The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	378945	388711	4534036	integrase	Enterobacteria_phage(87.5%)	13	378873:378893	388939:388959
378873:378893	attL	ATTGGTATACGTTTAGGTATA	NA	NA	NA	NA
WP_023196286.1|378945_380139_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	8.2e-108
WP_021000667.1|380168_380606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023196287.1|380773_381667_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_063308454.1|382073_382640_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	67.0	2.5e-62
WP_047352759.1|382658_382886_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_063308455.1|382882_383617_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.2	3.1e-73
WP_063308456.1|384167_384434_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	2.0e-22
WP_063308457.1|384430_384985_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.4e-33
WP_063308458.1|384977_385271_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	53.7	3.9e-19
WP_063308459.1|385263_385713_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	66.1	2.6e-43
WP_063308460.1|385785_386046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308461.1|386042_386363_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_063308462.1|386377_388711_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.3	0.0e+00
388939:388959	attR	ATTGGTATACGTTTAGGTATA	NA	NA	NA	NA
>prophage 2
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	2433145	2533235	4534036	protease,tail,integrase,head,terminase,capsid,tRNA,portal,lysis	Enterobacteria_phage(40.38%)	103	2429774:2429791	2471950:2471967
2429774:2429791	attL	AGCGCGTCATTCCCGTCA	NA	NA	NA	NA
WP_014883226.1|2433145_2433925_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_014883227.1|2433928_2435251_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_045282263.1|2435231_2435936_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_063308520.1|2435935_2440387_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_014883229.1|2440565_2442389_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_078310576.1|2442555_2443116_+	YcbK family protein	NA	NA	NA	NA	NA
WP_045134657.1|2443136_2443784_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014883232.1|2443836_2445027_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_072093609.1|2445211_2446315_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.5	1.4e-98
WP_014883234.1|2446925_2448326_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	1.4e-79
WP_045281289.1|2448490_2449693_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	2.9e-44
WP_063308521.1|2449877_2451170_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	94.2	1.6e-237
WP_013097283.1|2451214_2451472_-	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_052954565.1|2451455_2451842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047345117.1|2451829_2452573_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	93.5	2.1e-130
WP_042889584.1|2452618_2453446_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	85.1	2.2e-112
WP_045326846.1|2453442_2453637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058684728.1|2453636_2454044_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.6	1.9e-24
WP_063308522.1|2454233_2454641_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.4	1.2e-47
WP_063308523.1|2454633_2454864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308524.1|2454970_2455360_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	58.8	5.8e-31
WP_063308525.1|2455426_2455858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063308526.1|2456058_2456691_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	38.5	2.3e-32
WP_071890822.1|2456801_2457017_+	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	45.3	6.5e-08
WP_063308527.1|2457013_2457925_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	63.6	3.7e-92
WP_063308528.1|2457940_2458822_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	63.7	5.1e-83
WP_063308529.1|2458818_2460198_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	3.4e-174
WP_047363380.1|2460225_2461041_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.1	1.6e-115
WP_045343415.1|2461522_2462065_+	HNH endonuclease	NA	D6PIK0	uncultured_phage	41.2	5.7e-24
WP_023622516.1|2462167_2462392_+|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	95.9	2.1e-33
WP_044901837.1|2462369_2462864_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.6	5.4e-90
WP_063308530.1|2462860_2463238_+	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	63.4	5.7e-15
WP_071890824.1|2463218_2463395_+	rz1 lytic protein	NA	U5P461	Shigella_phage	56.6	1.7e-09
WP_080964258.1|2463737_2464040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078310420.1|2464580_2465228_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	74.8	4.1e-61
WP_045133824.1|2465238_2465466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308531.1|2465483_2466941_+	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	90.1	1.1e-268
WP_057992063.1|2467074_2467326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308770.1|2467489_2468080_+	hypothetical protein	NA	S4TR53	Salmonella_phage	81.5	8.2e-93
WP_071890829.1|2468079_2468436_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	77.2	8.2e-48
WP_045332660.1|2469256_2469730_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
WP_016063095.1|2469729_2471466_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
WP_063308532.1|2471465_2472770_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.1	1.2e-232
2471950:2471967	attR	AGCGCGTCATTCCCGTCA	NA	NA	NA	NA
WP_047717738.1|2472783_2473632_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	2.4e-138
WP_063308533.1|2473641_2474853_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.3	4.7e-196
