The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	1153671	1159472	4751034		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783717.1|1153671_1156005_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
WP_000795388.1|1156019_1156340_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|1156336_1156564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|1156560_1157112_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556594.1|1157108_1157375_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_000149860.1|1157912_1158650_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000984209.1|1158646_1158889_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000210082.1|1158905_1159472_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
>prophage 2
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	1162644	1227338	4751034	lysis,tail,capsid,tRNA,portal,plate,integrase,head,terminase	Salmonella_phage(88.1%)	61	1164023:1164070	1198280:1198327
WP_000124715.1|1162644_1163841_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
1164023:1164070	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_063328716.1|1164185_1165409_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.0	8.0e-151
WP_023184693.1|1165415_1166432_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	7.8e-192
WP_023136550.1|1166433_1167066_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_001397669.1|1167185_1167428_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_023184691.1|1167460_1167970_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	98.8	2.3e-88
WP_023184690.1|1167977_1168178_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	2.7e-32
WP_000963480.1|1168141_1168483_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_001244238.1|1168550_1168784_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_063328717.1|1168783_1169011_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	9.6e-34
WP_063328718.1|1169007_1169865_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	81.1	9.3e-130
WP_063328719.1|1169855_1172267_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.6	0.0e+00
WP_001154444.1|1172422_1172611_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000790439.1|1172679_1172979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328720.1|1173089_1173968_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	3.0e-51
WP_001284991.1|1174417_1176082_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_063328721.1|1176185_1177226_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	99.7	7.9e-200
WP_063328722.1|1177225_1178992_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.6	0.0e+00
WP_000216276.1|1179134_1179968_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_063328723.1|1179984_1181046_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_063328724.1|1181049_1181700_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.5	8.4e-115
WP_063328725.1|1181793_1182258_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	3.8e-85
WP_063328726.1|1182257_1182461_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	1.9e-33
WP_000171565.1|1182464_1182680_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_063328727.1|1182660_1183176_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.8	3.0e-75
WP_063328728.1|1183172_1183601_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	80.7	6.6e-52
WP_063328729.1|1183696_1184128_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	91.6	1.9e-70
WP_063328730.1|1184120_1184564_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.1	1.6e-56
WP_023184683.1|1184614_1186321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328731.1|1186459_1187038_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	1.8e-105
WP_000177401.1|1187034_1187394_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_000268275.1|1187380_1188289_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.3	3.2e-157
WP_063328732.1|1188281_1188887_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	2.4e-116
WP_001274653.1|1188883_1190650_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_000680168.1|1190652_1191180_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000046109.1|1191310_1192483_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207647.1|1192492_1193008_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|1193062_1193365_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1193379_1193499_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282774.1|1193491_1196299_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.4	0.0e+00
WP_000980409.1|1196295_1196781_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001102264.1|1196777_1197878_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.4	3.4e-193
WP_000980498.1|1197946_1198165_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1198716_1199880_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1198280:1198327	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1199887_1202068_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1202064_1203474_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1203538_1215013_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1215632_1216115_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1216264_1216741_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1216730_1217021_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1217186_1217525_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1217673_1219335_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1219420_1220299_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1220421_1221012_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1221046_1221652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1221772_1223059_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1223078_1223870_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1224035_1225397_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1225710_1225959_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1225977_1226526_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1226570_1227338_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	1717789	1726960	4751034	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1717789_1718737_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1718720_1719452_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1719432_1719540_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1719599_1720331_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1720553_1722239_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1722235_1722955_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1723001_1723469_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1723525_1724056_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1724227_1724686_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1724926_1726960_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	1795053	1801350	4751034		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1795053_1796457_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1796634_1797528_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1797904_1798990_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1798989_1799889_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1799936_1800815_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1800819_1801350_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	1907504	1918889	4751034	integrase	Stenotrophomonas_phage(25.0%)	12	1893392:1893407	1908929:1908944
1893392:1893407	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|1907504_1908767_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1909412_1909703_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
1908929:1908944	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|1910074_1910872_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|1911352_1911514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1911640_1912060_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1912062_1913331_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1913785_1913998_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1914008_1914197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1914456_1915650_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1916298_1916610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1916689_1917385_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1917458_1918889_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	2022143	2029906	4751034	integrase	Enterobacteria_phage(28.57%)	12	2024353:2024375	2036476:2036498
WP_000856224.1|2022143_2022374_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2022511_2022886_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2022886_2023762_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2023778_2024132_+	YebY family protein	NA	NA	NA	NA	NA
2024353:2024375	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2024503_2025583_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2025579_2026686_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2026716_2026947_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2027000_2027534_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2027790_2027958_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2028022_2028211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2028265_2028757_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2029309_2029906_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2036476:2036498	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	2635929	2720468	4751034	lysis,tail,tRNA,capsid,portal,holin,integrase,head,terminase	Enterobacteria_phage(34.04%)	105	2656567:2656583	2719987:2720003
