The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	166127	180062	4906321	integrase	Enterobacteria_phage(88.89%)	13	168656:168677	180224:180245
WP_001541628.1|166127_167318_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
WP_000120776.1|167995_168340_+	hypothetical protein	NA	NA	NA	NA	NA
168656:168677	attL	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_031614182.1|169152_171486_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|171500_171821_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_031614183.1|171956_172412_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_001244664.1|172404_172692_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_031614184.1|172684_173275_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001149160.1|173271_173538_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283042.1|174089_174824_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
WP_000638636.1|174820_175321_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446146.1|175394_175967_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_023568261.1|176168_178886_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_023568260.1|178898_180062_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	3.2e-210
180224:180245	attR	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	1305412	1380544	4906321	tRNA,head,tail,portal,terminase,transposase,capsid,holin,lysis,integrase	Salmonella_phage(38.89%)	85	1297493:1297509	1386391:1386407
1297493:1297509	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1305412_1306450_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1306565_1307255_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1307573_1307957_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1308018_1308606_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1308708_1309608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1309625_1310960_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1311090_1311828_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_022742804.1|1311812_1313435_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1313698_1313863_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1313859_1314435_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1314466_1315117_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1315116_1316073_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1316069_1316549_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_022742803.1|1317046_1318276_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_001670787.1|1318253_1318538_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1318578_1318818_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_022742802.1|1318860_1320018_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_031609046.1|1319980_1322908_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	99.0	0.0e+00
WP_001668146.1|1323034_1323334_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1323355_1323514_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001020640.1|1323867_1324563_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001191666.1|1324660_1324885_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_023139406.1|1324913_1325468_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_031609052.1|1325464_1326607_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_000620702.1|1326603_1326828_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_022742797.1|1326824_1327784_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_024150662.1|1327785_1328268_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_000767086.1|1329156_1329546_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150661.1|1329562_1330423_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_050196634.1|1330430_1331420_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_022742791.1|1331434_1332013_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_022742790.1|1332213_1332939_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_024150660.1|1333071_1333497_+	subtilase	NA	NA	NA	NA	NA
WP_023221874.1|1334023_1334212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294873.1|1334301_1334691_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_021000643.1|1334677_1334959_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_022742788.1|1334958_1335573_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_050955063.1|1335605_1336052_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_031603581.1|1336379_1336883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669689.1|1337139_1337541_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1337826_1338372_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1338343_1340275_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1340258_1340462_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1340458_1342039_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189498.1|1342028_1343525_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000011260.1|1343537_1343885_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_022742784.1|1343939_1344968_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000201485.1|1345025_1345391_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083293.1|1345401_1345779_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|1345765_1346344_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_022742782.1|1346340_1346742_+	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000971953.1|1346749_1347496_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1347546_1347942_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1347938_1348277_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_022742781.1|1348248_1351344_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_000447369.1|1351346_1351676_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1351685_1352384_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1352390_1353128_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1353025_1353673_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1353734_1357097_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1357135_1357378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742779.1|1357431_1359804_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000593433.1|1359800_1360625_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1360614_1361193_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1361289_1361517_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|1361623_1361836_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1362588_1362708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1363420_1363558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1364066_1365560_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1365964_1367764_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1367780_1368755_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1369028_1369709_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1369705_1370611_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1370622_1371351_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1371362_1372094_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1372093_1372474_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1372585_1372846_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1372883_1373810_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1373925_1375122_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1375143_1376061_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1376099_1376948_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1377063_1377957_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1377967_1379329_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1379332_1379968_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1379992_1380544_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1386391:1386407	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	1734694	1764280	4906321	tail,protease,holin	Salmonella_phage(33.33%)	31	NA	NA
WP_000781589.1|1734694_1735189_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1735602_1736094_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1736083_1736347_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1736343_1738830_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1738836_1739532_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1739518_1740388_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1740503_1740953_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1740962_1741565_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1741585_1742203_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1742199_1742859_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1742910_1743648_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1743644_1743857_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1743853_1744333_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1744329_1746261_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1746257_1746815_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_022742763.1|1746811_1747855_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1747898_1748546_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1749275_1749839_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1750030_1750234_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1750536_1751328_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1751624_1751828_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1751996_1754363_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1754691_1755681_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1755695_1756064_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1756092_1757424_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1757720_1758050_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1758642_1759884_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1759886_1760414_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1760791_1761235_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1763458_1763749_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1763776_1764280_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	