The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	1264934	1342107	4856440	transposase,portal,protease,integrase,holin,terminase,capsid,tail,head,lysis,tRNA	Salmonella_phage(33.33%)	89	1257015:1257031	1347954:1347970
1257015:1257031	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1264934_1265972_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1266087_1266777_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1267095_1267479_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1267540_1268128_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1268230_1269130_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1269147_1270482_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1270612_1271350_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1271334_1272957_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1273220_1273385_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1273381_1273957_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1273988_1274639_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1274638_1275595_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1275591_1276071_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007940.1|1276568_1277798_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.6	5.4e-232
WP_016716136.1|1277775_1278060_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	88.3	1.7e-43
WP_001237033.1|1278100_1278340_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_077906754.1|1278382_1279540_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	97.9	1.2e-212
WP_058685109.1|1279502_1282703_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	70.6	0.0e+00
WP_000551857.1|1282843_1283014_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_000373340.1|1283413_1283620_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1283727_1284813_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000169863.1|1284964_1285432_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000145711.1|1285445_1285673_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1285638_1286013_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1286104_1287010_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1287006_1287699_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1287713_1288379_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1288380_1288851_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1288853_1289507_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1289499_1289781_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_001217669.1|1290342_1290576_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1290692_1290941_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1290975_1291578_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096546.1|1291786_1292398_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_000801757.1|1292394_1292535_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1292531_1293209_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1293481_1294045_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1294551_1294740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1294954_1295641_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1295916_1296246_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1296229_1296682_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1296699_1297152_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1297387_1297789_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1298075_1298621_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1298592_1300524_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1300507_1300711_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1300707_1302288_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1302277_1303774_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1303786_1304134_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1304188_1305217_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1305274_1305634_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1305644_1306028_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1306055_1306634_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1306682_1307813_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1307921_1308323_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1308330_1309077_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1309127_1309523_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1309519_1309858_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1309829_1312925_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1312927_1313257_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1313266_1313965_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1313971_1314709_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1314606_1315254_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_050195757.1|1315315_1318678_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178849.1|1318716_1318959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144680.1|1319012_1321385_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	4.8e-91
WP_000593433.1|1321381_1322206_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1322195_1322774_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1322870_1323098_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1323204_1323417_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1324169_1324289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1325001_1325139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1325629_1327123_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1327527_1329327_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1329343_1330318_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1330591_1331272_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1331268_1332174_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1332185_1332914_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1332925_1333657_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1333656_1334037_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1334148_1334409_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1334446_1335373_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1335488_1336685_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1336706_1337624_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1337662_1338511_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1338626_1339520_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1339530_1340892_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1340895_1341531_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1341555_1342107_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1347954:1347970	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	1694824	1724415	4856440	tail,holin,protease	Salmonella_phage(45.45%)	30	NA	NA
WP_000781589.1|1694824_1695319_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1695732_1696224_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1696213_1696477_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1696473_1698960_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1698966_1699662_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1699648_1700518_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1700633_1701083_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1701092_1701695_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000990028.1|1702328_1702988_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1703039_1703777_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1703773_1703986_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1703982_1704462_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1704458_1706390_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1706386_1706944_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_020899389.1|1706940_1707984_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1708027_1708675_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1709404_1709968_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1710159_1710363_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1710665_1711457_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1711753_1711957_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001202279.1|1714819_1715809_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1715823_1716192_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1716220_1717552_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1717848_1718178_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1718770_1720012_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1720014_1720542_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1720919_1721363_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1721416_1723246_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1723593_1723884_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1723911_1724415_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	