WP_023893413.1|2635929_2636448_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2636444_2636552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2636757_2637204_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2637183_2637978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2638078_2639263_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2639381_2639729_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2639714_2640026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2640094_2640346_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2640541_2640640_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2640778_2641027_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2641340_2641982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2642211_2642394_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2642396_2642759_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2642931_2643570_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2643765_2644311_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2644393_2644549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2644627_2644876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2645130_2645979_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2646047_2646641_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2646785_2647574_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2647681_2648329_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2648525_2648852_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2649045_2650179_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2650260_2650851_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2650844_2651642_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|2651635_2652448_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2652437_2653412_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_063328740.1|2653411_2655046_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2655727_2656042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2656190_2656721_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2656567:2656583	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2656803_2657847_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2658185_2658653_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2658805_2659078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2659277_2659403_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2659780_2660125_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2661346_2661904_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2662715_2662979_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2663110_2663323_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2663737_2664259_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2664449_2664689_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2665178_2665967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2666962_2668087_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2668534_2668747_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334551.1|2669000_2669672_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_001520226.1|2669991_2672103_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.9	2.1e-26
WP_000457876.1|2673636_2673762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031609383.1|2674332_2674533_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_047594311.1|2674629_2675208_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	83.6	3.8e-87
WP_047594313.1|2675207_2677637_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.3e-88
WP_000178849.1|2677690_2677933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047588350.1|2677971_2681334_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.2	0.0e+00
WP_006669493.1|2681396_2682044_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	7.1e-90
WP_000662740.1|2681941_2682679_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_023229841.1|2682685_2683384_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.2e-103
WP_000447370.1|2683393_2683723_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_047588341.1|2683725_2686767_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.8	4.1e-289
WP_077915924.1|2686738_2687077_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	6.0e-32
WP_000479607.1|2687073_2687469_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077915925.1|2687519_2688266_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	77.7	1.8e-100
WP_000033885.1|2688273_2688675_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2688671_2689250_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2689236_2689614_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201486.1|2689624_2689984_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2690041_2691070_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_047588326.1|2691124_2691472_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	5.4e-20
WP_047594315.1|2691484_2692981_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.1	4.0e-96
WP_023237960.1|2692970_2694551_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.0	4.3e-189
WP_039513171.1|2694547_2694751_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
WP_039513168.1|2694734_2696666_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
WP_001102153.1|2696637_2697183_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2697468_2697870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133404.1|2698096_2698546_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	85.7	1.9e-57
WP_047588313.1|2698578_2699205_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.7	5.1e-93
WP_162492809.1|2699207_2699549_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	3.7e-45
WP_047588307.1|2699824_2700511_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	99.1	1.4e-131
WP_000657897.1|2700725_2700914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047588304.1|2701403_2702093_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	2.4e-59
WP_000801757.1|2702089_2702230_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_047588299.1|2702226_2702454_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	84.0	3.8e-14
WP_000023105.1|2702450_2702888_-	protein ninB	NA	G8C7V3	Escherichia_phage	69.4	8.0e-53
WP_001166750.1|2703053_2703248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042836535.1|2703510_2703723_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	88.6	1.4e-26
WP_000687976.1|2703868_2704141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047588288.1|2704137_2704533_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.5	4.4e-18
WP_047588285.1|2704550_2705303_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	77.8	2.2e-103
WP_001672755.1|2706276_2706771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071891193.1|2706767_2706986_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_139783358.1|2707068_2707476_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	9.8e-29
WP_051973138.1|2707497_2707968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783770.1|2708249_2708555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047588280.1|2708583_2708892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047588279.1|2709329_2709614_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_047588277.1|2709687_2710041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063328741.1|2710180_2712886_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	56.8	4.8e-156
WP_001126032.1|2712878_2713709_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|2713744_2714065_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_047589030.1|2714057_2714390_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	60.6	3.1e-09
WP_047589032.1|2714386_2714890_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_047589036.1|2714939_2715176_+	excisionase	NA	NA	NA	NA	NA
WP_023139988.1|2715165_2716308_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.8e-173
WP_000444509.1|2716421_2717672_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2717843_2718509_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2718505_2718835_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2718846_2719308_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2719361_2720468_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2719987:2720003	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	2989859	2998941	4751034	protease,integrase	Ralstonia_phage(16.67%)	8	2988252:2988264	3007438:3007450
2988252:2988264	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2989859_2991101_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2991628_2992006_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2992167_2992365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2992577_2994854_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2994884_2995205_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2995528_2995750_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2995879_2997826_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2997822_2998941_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3007438:3007450	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	3355999	3395945	4751034	lysis,protease,coat,tail,portal,integrase,terminase	Salmonella_phage(59.32%)	59	3355410:3355456	3395959:3396005
3355410:3355456	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_057518439.1|3355999_3357922_+	acyltransferase	NA	C6ZR20	Salmonella_phage	98.8	0.0e+00
WP_077950598.1|3358266_3360384_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	98.4	0.0e+00
WP_063328743.1|3360539_3362510_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.4	0.0e+00
