The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	687152	743497	4927145	lysis,head,terminase,plate,tRNA,integrase,holin,portal,tail,capsid	Escherichia_phage(30.43%)	63	700181:700196	729898:729913
WP_000785626.1|687152_687551_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|687553_687859_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|687900_688269_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|688413_688797_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422143.1|688800_689463_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|689912_691157_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|691411_692380_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617687.1|692651_693650_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951049.1|693738_694431_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|694582_695080_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|695165_696302_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121523.1|696382_698401_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|698571_699951_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
700181:700196	attL	TTTAAAGAAAAAGGTT	NA	NA	NA	NA
WP_000094651.1|700380_701901_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|702288_703854_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000983441.1|703850_704498_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|704729_705497_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023972640.1|707126_708134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.1e-193
WP_023972639.1|708133_708709_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	6.8e-68
WP_023972638.1|708841_709117_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	4.5e-38
WP_023972637.1|709137_709647_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.6	1.4e-88
WP_000920168.1|709654_709882_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000085639.1|709868_710069_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_001246237.1|710138_710366_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_023972636.1|710365_710590_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	4.2e-34
WP_153259982.1|710611_711205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077910960.1|711203_713450_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.9	0.0e+00
WP_023972634.1|713568_714009_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	100.0	1.9e-70
WP_001524927.1|714090_714822_+	hypothetical protein	NA	Q37850	Escherichia_phage	94.2	4.3e-128
WP_001524894.1|714981_715917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023972633.1|716263_717286_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	99.1	3.6e-197
WP_023972632.1|717282_718029_-	hypothetical protein	NA	O80303	Escherichia_phage	95.2	8.1e-138
WP_023972631.1|718028_719798_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	98.6	0.0e+00
WP_023972630.1|719929_720817_+|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	89.0	8.1e-129
WP_001247243.1|720893_721961_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_023972629.1|721964_722714_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.6	7.6e-128
WP_023972628.1|722807_723314_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	98.2	4.7e-89
WP_023972627.1|723313_723517_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	97.0	3.0e-31
WP_000134660.1|723520_723817_+|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_023972626.1|723803_724301_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	96.4	2.2e-91
WP_023972625.1|724297_724711_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.2	5.2e-62
WP_001384078.1|724682_724856_+	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_023972624.1|724818_725286_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.1	1.0e-82
WP_023140001.1|725278_725728_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	2.5e-70
WP_023972623.1|725796_726438_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_023972622.1|726434_726782_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	95.7	8.8e-55
WP_001550204.1|726788_727697_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	95.7	6.8e-155
WP_023972621.1|727689_728223_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	93.1	7.9e-95
WP_015406363.1|728229_729870_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	61.1	4.6e-101
WP_023972620.1|729876_730278_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	81.8	4.1e-56
729898:729913	attR	TTTAAAGAAAAAGGTT	NA	NA	NA	NA
WP_063328694.1|730412_731600_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	2.9e-222
WP_001550210.1|731615_732137_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
WP_023972619.1|732199_732535_+|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	97.3	1.5e-51
WP_000763323.1|732567_732687_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_023972618.1|732679_735121_+|tail	phage tail tape measure protein	tail	Q37848	Escherichia_phage	87.2	0.0e+00
WP_023972617.1|735136_735622_+|tail	phage tail protein	tail	O80317	Escherichia_phage	93.8	3.8e-80
WP_023972616.1|735618_736788_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	94.8	1.4e-205
WP_023135249.1|736855_737074_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
WP_000237776.1|737432_737939_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|738062_739910_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|740059_741805_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|742040_742256_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|742483_743497_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	1292582	1369327	4927145	lysis,head,capsid,terminase,tRNA,transposase,integrase,holin,protease,tail,portal	Salmonella_phage(37.5%)	89	1284663:1284679	1375174:1375190
1284663:1284679	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1292582_1293620_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1293735_1294425_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1294743_1295127_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1295188_1295776_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1295878_1296778_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000083343.1|1298259_1298997_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1298981_1300604_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1300867_1301032_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1301028_1301604_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1301635_1302286_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1302285_1303242_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1303238_1303718_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1304215_1305445_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1305422_1305707_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1305747_1305987_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1306029_1307187_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1307149_1310077_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1310203_1310554_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1310575_1310734_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1311190_1311853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1311852_1312239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1312231_1313071_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_023972744.1|1313129_1313525_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	2.5e-37
WP_000643689.1|1313624_1313867_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1313826_1314201_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_023972743.1|1314292_1315153_+	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	1.5e-47