1836163	1845334	4906321	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1836163_1837111_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1837094_1837826_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1837806_1837914_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1837973_1838705_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1838927_1840613_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1840609_1841329_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1841375_1841843_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1841899_1842430_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1842601_1843060_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1843300_1845334_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	1913642	1924148	4906321		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1913642_1915046_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1915223_1916117_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1916493_1917579_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1917578_1918478_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1918525_1919404_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1919404_1919956_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1919961_1920954_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1920950_1921724_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1921728_1922808_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1922834_1924148_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	2010853	2060919	4906321	plate,head,tail,portal,protease,terminase,capsid,holin,integrase	Salmonella_phage(86.15%)	69	2005431:2005445	2021561:2021575
2005431:2005445	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|2010853_2011327_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|2012636_2013434_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|2013725_2014715_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|2014716_2014944_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|2014983_2015553_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|2015556_2016138_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|2016148_2016406_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|2016407_2016941_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|2017011_2017551_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|2017687_2018515_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|2018572_2018944_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|2019483_2019708_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|2019670_2020009_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|2020214_2020910_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2021007_2021232_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2021260_2021815_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
2021561:2021575	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|2021811_2022969_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|2022965_2023190_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|2023186_2024005_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|2024006_2024489_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|2024488_2025382_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|2025378_2025768_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_020899399.1|2025784_2026645_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_020899400.1|2026652_2027642_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899401.1|2027655_2028408_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2028558_2028816_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2028961_2029348_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2029334_2029616_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2029615_2030230_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2030226_2030619_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|2031081_2031414_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|2031464_2031815_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|2031940_2032435_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000088175.1|2032431_2034165_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|2034176_2034359_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_020899404.1|2034358_2035600_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_001193639.1|2035577_2036228_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|2036242_2037448_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|2037498_2037699_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|2037701_2038025_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|2038021_2038426_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_001135699.1|2038397_2038910_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000779216.1|2038906_2039467_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|2039470_2039635_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_001007996.1|2039624_2041121_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000515952.1|2041120_2041477_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_022742746.1|2041506_2041800_+	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000785390.1|2041884_2043813_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000863827.1|2043846_2045187_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_001066630.1|2045183_2046242_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273648.1|2046241_2046775_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|2046779_2047193_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|2047185_2048265_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|2048267_2048855_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_020899405.1|2048841_2050404_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_022742744.1|2050373_2050979_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2051092_2051326_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2051400_2051514_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2051561_2051975_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2051971_2052184_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2053377_2053539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2053665_2054085_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2054087_2055356_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2055810_2056023_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2056033_2056222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2056482_2057679_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2058328_2058628_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2058719_2059415_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2059488_2060919_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	2164963	2241812	4906321	plate,head,tail,protease,terminase,transposase,holin,lysis,integrase	Edwardsiella_phage(16.67%)	96	2202433:2202448	2224577:2224592
WP_000856224.1|2164963_2165194_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2165331_2165706_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2165706_2166582_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2166598_2166952_+	YebY family protein	NA	NA	NA	NA	NA
WP_022742740.1|2167334_2168414_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|2168388_2168667_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742739.1|2168727_2169156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139359.1|2169254_2169434_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_023139358.1|2170044_2170377_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_001033921.1|2170369_2170690_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_022742735.1|2171549_2174240_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|2174380_2174716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2174791_2174998_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2175001_2175277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2175537_2175717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|2176147_2176546_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|2176644_2176899_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001534383.1|2176885_2177380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742734.1|2177423_2178431_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_157872077.1|2178342_2178885_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_022742732.1|2178897_2179293_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_023139357.1|2179289_2179562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2179768_2179921_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139356.1|2180170_2180419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|2180482_2181082_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_021000145.1|2181078_2181273_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_023139355.