1796467	1805638	4856440	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1796467_1797415_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1797398_1798130_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1798110_1798218_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1798277_1799009_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1799231_1800917_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1800913_1801633_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1801679_1802147_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1802203_1802734_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1802905_1803364_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1803604_1805638_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	1874656	1885162	4856440		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1874656_1876060_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1876237_1877131_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1877507_1878593_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1878592_1879492_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1879539_1880418_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1880418_1880970_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1880975_1881968_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1881964_1882738_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1882742_1883822_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1883848_1885162_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	1974504	1981758	4856440		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|1974504_1974924_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1974926_1976195_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1976649_1976862_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1976872_1977061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1977321_1978518_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1979167_1979467_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1979558_1980254_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1980327_1981758_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	2085802	2092611	4856440	integrase,tail	Salmonella_phage(33.33%)	11	2088012:2088034	2097727:2097749
WP_000856224.1|2085802_2086033_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2086170_2086545_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2086545_2087421_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2087437_2087791_+	YebY family protein	NA	NA	NA	NA	NA
2088012:2088034	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2088164_2089019_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2089078_2089573_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2089762_2089993_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2090046_2090580_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2090836_2091004_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2091068_2091257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2091729_2092611_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2097727:2097749	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	2867126	2958042	4856440	protease,holin,terminase,tail,lysis,tRNA	Salmonella_phage(57.78%)	90	NA	NA
WP_000938191.1|2867126_2867807_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2868427_2869087_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2869173_2869503_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2869499_2869781_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2869829_2870609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2870634_2871183_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2871397_2872609_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2872666_2872984_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2873028_2873442_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2873615_2874278_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2874372_2874831_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2874866_2876921_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2877044_2877491_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2877509_2879663_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2879649_2880255_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2880471_2880981_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2881337_2882390_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2882461_2882914_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2883099_2884860_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2884928_2885447_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2885546_2885714_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2885969_2886533_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2886529_2888170_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2888174_2889428_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2889442_2891350_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_058685102.1|2891362_2893471_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2893569_2894679_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2894675_2895218_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2895383_2896394_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2896601_2899214_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2899640_2899832_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2900102_2900789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2900773_2901073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2901141_2901768_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2902415_2903384_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2903859_2904441_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2904440_2906879_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2906932_2907175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2907213_2908089_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2910635_2911340_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2911237_2911975_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2911984_2912680_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2912769_2913303_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2913419_2913917_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2914016_2914349_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2915469_2916015_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2916483_2916930_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2916947_2917400_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2917383_2917713_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2917988_2918675_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2919035_2919485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2919620_2919746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2919940_2920630_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2920626_2920767_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2920763_2921375_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2921583_2922186_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2922270_2922492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2922601_2922835_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2923426_2924023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2924034_2925012_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2925066_2925324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2925323_2925968_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2925971_2926280_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2926283_2926742_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2926738_2927086_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2927096_2927846_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2927848_2928832_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2928916_2929237_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2929271_2929499_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2929604_2930039_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2930335_2930467_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2930515_2930866_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_014344386.1|2934154_2935312_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2935354_2935594_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2935634_2935883_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_058685071.1|2935927_2937220_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	1.9e-251
