The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	377339	392349	2799488		Aeromonas_phage(45.45%)	18	NA	NA
WP_063353456.1|377339_377804_+	hypothetical protein	NA	F8TUR4	EBPR_podovirus	41.4	1.4e-18
WP_063353457.1|377784_379269_+	hypothetical protein	NA	A0A1Y0T3N1	Sinorhizobium_phage	39.8	5.4e-77
WP_063353458.1|379268_380759_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.0	2.4e-104
WP_082823104.1|380755_381586_+	hypothetical protein	NA	H9C0V1	Aeromonas_phage	37.3	1.6e-46
WP_063353459.1|383028_383529_+	hypothetical protein	NA	A0A220NQI9	Acinetobacter_phage	45.1	2.0e-28
WP_063353460.1|383528_384569_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.0	4.1e-79
WP_063353461.1|384572_384911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353462.1|384920_385337_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	42.2	1.1e-14
WP_082823105.1|385327_385906_+	hypothetical protein	NA	A0A2H4P6T2	Pseudomonas_phage	45.6	1.2e-24
WP_082823106.1|385905_386304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353463.1|386240_386804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353464.1|386800_387958_+	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	36.4	1.8e-35
WP_063353465.1|387960_388398_+	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	38.4	1.3e-10
WP_157884473.1|389005_389173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167348728.1|389263_389410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157884474.1|389429_389642_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_157884475.1|389725_389929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157884476.1|390354_392349_+	hypothetical protein	NA	H9C0W9	Aeromonas_phage	29.0	9.7e-21
>prophage 2
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	398131	407266	2799488		Acinetobacter_phage(25.0%)	9	NA	NA
WP_157884483.1|398131_398863_+	hypothetical protein	NA	A0A220NQH2	Acinetobacter_phage	26.8	5.3e-09
WP_063353477.1|398862_399171_+	hypothetical protein	NA	K4I3B0	Acinetobacter_phage	38.5	1.7e-09
WP_157884484.1|399163_400129_+	hypothetical protein	NA	H9C0X5	Aeromonas_phage	24.3	2.8e-13
WP_063353478.1|400145_400745_+	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	41.0	1.4e-28
WP_063353479.1|400840_401197_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	36.0	2.3e-13
WP_082823109.1|401123_402407_+	hypothetical protein	NA	H9C0X9	Aeromonas_phage	40.1	4.9e-66
WP_063353481.1|402408_402984_+	DUF2612 domain-containing protein	NA	Q2NPA3	Xanthomonas_phage	39.9	9.6e-30
WP_063353482.1|402983_404225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157884485.1|404761_407266_+	hypothetical protein	NA	A0A166Y926	Gordonia_phage	39.8	2.4e-08
>prophage 3
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	437141	452526	2799488	tail,transposase	Stx2-converting_phage(25.0%)	17	NA	NA
WP_063353329.1|437141_438752_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.6	9.6e-112
WP_020944072.1|438815_439163_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_063353330.1|439159_439519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063353501.1|441139_441865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353502.1|441871_442960_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_006116898.1|442959_443367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157884486.1|443321_444764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353503.1|444813_445320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353504.1|445316_445748_+	cell wall hydrolase	NA	W6MVH4	Pseudomonas_phage	47.2	2.5e-22
WP_063353505.1|445904_446273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353506.1|446269_446650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353507.1|446651_446852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353508.1|446906_447671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063353509.1|448066_448279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|448941_450192_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_157884487.1|450383_451146_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.6	1.2e-11
WP_012812328.1|451275_452526_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	601870	620460	2799488	terminase,portal,capsid,head,tail,integrase	Rhodobacter_phage(22.22%)	31	599822:599836	622718:622732
599822:599836	attL	AATATCTGTGGCGGA	NA	NA	NA	NA
WP_063353588.1|601870_602545_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_063353589.1|602584_602833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063353590.1|602834_604184_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	36.5	1.4e-63
WP_063353591.1|604184_605144_-	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	47.6	2.4e-65
WP_063353592.1|605145_606423_-|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	49.8	5.5e-110
WP_063353593.1|606425_608150_-|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	51.3	4.0e-156
WP_063353594.1|608152_608614_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXG3	Streptococcus_phage	32.9	4.7e-19
WP_082823115.1|608814_609135_-	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	31.6	3.5e-05
WP_063353596.1|609205_609688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162269448.1|609684_610587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063353598.1|610625_610913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063353599.1|610909_612439_-	hypothetical protein	NA	O80281	Escherichia_phage	29.9	6.3e-44
WP_063353600.1|612431_612878_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_063353601.1|612870_613119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063353602.1|613299_613779_-	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	35.9	2.5e-07