WP_000801764.1|1315149_1315845_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1315858_1316557_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1316664_1317297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1317539_1317773_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1317889_1318138_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1318172_1318775_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|1318983_1319595_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1319591_1319732_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1319728_1320406_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1320678_1321242_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1321748_1321937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1322151_1322838_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1323113_1323443_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1323426_1323879_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1323896_1324349_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1324584_1324986_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1325272_1325818_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1325789_1327721_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1327704_1327908_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1327904_1329485_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1329474_1330971_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1330983_1331331_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1331385_1332414_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1332471_1332831_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1332841_1333225_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1333252_1333831_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1333879_1335010_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1335118_1335520_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1335527_1336274_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1336324_1336720_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1336716_1337055_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1337026_1340122_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1340124_1340454_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1340463_1341162_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1341168_1341906_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1341803_1342451_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1342512_1345875_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1345913_1346156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1346209_1348582_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1348578_1349403_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1349392_1349971_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1350067_1350295_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|1350401_1350614_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1351366_1351486_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1352198_1352336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165418335.1|1352340_1352478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1352850_1354344_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1354748_1356548_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1356564_1357539_+	signal peptidase I	NA	NA	NA	NA	NA
WP_045721070.1|1357812_1358499_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	5.7e-21
WP_000102232.1|1358488_1359394_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1359405_1360134_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1360145_1360877_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1360876_1361257_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1361368_1361629_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1361666_1362593_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1362708_1363905_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1363926_1364844_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1364882_1365731_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1365846_1366740_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1366750_1368112_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1368115_1368751_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1368775_1369327_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1375174:1375190	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	1722773	1752356	4927145	holin,protease,tail	Enterobacteria_phage(30.0%)	29	NA	NA
WP_000781589.1|1722773_1723268_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1723681_1724173_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1724162_1724426_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778094.1|1724422_1726909_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1726915_1727611_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1727597_1728467_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1728582_1729032_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_023972899.1|1729041_1729644_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000990028.1|1730277_1730937_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1730988_1731726_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1731722_1731935_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_023972757.1|1731931_1732411_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1732407_1734339_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1734335_1734893_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1734889_1735933_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1735976_1736624_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1737353_1737917_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1738108_1738312_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1738614_1739406_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1739701_1739905_+|tail	tail protein	tail	NA	NA	NA	NA
WP_023972657.1|1740073_1742440_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_010989045.1|1743771_1744140_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1744168_1745500_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1745796_1746126_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_023972659.1|1746718_1747960_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_023972660.1|1747962_1748490_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	4.1e-11
WP_000022213.1|1748867_1749311_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1751534_1751825_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1751852_1752356_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	1824406	1833577	4927145	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1824406_1825354_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1825337_1826069_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1826049_1826157_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1826216_1826948_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1827170_1828856_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1828852_1829572_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1829618_1830086_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1830142_1830673_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1830844_1831303_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1831543_1833577_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	1901885	1912391	4927145		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1901885_1903289_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1903466_1904360_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1904736_1905822_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1905821_1906721_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1906768_1907647_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1907647_1908199_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1908204_1909197_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1909193_1909967_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1909971_1911051_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1911077_1912391_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	1999162	2049911	4927145	lysis,head,terminase,plate,protease,integrase,holin,portal,tail,capsid	Salmonella_phage(90.48%)	68	1992963:1992977	2010215:2010229
1992963:1992977	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1999162_1999636_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|2000945_2001743_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_186246704.1|2002034_2002850_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	99.3	2.2e-157
WP_001527041.1|2003024_2003252_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|2003291_2003861_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|2003864_2004698_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|2004694_2005312_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|2005308_2005824_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|2005820_2006051_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|2006121_2006661_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|2006797_2007625_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|2007682_2008054_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|2008868_2009564_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2009661_2009886_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2009914_2010469_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