WP_063328689.1|3362509_3363832_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	98.0	1.0e-236
WP_023206221.1|3363874_3364564_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_015995284.1|3364566_3365022_-	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	100.0	2.3e-87
WP_057518443.1|3365021_3365723_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	99.6	5.2e-78
WP_063328744.1|3365726_3367145_-	hypothetical protein	NA	E7C9U1	Salmonella_phage	97.2	1.2e-270
WP_063328745.1|3367104_3367605_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	97.6	9.7e-87
WP_057518446.1|3367588_3367798_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	89.9	2.5e-28
WP_057518447.1|3367836_3369129_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	98.8	2.0e-240
WP_000433856.1|3369128_3370040_-	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_057518448.1|3370053_3372231_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
WP_000417866.1|3372230_3373730_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|3373707_3374196_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_063328746.1|3374199_3374604_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	96.3	8.4e-65
WP_023241520.1|3374603_3374993_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_000807788.1|3374996_3375239_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_023241521.1|3375495_3376026_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	99.4	5.6e-93
WP_023241522.1|3376242_3376710_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	98.7	1.4e-76
WP_023241523.1|3376706_3377204_-	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.8	3.2e-90
WP_000286100.1|3377181_3377385_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_063328747.1|3377849_3378368_-	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	97.7	3.6e-92
WP_063328748.1|3378364_3378544_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	2.7e-23
WP_000188966.1|3378524_3378728_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
WP_063328749.1|3378724_3379381_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	1.5e-39
WP_023206523.1|3379377_3379773_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
WP_063328750.1|3380028_3380205_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	94.8	3.9e-27
WP_000113771.1|3380201_3380384_-	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_000679702.1|3380350_3380524_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_063328751.1|3380520_3380958_-	recombination protein NinB	NA	C6ZR55	Salmonella_phage	96.6	4.6e-77
WP_024159562.1|3381031_3381301_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	98.9	1.4e-44
WP_058657041.1|3381297_3382674_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	99.1	1.8e-252
WP_001531205.1|3382670_3383504_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	4.6e-150
WP_001125981.1|3383496_3383643_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3383677_3383959_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3384069_3384285_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3384395_3385085_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000248006.1|3385173_3386097_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
WP_000786965.1|3386132_3386342_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_023200932.1|3386720_3387053_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.1e-51
WP_000246166.1|3387131_3387326_+	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_063328752.1|3387409_3388555_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	70.9	1.4e-67
WP_071891196.1|3388749_3388923_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	96.2	1.3e-22
WP_000156731.1|3388903_3389092_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3389081_3389225_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_020898894.1|3389221_3389929_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	1.9e-136
WP_057515781.1|3389929_3390436_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	91.1	7.3e-82
WP_001016182.1|3390444_3390993_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_010835872.1|3391009_3391303_+	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_071889686.1|3391313_3391478_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	92.6	6.7e-21
WP_057518456.1|3391498_3391828_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	96.2	6.0e-53
WP_001673392.1|3391824_3392058_+	hypothetical protein	NA	E9NIE8	Enterobacter_phage	41.0	5.1e-06
WP_063328753.1|3392054_3392414_+	Eaf protein	NA	T1SA95	Salmonella_phage	93.3	1.0e-61
WP_071891199.1|3392410_3393463_+	Ead protein	NA	A0A1V0E5L5	Salmonella_phage	58.8	2.5e-92
WP_063328754.1|3393464_3393683_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	97.2	4.1e-34
WP_145912976.1|3393686_3394277_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	60.6	6.8e-47
WP_158510309.1|3394411_3394552_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	2.7e-15
WP_063328755.1|3394781_3395945_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	4.5e-220
3395959:3396005	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	4121492	4130440	4751034	capsid,integrase	Enterobacteria_phage(83.33%)	12	4118716:4118732	4130610:4130626
4118716:4118732	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4121492_4123826_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4123840_4124161_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4124157_4124385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4124381_4124933_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4124929_4125196_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|4125300_4125429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075207146.1|4125670_4126480_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|4126483_4126723_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4126738_4127305_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4127743_4128685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4128693_4129149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4129171_4130440_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4130610:4130626	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 11
NZ_CP014665	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 chromosome, complete genome	4751034	4383154	4427932	4751034	tRNA,plate,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4383154_4384153_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4384240_4385551_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4385797_4386313_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4386412_4386622_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4386643_4386757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4386753_4388079_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4388257_4388866_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4388974_4389343_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4389513_4391934_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4392032_4392905_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4392918_4393416_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4393596_4394514_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4394677_4396036_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4396124_4397234_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4397595_4398786_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4398917_4400462_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4400476_4401367_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4401532_4401943_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4402085_4404182_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4404181_4404919_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4404915_4405584_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4405617_4405860_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4406303_4407953_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4408297_4409647_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4409777_4410125_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4410700_4410988_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4410990_4411596_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4411608_4411923_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4412082_4412538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4412534_4412732_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4412721_4414149_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4414148_4414673_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4414724_4415042_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4415001_4415130_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4415226_4417581_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4417580_4418534_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4418533_4418743_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4418730_4419774_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4419783_4420506_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4420833_4421196_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4421192_4422122_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4422121_4423669_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4423832_4424192_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4424182_4425298_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4425290_4425923_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4425925_4427407_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4427416_4427932_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