WP_035351168.1|613876_614119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353603.1|614092_614617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116100194.1|614613_614940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064776463.1|614936_615188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819274.1|615272_615914_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157884490.1|615918_616179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353604.1|616393_616909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353605.1|617261_617474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035353160.1|617470_617767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353606.1|617742_618090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353607.1|618086_618326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353608.1|618322_618607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353609.1|618603_618789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353610.1|618785_619151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353611.1|619147_619405_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_082823116.1|619404_620460_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	34.2	6.0e-46
622718:622732	attR	TCCGCCACAGATATT	NA	NA	NA	NA
>prophage 5
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	655400	675658	2799488	terminase	Aeromonas_phage(40.0%)	27	NA	NA
WP_063353633.1|655400_656855_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	46.0	5.5e-106
WP_035354328.1|656851_657904_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_082823118.1|657918_658137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063354856.1|658150_659527_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.0	4.5e-86
WP_063353634.1|659528_660530_+	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	36.4	9.8e-30
WP_063353635.1|660568_661069_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	48.1	1.5e-31
WP_035354206.1|661068_662106_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.7	6.9e-79
WP_063353636.1|662152_662470_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.4	2.7e-10
WP_063353637.1|662506_663013_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	44.0	1.9e-13
WP_063353638.1|663003_663384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353639.1|663344_663917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353640.1|663935_665090_+	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	34.2	4.3e-29
WP_006117079.1|665092_665530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353641.1|665569_666025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162269444.1|666060_666210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353642.1|666194_667232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353643.1|667267_667981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353644.1|667977_668298_+	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	36.2	6.3e-07
WP_063353645.1|668294_669221_+	hypothetical protein	NA	Q2NP99	Xanthomonas_phage	30.0	9.1e-14
WP_063353646.1|669217_669907_+	hypothetical protein	NA	H9C0X6	Aeromonas_phage	48.3	2.2e-36
WP_006117087.1|669918_670272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353647.1|670258_671494_+	hypothetical protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	38.5	9.5e-59
WP_063353648.1|671493_672072_+	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	38.6	1.3e-29
WP_035354193.1|672079_673177_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	33.8	3.8e-11
WP_063353649.1|673183_673753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035354323.1|673876_674323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035354190.1|674395_675658_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.7	1.2e-29
>prophage 6
NZ_CP011120	Acetobacter oryzifermentans strain SLV-7 chromosome, complete genome	2799488	1682922	1754758	2799488	holin,transposase	Burkholderia_phage(23.08%)	55	NA	NA
WP_063354180.1|1682922_1685412_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_063354181.1|1685980_1686760_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_063354182.1|1686788_1687406_-	DUF1442 domain-containing protein	NA	NA	NA	NA	NA
WP_063354183.1|1687435_1688026_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063354184.1|1688327_1690688_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_063354185.1|1690861_1692442_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_063354186.1|1692813_1693335_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_035350979.1|1693627_1695904_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_035351000.1|1696103_1696916_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_063354187.1|1697247_1698588_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_063354188.1|1698931_1699126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354189.1|1699139_1700279_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_063354190.1|1700293_1701907_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_063354191.1|1701971_1703663_-	thiol reductant ABC exporter subunit CydC	NA	A0A285PWH2	Cedratvirus	30.1	1.1e-12
WP_063354192.1|1703659_1705354_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	32.8	3.2e-25
WP_063354193.1|1705885_1706575_-	Fe2+-dependent dioxygenase	NA	A0A0E3FJG1	Synechococcus_phage	32.5	1.7e-12
WP_063354194.1|1706678_1709117_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_063354195.1|1709266_1709962_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006117246.1|1710292_1711282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354196.1|1711313_1712414_-	asparaginase	NA	NA	NA	NA	NA
WP_063354197.1|1712530_1714120_-	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_063354198.1|1714145_1715837_-	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_157884508.1|1716538_1716715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063354199.1|1717033_1717312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157884509.1|1717627_1718382_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.9	6.5e-26
WP_063354201.1|1718634_1720257_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	3.9e-60
WP_063354203.1|1720952_1723466_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	40.6	1.7e-17
WP_063354204.1|1723566_1724637_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.5	3.0e-77
WP_157884487.1|1724949_1725712_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.6	1.2e-11
WP_063354205.1|1725792_1726257_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_063354206.1|1727045_1728401_-	MFS transporter	NA	NA	NA	NA	NA
WP_035352011.1|1728685_1729078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354207.1|1729792_1730866_+	alkene reductase	NA	NA	NA	NA	NA
WP_063354208.1|1730883_1731885_-	CRISPR-associated endonuclease Cas3''	NA	NA	NA	NA	NA