WP_000191399.1|2937414_2938617_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2938694_2940131_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2940375_2941590_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2941906_2942368_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2942568_2943969_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2944575_2945667_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2945851_2947042_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2947103_2947751_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2947778_2948327_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2948586_2950428_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2950772_2955239_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2955238_2955943_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2955923_2957246_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2957238_2958042_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	3008105	3016837	4856440	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3008105_3009360_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3009823_3010282_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3010473_3012750_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3012780_3013101_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3013424_3013646_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3013775_3015722_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3015718_3016837_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	3147229	3183036	4856440	portal,protease,integrase,coat,terminase,lysis	Salmonella_phage(61.4%)	57	3141765:3141787	3183102:3183124
3141765:3141787	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
WP_015975192.1|3147229_3148132_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	100.0	8.5e-174
WP_000677939.1|3148200_3148362_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_015975190.1|3148452_3148704_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975201.1|3148803_3148983_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_000757526.1|3148996_3149362_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_015975200.1|3149392_3149887_+	hypothetical protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
WP_015975199.1|3149909_3151739_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	100.0	0.0e+00
WP_173644898.1|3151738_3153109_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	96.3	2.7e-240
WP_023210752.1|3153118_3153808_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	95.6	6.4e-89
WP_058685087.1|3153810_3154266_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	97.4	1.2e-83
WP_023167450.1|3154265_3154967_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_001122424.1|3154970_3156389_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3156348_3156849_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3156832_3157042_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_058685086.1|3157080_3158373_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	99.3	4.7e-242
WP_023167453.1|3158372_3159284_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023170969.1|3159297_3161475_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023181139.1|3161474_3162974_-|terminase	phage terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.4	2.0e-305
WP_000729925.1|3162951_3163440_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|3163443_3163848_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|3163850_3164093_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001177703.1|3164395_3165082_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_001531485.1|3165294_3165732_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_000074137.1|3165820_3166318_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_000286100.1|3166295_3166499_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001235453.1|3166937_3167561_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000219131.1|3167557_3167737_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_000149925.1|3167717_3167921_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3167917_3168142_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|3168138_3168750_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|3168742_3168919_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_058685112.1|3168911_3169244_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	99.1	3.0e-60
WP_071955124.1|3169246_3169423_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	4.3e-26
WP_001248406.1|3170070_3171447_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3171443_3172259_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3172251_3172398_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3172432_3172711_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3172817_3173003_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3173083_3173734_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_023893006.1|3174087_3174390_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	3.1e-48
WP_001682202.1|3174410_3174989_-	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_173644899.1|3175238_3175916_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	90.4	6.4e-33
WP_023167636.1|3176232_3176406_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_000156731.1|3176386_3176575_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_058685122.1|3176564_3176708_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	93.6	3.5e-18
WP_023167638.1|3176704_3177412_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_001253478.1|3177411_3177696_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_015975204.1|3177742_3178036_+	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	100.0	1.9e-50
WP_001214434.1|3178046_3178217_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	100.0	3.5e-25
WP_015975203.1|3178204_3178702_+	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	99.4	2.3e-88
WP_015975202.1|3178810_3179170_+	Eaf protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
WP_063320243.1|3179166_3179865_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	76.3	5.7e-101
WP_015976809.1|3179864_3180110_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	100.0	8.7e-41
WP_015976808.1|3180111_3180330_+	DUF4014 family protein	NA	Q5G8V0	Enterobacteria_phage	100.0	7.0e-34
WP_015976806.1|3180706_3181267_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	100.0	8.3e-103
WP_001556007.1|3181769_3181988_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3181965_3183036_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3183102:3183124	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	3666172	3716998	4856440	protease,integrase,holin,terminase,tail,lysis	Enterobacteria_phage(91.78%)	73	3670093:3670109	3720043:3720059
WP_058685116.1|3666172_3667309_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	99.5	4.6e-209
WP_015976802.1|3667428_3667671_+	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	100.0	1.6e-39
WP_015976801.1|3667852_3668506_-	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	100.0	8.7e-120
WP_015976799.1|3668816_3671972_-	host specificity protein J	NA	Q5G8W0	Enterobacteria_phage	100.0	0.0e+00
3670093:3670109	attL	TCAGAGTCGGTGTTGAT	NA	NA	NA	NA
WP_001747796.1|3671981_3672509_-|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	95.2	6.4e-65
WP_015976798.1|3672451_3673171_-	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	100.0	2.0e-146
WP_015976797.1|3673170_3673875_-|tail	phage minor tail protein L	tail	Q5G8W3	Enterobacteria_phage	100.0	6.4e-137
WP_015976796.1|3674038_3674326_+	hypothetical protein	NA	Q5G8W4	Enterobacteria_phage	100.0	9.5e-47
WP_015976795.1|3674330_3674591_-	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	100.0	5.6e-38
WP_015976794.1|3674602_3674950_-|tail	phage tail protein	tail	Q5G8W6	Enterobacteria_phage	100.0	1.5e-62
WP_015976793.1|3675042_3675441_+	hypothetical protein	NA	Q5G8W7	Enterobacteria_phage	100.0	2.7e-71
WP_015976792.1|3675441_3678816_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	100.0	0.0e+00
WP_102136173.1|3678877_3679348_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	100.0	1.7e-80
WP_015976790.1|3679445_3680975_-	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	100.0	7.6e-167
WP_006754909.1|3681080_3681254_-	hypothetical protein	NA	Q5G8X1	Enterobacteria_phage	100.0	5.2e-24
WP_015976789.1|3681332_3681986_-	hypothetical protein	NA	Q5G8X2	Enterobacteria_phage	100.0	3.5e-121
WP_015976788.1|3682031_3682769_-	immunoglobulin domain-containing protein	NA	Q5G8X3	Enterobacteria_phage	100.0	5.0e-132
WP_015976787.1|3682784_3683171_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	100.0	2.0e-68
WP_015976786.1|3683167_3683563_-	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	100.0	7.2e-69
