The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	1152286	1158090	4635697		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1152286_1154620_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1154634_1154955_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1154951_1155179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1155175_1155727_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1155723_1155990_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|1156527_1157265_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|1157261_1157507_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1157523_1158090_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	1690130	1699301	4635697	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1690130_1691078_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1691061_1691793_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1691773_1691881_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1691940_1692672_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1692894_1694580_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1694576_1695296_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1695342_1695810_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1695866_1696397_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1696568_1697027_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1697267_1699301_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	1767393	1773690	4635697		Enterobacteria_phage(50.0%)	6	NA	NA
WP_063308384.1|1767393_1768797_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.5e-20
WP_000981469.1|1768974_1769868_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1770244_1771330_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1771329_1772229_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1772276_1773155_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1773159_1773690_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	1879844	1891229	4635697	integrase	Stenotrophomonas_phage(25.0%)	12	1865732:1865747	1881269:1881284
1865732:1865747	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|1879844_1881107_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1881752_1882043_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
1881269:1881284	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|1882414_1883212_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|1883692_1883854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1883980_1884400_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1884402_1885671_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1886125_1886338_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1886348_1886537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1886796_1887990_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1888638_1888950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1889029_1889725_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1889798_1891229_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	1994483	2002246	4635697	integrase	Enterobacteria_phage(28.57%)	12	1996693:1996715	2008816:2008838
WP_000856224.1|1994483_1994714_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1994851_1995226_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|1995226_1996102_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1996118_1996472_+	YebY family protein	NA	NA	NA	NA	NA
1996693:1996715	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|1996843_1997923_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|1997919_1999026_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|1999056_1999287_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1999340_1999874_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2000130_2000298_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2000362_2000551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2000605_2001097_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2001649_2002246_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2008816:2008838	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	2914277	2923359	4635697	protease,integrase	Ralstonia_phage(16.67%)	8	2912670:2912682	2931855:2931867
2912670:2912682	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2914277_2915519_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2916046_2916424_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2916585_2916783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2916995_2919272_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2919302_2919623_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2919946_2920168_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2920297_2922244_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2922240_2923359_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2931855:2931867	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 7
NZ_CP014666	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 chromosome, complete genome	4635697	4267631	4312409	4635697	tRNA,tail,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4267631_4268630_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4268717_4270028_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4270274_4270790_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4270889_4271099_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4271120_4271234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4271230_4272556_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4272734_4273343_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4273451_4273820_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4273990_4276411_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4276509_4277382_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4277395_4277893_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4278073_4278991_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4279154_4280513_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4280601_4281711_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4282072_4283263_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4283394_4284939_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4284953_4285844_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4286009_4286420_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4286562_4288659_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4288658_4289396_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4289392_4290061_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4290094_4290337_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4290780_4292430_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4292774_4294124_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4294254_4294602_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4295177_4295465_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4295467_4296073_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4296085_4296400_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4296559_4297015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4297011_4297209_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4297198_4298626_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4298625_4299150_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4299201_4299519_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4299478_4299607_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4299703_4302058_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4302057_4303011_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4303010_4303220_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4303207_4304251_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4304260_4304983_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4305310_4305673_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4305669_4306599_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4306598_4308146_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4308309_4308669_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4308659_4309775_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4309767_4310400_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_063308402.1|4310402_4311866_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4311893_4312409_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