WP_082823235.1|1732190_1732460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354927.1|1732498_1732855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354209.1|1732896_1733991_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_063354210.1|1734907_1735891_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_063354211.1|1735918_1736950_+	methionine synthase	NA	NA	NA	NA	NA
WP_157884510.1|1736969_1737458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063354212.1|1737654_1738314_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_063354213.1|1738225_1739278_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_063354214.1|1739504_1740398_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082823170.1|1740837_1741176_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_063354215.1|1741259_1742162_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063354216.1|1742254_1743460_-	MFS transporter	NA	NA	NA	NA	NA
WP_157884511.1|1744492_1745703_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	62.3	2.3e-94
WP_063354219.1|1746195_1746597_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	59.8	7.1e-40
WP_082823171.1|1746593_1747526_-	DUF4928 family protein	NA	NA	NA	NA	NA
WP_063354220.1|1747522_1748386_-	hypothetical protein	NA	I6NTM1	Burkholderia_phage	58.8	5.4e-93
WP_063354221.1|1748382_1749531_-	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	65.6	1.6e-145
WP_157884512.1|1749893_1752299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082823236.1|1752316_1753084_-	multidrug transporter	NA	NA	NA	NA	NA
WP_063354131.1|1753075_1753489_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	50.5	2.2e-20
WP_010511145.1|1753726_1754758_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP011121	Acetobacter oryzifermentans strain SLV-7 plasmid unnamed1, complete sequence	165374	2036	119132	165374	transposase,integrase	uncultured_Caudovirales_phage(37.5%)	106	16674:16690	119161:119188
WP_006115564.1|2036_3116_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_006115565.1|3552_3972_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006115566.1|3937_4429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039891567.1|4428_5472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035350857.1|5703_6663_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_006115571.1|6981_7620_+	HPP family protein	NA	NA	NA	NA	NA
WP_082823244.1|7653_8118_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006115867.1|8316_8895_-	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	40.0	5.1e-23
WP_010512346.1|8930_9146_+	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_063354992.1|9159_9432_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_003631279.1|9428_9818_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010512344.1|9879_10245_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_063354993.1|10251_12576_-	nitric oxide reductase	NA	NA	NA	NA	NA
WP_006117537.1|12667_13984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026019419.1|14072_14525_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_035366749.1|14526_15018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364821.1|16267_17477_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	5.0e-97
16674:16690	attL	TGCAACTGTTGCCAGAC	NA	NA	NA	NA
WP_039892090.1|18417_19410_-	TonB family protein	NA	NA	NA	NA	NA
16674:16690	attL	TGCAACTGTTGCCAGAC	NA	NA	NA	NA
WP_006117544.1|19507_19687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117545.1|19738_20269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117546.1|20345_22568_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_019088957.1|23334_23634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117547.1|23620_24823_+	porin	NA	NA	NA	NA	NA
WP_167348742.1|24954_25710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063354995.1|25726_25999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096884248.1|25988_27198_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	6.6e-97
WP_063354997.1|27293_28814_-	MFS transporter	NA	NA	NA	NA	NA
WP_012813226.1|29017_29896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082823246.1|29899_30523_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063354999.1|30958_32380_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_045543339.1|32720_33203_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_063355000.1|33227_34202_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_063355001.1|34198_35308_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_063355002.1|35304_35868_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063355027.1|35867_36836_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_063355003.1|36832_38011_+	MSMEG_0565 family glycosyltransferase	NA	NA	NA	NA	NA
WP_020936672.1|37998_38286_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_035366434.1|38302_39550_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063355004.1|39564_41337_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	20.7	1.7e-08
WP_063355005.1|41377_42139_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_114012474.1|43060_44148_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.2e-43
WP_012813198.1|44297_44660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003618686.1|44873_45134_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003618711.1|45130_45424_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	2.1e-17
WP_006117365.1|45609_46143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117366.1|46212_47970_-	oleate hydratase	NA	NA	NA	NA	NA
WP_097802310.1|49788_50912_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.5	4.6e-52
WP_006115870.1|51961_53347_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.5e-31
WP_063355028.1|53512_53785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006115745.1|54187_55678_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006115744.1|56169_57093_+	Plasmid Encoded RepA protein	NA	NA	NA	NA	NA
WP_019088965.1|57823_58522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081461418.1|58518_59154_-	ParA family protein	NA	W0LIU2	Mycobacterium_phage	30.9	2.7e-09
WP_006115743.1|59608_64735_+	DEAD/DEAH box helicase family protein	NA	I6WLR1	Burkholderia_virus	39.8	0.0e+00
WP_010511145.1|66187_67219_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
66278:66294	attR	TGCAACTGTTGCCAGAC	NA	NA	NA	NA
WP_100070283.1|67237_68296_+	methionine synthase	NA	NA	NA	NA	NA