2010215:2010229	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|2010465_2011623_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|2011619_2011844_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|2011840_2012659_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|2012660_2013143_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|2013142_2014036_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|2014032_2014422_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|2014438_2015299_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202277.1|2015306_2016296_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_000188927.1|2016306_2016930_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|2017062_2017320_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|2017249_2017684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|2017845_2018190_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|2018192_2018807_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|2018803_2019289_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|2019501_2019921_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|2020140_2020443_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|2020503_2020854_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|2020979_2021474_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|2021470_2023204_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|2023215_2023398_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|2023397_2024639_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|2024616_2025267_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|2025281_2026487_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|2026537_2026738_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|2026740_2027064_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|2027060_2027465_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|2027436_2027949_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|2027945_2028506_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_023233175.1|2028509_2028674_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	3.8e-24
WP_001007991.1|2028663_2030160_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|2030159_2030516_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|2030512_2030839_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|2030923_2032852_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|2032885_2034226_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|2034222_2035281_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|2035280_2035814_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|2035818_2036232_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|2036203_2036749_+|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|2036783_2037305_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|2037307_2037895_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|2037881_2039444_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_015701331.1|2039413_2040013_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|2040297_2041305_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|2041517_2041739_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|2042369_2042531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2042657_2043077_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2043079_2044348_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2044802_2045015_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2045025_2045214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023972908.1|2045474_2046671_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	1.1e-109
WP_000107430.1|2047320_2047620_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2047711_2048407_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2048480_2049911_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	2153954	2160763	4927145	tail,integrase	Salmonella_phage(33.33%)	11	2156164:2156186	2165879:2165901
WP_000856224.1|2153954_2154185_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2154322_2154697_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2154697_2155573_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2155589_2155943_+	YebY family protein	NA	NA	NA	NA	NA
2156164:2156186	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_176731523.1|2156316_2157159_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
WP_010989030.1|2157230_2157725_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2157914_2158145_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2158198_2158732_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2158988_2159156_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2159220_2159409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2159881_2160763_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2165879:2165901	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	2949239	3048045	4927145	lysis,terminase,tRNA,holin,protease,tail,portal	Salmonella_phage(42.59%)	98	NA	NA
WP_000938191.1|2949239_2949920_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2950540_2951200_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2951286_2951616_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2951612_2951894_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2951942_2952722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2952747_2953296_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2953510_2954722_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2954779_2955097_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2955141_2955555_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2955728_2956391_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2956485_2956944_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_041112204.1|2956979_2959034_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.4e-19
WP_001261222.1|2959157_2959604_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2959622_2961776_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2961762_2962368_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2962584_2963094_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2963450_2964503_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2964574_2965027_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2965212_2966973_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2967041_2967560_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2967659_2967827_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2968082_2968646_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2968642_2970283_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2970287_2971541_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2971555_2973463_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2973475_2975584_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2975682_2976792_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2976788_2977331_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2977496_2978507_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2978714_2981327_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2981753_2981945_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2982215_2982902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2982886_2983186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2983254_2983881_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2984528_2985497_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2985972_2986554_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000178849.1|2989044_2989287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2989325_2992676_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2992747_2993452_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2993349_2994087_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2994096_2994792_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2994881_2995415_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2995531_2996029_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_023972925.1|2996127_2996460_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	60.6	2.2e-34
WP_010989010.1|2996456_2999444_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2999523_2999853_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2999849_3000248_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3000293_3001043_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3001054_3001456_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3001452_3002019_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_023972924.1|3001999_3002299_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	5.9e-15