WP_015976785.1|3683570_3683933_-	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	100.0	9.5e-68
WP_000312329.1|3683925_3684105_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	100.0	8.6e-30
WP_000633370.1|3684104_3684506_-	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	100.0	1.4e-72
WP_001151796.1|3684557_3684746_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	100.0	2.9e-28
WP_000273924.1|3684755_3685832_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	100.0	1.4e-207
WP_015976784.1|3685849_3686299_-	hypothetical protein	NA	Q5G8Y1	Enterobacteria_phage	100.0	7.4e-78
WP_015976783.1|3686311_3687577_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	100.0	1.9e-235
WP_015976782.1|3687579_3688506_-	hypothetical protein	NA	Q5G8Y3	Enterobacteria_phage	100.0	9.6e-173
WP_015976781.1|3688465_3689815_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	100.0	1.3e-258
WP_000623181.1|3690055_3690322_-	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	100.0	8.3e-45
WP_015976779.1|3690383_3691703_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	100.0	2.9e-263
WP_000147265.1|3691686_3692118_-|terminase	terminase small subunit	terminase	Q5G8Y8	Enterobacteria_phage	100.0	5.8e-72
WP_015976837.1|3692552_3693242_-	Rha family transcriptional regulator	NA	Q5G8R0	Enterobacteria_phage	100.0	5.0e-126
WP_058685119.1|3693459_3693912_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	99.3	2.0e-75
WP_015976834.1|3693926_3694364_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	100.0	6.7e-76
WP_000738703.1|3694347_3694674_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_058685118.1|3694809_3695079_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	80.7	3.9e-18
WP_001531203.1|3695114_3695879_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	100.0	1.0e-143
WP_015976833.1|3695875_3696055_-	hypothetical protein	NA	Q5G8R7	Enterobacteria_phage	100.0	1.2e-23
WP_000149926.1|3696035_3696239_-	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3696235_3696460_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_015976832.1|3696456_3697062_-	recombination protein NinG	NA	Q5G8S0	Enterobacteria_phage	100.0	3.5e-99
WP_015976831.1|3697062_3697281_-	hypothetical protein	NA	Q5G8S1	Enterobacteria_phage	100.0	8.3e-35
WP_015976830.1|3697261_3697444_-	gp67	NA	Q5G8S2	Enterobacteria_phage	100.0	6.7e-30
WP_000113769.1|3697440_3697617_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	3.0e-27
WP_000679702.1|3697583_3697757_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_015976828.1|3697753_3698191_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	100.0	5.9e-80
WP_015976827.1|3698264_3698543_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	100.0	9.9e-49
WP_015976826.1|3698543_3700424_-	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	100.0	0.0e+00
WP_015976824.1|3700531_3701380_-	replication protein	NA	Q5G8T0	Enterobacteria_phage	100.0	7.0e-146
WP_015976823.1|3701366_3701528_-	hypothetical protein	NA	Q5G8T1	Enterobacteria_phage	100.0	1.3e-21
WP_000424167.1|3701562_3701841_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3701947_3702133_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3702213_3702864_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_015976822.1|3703215_3703545_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	100.0	3.8e-55
WP_063316953.1|3703595_3704903_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	100.0	1.1e-68
WP_001199269.1|3705102_3705243_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	3.5e-18
WP_000361564.1|3705235_3705349_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_015976818.1|3705542_3706250_+	gp49	NA	Q5G8U0	Enterobacteria_phage	100.0	4.1e-139
WP_024142050.1|3706250_3706721_+	single-stranded DNA-binding protein	NA	Q5G8U1	Enterobacteria_phage	99.4	3.8e-61
WP_102136175.1|3706783_3707281_+	HNH endonuclease	NA	Q5G8U2	Enterobacteria_phage	100.0	5.3e-93
WP_058685125.1|3707348_3707642_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	100.0	5.5e-50
WP_015976814.1|3707652_3707940_+	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	100.0	2.1e-46
WP_015976813.1|3707936_3708107_+	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	100.0	6.1e-25
WP_058685126.1|3708172_3708721_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	99.5	5.2e-94
WP_015976811.1|3708717_3709083_+	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	100.0	8.4e-72
WP_063316954.1|3709079_3709904_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	99.6	2.0e-150
WP_015976809.1|3709903_3710149_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	100.0	8.7e-41
WP_015976808.1|3710150_3710369_+	DUF4014 family protein	NA	Q5G8V0	Enterobacteria_phage	100.0	7.0e-34
WP_015976806.1|3710745_3711306_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	100.0	8.3e-103
WP_015976804.1|3711928_3713092_+|integrase	site-specific integrase	integrase	Q5G8V5	Enterobacteria_phage	100.0	6.3e-230
WP_000893231.1|3713297_3714548_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3714559_3715663_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3715945_3716998_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3720043:3720059	attR	ATCAACACCGACTCTGA	NA	NA	NA	NA
>prophage 11
NZ_CP014977	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 chromosome, complete genome	4856440	4475837	4522881	4856440	tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4475837_4476836_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4476923_4478234_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4478480_4478996_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4479094_4479304_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4479325_4479439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4479435_4480761_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4480939_4481548_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4481656_4482025_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4482195_4484616_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4484714_4485587_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4485600_4486098_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4486278_4487196_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4487359_4488718_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4488806_4489916_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4490277_4491468_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4491599_4493144_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4493158_4494049_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4494214_4494625_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4494767_4496864_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4496863_4497601_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4497597_4498266_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4498299_4498542_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4498985_4500635_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4500979_4502329_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4502461_4502809_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4503384_4503672_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4503674_4504280_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4504292_4504607_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4504766_4505222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4505218_4505416_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4505405_4506833_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4506832_4507357_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4507408_4507726_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4507685_4507814_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4507910_4510265_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4510264_4511218_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4511217_4511427_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4511414_4512458_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4512467_4513190_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4513517_4513880_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4513876_4514806_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4514805_4516353_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4516516_4516876_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4516866_4517982_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4517974_4518607_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4518609_4520355_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4520359_4520965_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4520961_4521417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4521665_4521956_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4522152_4522881_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