1|2181269_2181581_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_023139354.1|2181920_2182262_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139353.1|2182810_2183740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|2184217_2184424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742726.1|2184414_2184960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2185237_2185696_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_001526513.1|2185862_2186165_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001208103.1|2186142_2186631_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_085983312.1|2186651_2187092_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001113128.1|2187317_2187500_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_022742724.1|2187570_2188323_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_022742723.1|2188288_2189710_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_023139350.1|2189709_2191230_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_000552017.1|2191270_2191960_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139349.1|2191956_2193303_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_001525451.1|2193304_2193787_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031915.1|2193786_2194815_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|2194818_2195166_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_023139348.1|2195172_2195628_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_022742718.1|2195621_2196206_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_001748490.1|2196202_2196568_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_000094504.1|2196552_2197098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748488.1|2197078_2198563_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
WP_000016414.1|2198563_2199010_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2199009_2199414_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|2199455_2199638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742717.1|2199621_2201793_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_022742716.1|2201789_2202500_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
2202433:2202448	attL	TTACGGCGTCGGTGAC	NA	NA	NA	NA
WP_000890115.1|2202499_2202802_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|2202798_2203668_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_022742715.1|2203648_2204326_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_001191865.1|2204338_2204695_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742714.1|2204691_2205933_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_022742713.1|2205934_2206537_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742712.1|2206526_2207978_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742711.1|2207977_2208553_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_024150649.1|2208935_2209631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742709.1|2209631_2210288_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|2210737_2211637_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742707.1|2211899_2213042_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_176731523.1|2213949_2214792_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
WP_010989030.1|2214863_2215358_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2215547_2215778_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2215831_2216365_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2216621_2216789_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2216853_2217042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2217514_2218396_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_000457876.1|2219261_2219387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520350.1|2219900_2220047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2220534_2221149_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2221158_2221317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|2221449_2222364_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000684835.1|2223667_2224036_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001617922.1|2225499_2225640_-	hypothetical protein	NA	NA	NA	NA	NA
2224577:2224592	attR	GTCACCGACGCCGTAA	NA	NA	NA	NA
WP_001752421.1|2225805_2226075_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_000354408.1|2226444_2226864_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|2227251_2227728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742706.1|2228057_2228453_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000182072.1|2229136_2229859_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2230143_2230308_+	membrane protein	NA	NA	NA	NA	NA
WP_000986176.1|2230531_2231182_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_000457836.1|2231200_2231392_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|2231502_2231739_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001542138.1|2231856_2233296_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001535256.1|2233373_2236007_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|2235975_2237259_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|2237387_2237885_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|2237982_2238669_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|2238688_2240737_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|2240930_2241812_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 8
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	3005506	3104315	4906321	tRNA,tail,portal,protease,terminase,holin,lysis	Salmonella_phage(41.82%)	99	NA	NA
WP_000938191.1|3005506_3006187_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|3006807_3007467_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|3007553_3007883_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3007879_3008161_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|3008209_3008989_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|3009014_3009563_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|3009777_3010989_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3011046_3011364_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|3011408_3011822_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3011995_3012658_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3012752_3013211_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|3013246_3015301_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|3015424_3015871_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|3015889_3018043_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3018029_3018635_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3018851_3019361_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|3019717_3020770_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3020841_3021294_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|3021479_3023240_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3023308_3023827_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3023926_3024094_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3024349_3024913_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3024909_3026550_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3026554_3027808_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3027822_3029730_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|3029742_3031851_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|3031949_3033059_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|3033055_3033598_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_022742665.1|3033763_3034774_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3034981_3037594_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3038020_3038212_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3038482_3039169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|3039153_3039453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3039521_3040148_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|3040795_3041764_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_022742661.1|3042239_3042821_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_022742660.1|3042820_3045259_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_000178849.1|3045312_3045555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742659.1|3045593_3048059_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	66.6	9.8e-265
WP_022742658.1|3048051_3048945_-	host specificity protein J	NA	A0A2I6TCW5	Escherichia_phage	73.3	2.4e-128