66278:66294	attR	TGCAACTGTTGCCAGAC	NA	NA	NA	NA
WP_052583250.1|68405_69332_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087651418.1|69392_70146_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_006115735.1|70289_70586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813272.1|70582_70924_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012813273.1|71237_72317_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	56.2	5.3e-82
WP_012813274.1|72325_73024_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.7	4.1e-83
WP_063355008.1|73047_74343_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.3	8.0e-133
WP_006115730.1|74342_74765_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_006115729.1|74761_75115_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006115727.1|75557_77171_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.8	2.5e-43
WP_012813241.1|77170_77572_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_006115724.1|77568_77889_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012812328.1|78358_79609_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_035350857.1|79807_80767_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003631146.1|81013_82405_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003631147.1|82489_83647_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_035350860.1|83734_84328_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082823247.1|85252_85669_+	DUF1348 family protein	NA	NA	NA	NA	NA
WP_011251546.1|86405_87587_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010512344.1|88534_88900_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_003631279.1|88961_89351_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_063354992.1|89347_89620_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_010512346.1|89633_89849_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_006115867.1|89884_90463_+	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	40.0	5.1e-23
WP_082823248.1|90661_91147_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063355009.1|91656_92919_-	sodium:proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	31.6	1.9e-14
WP_003618711.1|93050_93344_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	2.1e-17
WP_003618686.1|93340_93601_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012813331.1|94189_94993_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_063355011.1|94999_95827_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035366644.1|95878_96448_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063355029.1|97371_99027_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063355012.1|99029_99953_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_063355013.1|99945_100947_+	TniQ family protein	NA	NA	NA	NA	NA
WP_063355014.1|101267_102347_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.9	2.0e-81
WP_096884248.1|102534_103745_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	6.6e-97
WP_006115730.1|103909_104332_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_006115729.1|104328_104682_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167348743.1|105051_105210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010511145.1|105232_106264_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063355016.1|106726_109861_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	2.5e-63
WP_063355017.1|109860_110895_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_063355030.1|110891_112151_-	TolC family protein	NA	NA	NA	NA	NA
WP_007284432.1|112326_112977_-	cation transporter	NA	NA	NA	NA	NA
WP_063355018.1|113050_113449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063355031.1|113803_115468_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063355019.1|115470_116394_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_082823250.1|116386_117388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063355021.1|117692_117884_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096884248.1|117921_119132_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	6.6e-97
119161:119188	attR	GTCTCCACAAAACCCGGGGCAATTCAGT	NA	NA	NA	NA
>prophage 1
NZ_CP011122	Acetobacter oryzifermentans strain SLV-7 plasmid unnamed2, complete sequence	116245	1983	30342	116245	transposase,integrase	Stx2-converting_phage(33.33%)	24	15636:15651	31586:31601
WP_063355063.1|1983_3063_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063355036.1|3221_3821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063355037.1|3858_5385_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.3	2.7e-87
WP_063355038.1|5374_6508_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_063355039.1|6539_9836_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	2.7e-60
WP_063355040.1|9837_10575_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_063355041.1|10754_10943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157884545.1|11225_11675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063355043.1|11854_12133_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_063355044.1|12120_12450_+	DUF1870 family protein	NA	NA	NA	NA	NA
WP_063355045.1|12648_13728_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063355046.1|13818_14163_-	endoribonuclease MazF	NA	NA	NA	NA	NA
WP_063355047.1|14159_14402_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063355048.1|14618_14876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063355049.1|15013_16093_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
15636:15651	attL	TCGCCATCCCGTTCTT	NA	NA	NA	NA
WP_063355050.1|17375_18230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157884546.1|18400_20431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063353329.1|20656_22267_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.6	9.6e-112
WP_020944072.1|22330_22678_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	52.4	1.5e-25
WP_063353330.1|22674_23034_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	44.1	1.7e-05
WP_145912893.1|23695_24833_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.9e-53
WP_063355052.1|25549_27124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167348744.1|27653_28490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063355053.1|28833_30342_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
31586:31601	attR	TCGCCATCCCGTTCTT	NA	NA	NA	NA