WP_001107908.1|3002291_3002615_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3002705_3004787_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|3004710_3006258_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3006254_3006461_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3006457_3008596_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3008552_3009086_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3009293_3009773_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3009790_3010243_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3010226_3010556_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3010831_3011518_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3011878_3012328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3012463_3012589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|3013145_3013943_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|3013932_3014079_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3014075_3014687_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|3014895_3015498_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|3015580_3015802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3015913_3016147_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3016438_3016729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3016806_3017118_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3017114_3017462_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3017472_3018222_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3018224_3019208_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3019292_3019667_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3019632_3019872_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3019991_3020402_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077910972.1|3020451_3020712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|3020704_3020863_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_000407058.1|3020947_3021184_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	81.1	1.5e-34
WP_000017133.1|3021310_3024196_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3024158_3025316_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3025358_3025598_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3025638_3025887_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_000191399.1|3027417_3028620_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3028697_3030134_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023972943.1|3030378_3031593_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3031909_3032371_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3032571_3033972_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3034578_3035670_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3035854_3037045_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3037106_3037754_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3037781_3038330_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3038589_3040431_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3040775_3045242_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3045241_3045946_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3045926_3047249_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3047241_3048045_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	3098137	3106869	4927145	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3098137_3099392_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3099855_3100314_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3100505_3102782_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3102812_3103133_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3103456_3103678_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3103807_3105754_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3105750_3106869_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	3231536	3271961	4927145	lysis,terminase,protease,integrase,coat,portal,holin	Salmonella_phage(60.34%)	61	3231082:3231104	3272027:3272049
3231082:3231104	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000915523.1|3231536_3231899_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_023893012.1|3231895_3232828_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	98.7	8.7e-174
WP_023220032.1|3232817_3234275_+	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	99.2	1.9e-239
WP_023972981.1|3234333_3236337_-	endorhamnosidase	NA	A0A192Y6X2	Salmonella_phage	96.9	0.0e+00
WP_031306894.1|3236448_3237222_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	8.0e-80
WP_031306893.1|3237305_3237944_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	5.3e-98
WP_023972978.1|3238017_3238191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972977.1|3238290_3238932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023167446.1|3238992_3239322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023167447.1|3239339_3241157_-	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_023893010.1|3241156_3242527_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.4	1.3e-242
WP_023167449.1|3242536_3243226_-	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
WP_000627703.1|3243228_3243684_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167450.1|3243683_3244385_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_001122424.1|3244388_3245807_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3245766_3246267_-	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_023167451.1|3246250_3246811_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_023167452.1|3246851_3248144_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	98.8	2.3e-241
WP_023167453.1|3248143_3249055_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023170969.1|3249068_3251246_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023972976.1|3251245_3252745_-|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.2	1.0e-304
WP_000729925.1|3252722_3253211_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|3253214_3253619_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|3253621_3253864_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|3254187_3254709_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3254921_3255371_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_023167456.1|3255388_3255826_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	3.7e-74
WP_000738703.1|3255809_3256136_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_022630928.1|3256360_3256879_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000027545.1|3257149_3257638_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_023167457.1|3257634_3257814_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_000149926.1|3257794_3257998_-	phage NinH family protein	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3257994_3258219_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|3258215_3258827_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|3258819_3258996_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|3258988_3259321_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|3259323_3259500_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3259466_3259640_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736921.1|3259636_3260074_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_001248406.1|3260147_3261524_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3261520_3262336_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3262328_3262475_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3262509_3262788_-	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3262894_3263080_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3263160_3263811_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|3264164_3264467_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|3264487_3265066_-	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_172967229.1|3265258_3266050_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	91.5	2.2e-32
WP_023167636.1|3266384_3266558_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_000156731.1|3266538_3266727_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023167637.1|3266716_3266860_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_023167638.1|3266856_3267564_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_001253478.1|3267563_3267848_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630922.1|3267894_3268188_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_023167639.1|3268198_3268363_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630920.1|3268359_3268758_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_022630919.1|3268754_3269054_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_023972681.1|3269504_3269978_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	2.5e-68
WP_153266261.1|3270444_3270585_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	100.0	3.2e-16
