_012295310.1|2328518_2330060_-	hypothetical protein	NA	A0A0E3XCJ0	Enterococcus_phage	32.8	6.4e-12
WP_051563285.1|2330072_2330546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295313.1|2330520_2331453_-	hypothetical protein	NA	Q0SPI6	Clostridium_phage	37.9	1.0e-33
WP_012295314.1|2331740_2332091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295315.1|2332084_2332258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155726286.1|2332512_2332668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051563287.1|2332854_2333220_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	43.4	1.2e-17
WP_036162189.1|2333265_2333628_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	33.0	8.2e-11
WP_036162191.1|2333635_2333815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015344.1|2334304_2336218_+	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	49.7	1.0e-144
WP_036162193.1|2336421_2337771_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	2775545	2784881	4692801	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_036162332.1|2775545_2776727_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.6	2.5e-08
WP_012295731.1|2776871_2779289_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.8	0.0e+00
WP_031416439.1|2779650_2781393_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	5.8e-46
WP_012295733.1|2781450_2781798_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036162335.1|2781944_2783123_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	49.2	5.8e-106
WP_031416441.1|2783349_2784306_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	5.1e-60
WP_012295735.1|2784302_2784881_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	49.5	2.9e-42
>prophage 6
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	3244323	3252735	4692801		Synechococcus_phage(33.33%)	8	NA	NA
WP_012292017.1|3244323_3244893_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	1.3e-23
WP_012292016.1|3244892_3245948_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.7	8.6e-61
WP_012292015.1|3246041_3247466_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.4e-52
WP_012292014.1|3247441_3249676_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.4e-156
WP_012292013.1|3249662_3250346_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012292012.1|3250348_3250597_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012292011.1|3250599_3251310_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	41.0	3.4e-45
WP_012292010.1|3251439_3252735_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	4.7e-16
>prophage 7
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	3274617	3282085	4692801		Bacillus_virus(33.33%)	8	NA	NA
WP_012291991.1|3274617_3275442_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.8e-72
WP_036160402.1|3275460_3276921_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.7	5.0e-115
WP_012291989.1|3277233_3277575_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012291988.1|3277588_3278890_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.5	1.8e-68
WP_012291987.1|3278956_3279457_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.6	3.2e-21
WP_012291986.1|3279556_3280288_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.1e-17
WP_012291985.1|3280284_3281037_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_012291984.1|3281110_3282085_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	51.1	1.1e-86
>prophage 8
NZ_CP015224	Lysinibacillus sphaericus strain 2362 chromosome, complete genome	4692801	4414798	4476116	4692801	transposase,integrase	Bacillus_phage(54.55%)	39	4418758:4418816	4486032:4486090
WP_139015310.1|4414798_4416150_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	81.8	1.9e-124
WP_036160752.1|4417678_4422550_+	DNRLRE domain-containing protein	NA	I1TLF2	Bacillus_phage	26.6	3.4e-11
4418758:4418816	attL	TATTATGTCTGCGGATGTAAGTCTTTATCTATCTTCAACTAATGATCCAACTCCTATTA	NA	NA	NA	NA
WP_012292799.1|4424649_4426887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292800.1|4427893_4428094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160760.1|4428090_4428321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160763.1|4428856_4429222_+	hypothetical protein	NA	I1TLF2	Bacillus_phage	45.1	2.3e-05
WP_012292803.1|4429208_4430684_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_012292804.1|4430686_4433674_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292805.1|4433686_4434055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292806.1|4434743_4434998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080695165.1|4435082_4435586_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292809.1|4435763_4436378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015351.1|4436942_4437368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292811.1|4437495_4437972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155729475.1|4438706_4438937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015311.1|4440430_4440748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015312.1|4441096_4441291_+	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	67.3	2.3e-12
WP_080695166.1|4441242_4441503_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	65.4	2.0e-11
WP_012292817.1|4441544_4441952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015313.1|4444230_4445109_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_012292822.1|4445647_4446109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155729476.1|4447983_4448589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160771.1|4449175_4451788_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	35.9	2.5e-133
WP_051563177.1|4451972_4454312_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	4.3e-20
WP_012292827.1|4454994_4456428_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_012292828.1|4457669_4458542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160774.1|4458869_4459304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080695167.1|4459443_4459542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292831.1|4460409_4462143_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012292832.1|4462836_4463580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160776.1|4464208_4464529_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_012292834.1|4464576_4464987_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_139015314.1|4465793_4466204_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_036160781.1|4466625_4467753_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_012292837.1|4467782_4469183_-	spore germination protein	NA	NA	NA	NA	NA
WP_036160788.1|4471625_4472519_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.7	1.4e-19
WP_012292840.1|4472524_4473358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.5	3.0e-16
WP_080695238.1|4474299_4475274_+|integrase	tyrosine-type recombinase/integrase	integrase	W5RV39	Staphylococcus_phage	25.5	1.0e-07
WP_036160791.1|4475279_4476116_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.3	2.3e-24
4486032:4486090	attR	TATTATGTCTGCGGATGTAAGTCTTTATCTATCTTCAACTAATGATCCAACTCCTATTA	NA	NA	NA	NA