WP_000246065.1|3049016_3049721_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_022742655.1|3050365_3051061_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000877926.1|3051150_3051684_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3051800_3052298_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3052396_3052729_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3052725_3055713_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3055792_3056122_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3056118_3056517_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3056562_3057312_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3057323_3057725_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3057721_3058288_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3058268_3058568_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3058560_3058884_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3058974_3061056_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|3060979_3062527_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3062523_3062730_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3062726_3064865_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3064821_3065355_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3065562_3066042_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3066059_3066512_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3066495_3066825_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3067100_3067787_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3068147_3068597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3068732_3068858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3069031_3069349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742653.1|3069415_3070213_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_001617856.1|3070202_3070349_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3070345_3070957_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000807548.1|3071850_3072072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3072183_3072417_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3072708_3072999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3073076_3073388_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3073384_3073732_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3073742_3074492_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3074494_3075478_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3075562_3075937_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3075902_3076142_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3076261_3076672_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|3076721_3076982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|3076974_3077133_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|3077154_3077454_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_022742652.1|3077580_3080466_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3080428_3081586_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3081628_3081868_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3081908_3082157_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3082201_3083494_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3083688_3084891_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000544849.1|3086648_3087863_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3088179_3088641_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3088841_3090242_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3090848_3091940_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3092124_3093315_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3093376_3094024_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3094051_3094600_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3094859_3096701_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_022742649.1|3097045_3101512_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3101511_3102216_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3102196_3103519_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3103511_3104315_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	3154378	3163110	4906321	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3154378_3155633_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3156096_3156555_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_058683849.1|3156746_3159023_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	4.0e-164
WP_000520789.1|3159053_3159374_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3159697_3159919_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3160048_3161995_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3161991_3163110_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	3756207	3767406	4906321	integrase	Enterobacteria_phage(90.0%)	12	3755714:3755734	3767569:3767589
3755714:3755734	attL	GATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_063325254.1|3756207_3758541_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|3758555_3758876_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459302.1|3759011_3759467_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|3759459_3759747_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980221.1|3759739_3760330_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_001149160.1|3760326_3760593_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032172942.1|3761145_3761880_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.8e-129
WP_000984202.1|3761876_3762122_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_021546004.1|3762136_3762709_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	99.5	1.8e-97
WP_024236189.1|3762912_3764535_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.8	3.1e-09
WP_021546002.1|3764531_3766235_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021546001.1|3766236_3767406_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	9.7e-146
3767569:3767589	attR	GATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
>prophage 11
NZ_CP014967	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 chromosome, complete genome	4906321	4524927	4571970	4906321	tail,plate,tRNA,holin	Burkholderia_phage(42.86%)	49	NA	NA
WP_001182237.1|4524927_4525926_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4526013_4527324_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4527570_4528086_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4528184_4528394_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4528415_4528529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4528525_4529851_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4530029_4530638_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4530746_4531115_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4531285_4533706_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4533804_4534677_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4534690_4535188_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4535368_4536286_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4536449_4537808_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4537896_4539006_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4539367_4540558_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4540689_4542234_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4542248_4543139_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4543304_4543715_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_022742864.1|4543857_4545954_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4545953_4546691_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4546687_4547356_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4547389_4547632_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4548075_4549725_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4550069_4551419_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4551551_4551899_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4552474_4552762_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4552764_4553370_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4553382_4553697_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4553856_4554312_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4554308_4554506_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4554495_4555923_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4555922_4556447_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4556498_4556816_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4556775_4556904_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4557000_4559355_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001269716.1|4560306_4560516_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4560503_4561547_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4561556_4562279_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4562606_4562969_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4562965_4563895_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4563894_4565442_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4565605_4565965_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4565955_4567071_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4567063_4567696_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4567698_4569444_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4569448_4570054_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4570050_4570506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4570754_4571045_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4571241_4571970_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP014968	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 isolate USDA-ARS-USMARC-1910 plasmid pSTY1-2011K-1702, complete sequence	94016	40863	50159	94016	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40863_41280_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41463_41799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41855_42422_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42453_43395_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43809_45015_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45014_45989_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_022743179.1|46070_47345_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|47344_47767_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48277_48748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48740_49097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49478_50159_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