WP_001556007.1|3270694_3270913_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3270890_3271961_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3272027:3272049	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	4515083	4562126	4927145	holin,tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4515083_4516082_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4516169_4517480_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4517726_4518242_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4518340_4518550_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4518571_4518685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4518681_4520007_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4520185_4520794_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4520902_4521271_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4521441_4523862_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4523960_4524833_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4524846_4525344_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4525524_4526442_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4526605_4527964_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4528052_4529162_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4529523_4530714_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4530845_4532390_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4532404_4533295_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4533460_4533871_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4534013_4536110_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4536109_4536847_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4536843_4537512_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4537545_4537788_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4538231_4539881_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4540225_4541575_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4541707_4542055_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4542629_4542917_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4542919_4543525_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4543537_4543852_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4544011_4544467_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4544463_4544661_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4544650_4546078_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4546077_4546602_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4546653_4546971_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4546930_4547059_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4547155_4549510_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4549509_4550463_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4550462_4550672_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4550659_4551703_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4551712_4552435_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4552762_4553125_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4553121_4554051_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4554050_4555598_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4555761_4556121_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4556111_4557227_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4557219_4557852_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4557854_4559600_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4559604_4560210_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4560206_4560662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4560910_4561201_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4561397_4562126_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 12
NZ_CP014982	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 chromosome, complete genome	4927145	4678974	4744780	4927145	lysis,head,terminase,tail,portal,integrase,holin,protease,plate,capsid	Escherichia_phage(38.64%)	76	4708832:4708878	4740155:4740201
WP_000208240.1|4678974_4679505_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4679514_4680846_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_023972960.1|4680912_4681842_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4681934_4682420_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4682641_4682881_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4683279_4684125_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4684145_4685654_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250625.1|4685765_4686776_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796300.1|4686872_4687619_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|4687725_4688154_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4688254_4688851_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4688963_4689731_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4689822_4690587_-	epimerase	NA	NA	NA	NA	NA
WP_001738619.1|4690596_4690887_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774147.1|4690969_4691845_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4691873_4692896_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4692924_4693926_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|4693922_4694966_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|4694959_4696495_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283048.1|4696750_4697710_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4697797_4699390_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4699403_4699754_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000061008.1|4699990_4700155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|4700252_4700975_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557889.1|4701037_4702078_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646499.1|4702087_4703047_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777317.1|4703057_4704392_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750761.1|4704654_4705410_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4705510_4706500_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4706703_4707666_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4707850_4708753_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4708832:4708878	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4708989_4709208_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882949.1|4709289_4710453_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978885.1|4710452_4710932_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000069914.1|4710946_4713394_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
WP_000785970.1|4713386_4713506_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031306.1|4713538_4713814_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4713870_4714389_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286720.1|4714401_4715592_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_010835363.1|4715651_4716245_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_023891855.1|4716464_4716953_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	82.6	2.1e-70
WP_010835343.1|4716922_4717540_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_022631136.1|4717544_4718078_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_023167498.1|4718080_4719643_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	49.4	1.5e-154
WP_001285338.1|4719639_4720251_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_001121478.1|4720243_4721152_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|4721156_4721504_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093737.1|4721500_4722136_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_001001780.1|4722202_4722655_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917156.1|4722647_4723115_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_000040673.1|4723222_4723648_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000736607.1|4723635_4724061_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_000123124.1|4724572_4724854_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4724857_4725061_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4725060_4725570_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001682330.1|4725669_4726413_-|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
WP_001248559.1|4726416_4727490_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001085976.1|4727548_4728403_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_010835387.1|4728576_4730349_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038172.1|4730348_4731383_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_010835386.1|4731813_4734021_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000216280.1|4734251_4736540_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_000027666.1|4736529_4736805_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_001113272.1|4736801_4737026_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_001277964.1|4737025_4737328_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_000288879.1|4737327_4737552_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_000217677.1|4737615_4738116_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001308179.1|4738285_4738558_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4738694_4738988_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4739057_4740038_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4740223_4740724_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4740155:4740201	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4740874_4741573_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4741569_4742943_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133444.1|4742993_4743389_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559232.1|4743400_4744090_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122635.1|4744159_4744780_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