WP_063308534.1|2474893_2475190_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	83.0	5.8e-15
WP_059362068.1|2475189_2475516_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	92.6	1.2e-53
WP_032665834.1|2475512_2475857_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	57.3	1.1e-25
WP_032665836.1|2475837_2476221_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.5	2.8e-41
WP_032665838.1|2476223_2476628_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	9.7e-45
WP_032104401.1|2476660_2477113_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
WP_032665840.1|2477176_2477539_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.2	1.1e-26
WP_032665842.1|2477777_2481107_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.5	0.0e+00
WP_032610603.1|2481109_2481448_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
WP_032610602.1|2481444_2482200_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
WP_032610600.1|2482201_2482912_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
WP_032610599.1|2482940_2483288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610598.1|2483314_2483905_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
WP_063308535.1|2483959_2487793_+|tail	phage tail protein	tail	Q9MCR7	Enterobacteria_phage	83.6	0.0e+00
WP_063308536.1|2487794_2488760_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.1	1.1e-57
WP_156491237.1|2489585_2489948_+	hypothetical protein	NA	A0A2I6PD03	Escherichia_phage	57.0	5.3e-26
WP_023296458.1|2490079_2490346_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	95.5	4.7e-40
WP_045281288.1|2490770_2493383_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	9.1e-19
WP_014883237.1|2493485_2494256_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	6.4e-29
WP_014883238.1|2494252_2495044_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_032637061.1|2495053_2496199_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_014883240.1|2496195_2497158_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045281287.1|2497150_2497726_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_014883242.1|2497975_2498986_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014883243.1|2499151_2499694_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_045281286.1|2499690_2500800_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	39.1	4.1e-05
WP_063308537.1|2500898_2503007_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_014883246.1|2503019_2504927_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	6.2e-49
WP_014883247.1|2504940_2506194_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_014883248.1|2506198_2507839_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_014883249.1|2507835_2508402_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|2508658_2508826_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227926.1|2508897_2509416_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_014883250.1|2509484_2511245_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_023332611.1|2511431_2511884_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_014883252.1|2511948_2513004_-	porin OmpA	NA	NA	NA	NA	NA
WP_014883253.1|2513359_2513869_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_032637053.1|2514086_2514713_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_023332614.1|2514669_2516832_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_014883256.1|2516851_2517298_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_045281285.1|2517421_2519476_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	7.9e-18
WP_008499922.1|2519534_2519993_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023332617.1|2520073_2520736_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_014883259.1|2520909_2521323_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_008499919.1|2521359_2521677_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_045134648.1|2521737_2522928_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_032637048.1|2523102_2523660_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_045134647.1|2523670_2524459_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045281283.1|2524470_2524752_+	acylphosphatase	NA	NA	NA	NA	NA
WP_008499913.1|2524748_2525078_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023332622.1|2525147_2525699_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_127312439.1|2525709_2526864_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_045281281.1|2526868_2529586_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023332625.1|2529658_2530165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127312440.1|2530240_2530960_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032637043.1|2531292_2532048_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032637041.1|2532044_2532521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097244.1|2532575_2533235_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	8.9e-48
>prophage 3
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	2553089	2615895	4534036	protease,plate,coat,transposase	Enterobacteria_phage(28.57%)	40	NA	NA
WP_063308553.1|2553089_2554784_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_156491214.1|2554894_2557825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308555.1|2558223_2559861_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	5.5e-38
WP_063308556.1|2560901_2562392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082826296.1|2563206_2563476_-	DUF2165 family protein	NA	NA	NA	NA	NA
WP_082826297.1|2563349_2563709_-	DUF2165 family protein	NA	NA	NA	NA	NA
WP_071890842.1|2563912_2564578_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_063308558.1|2565089_2565377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491215.1|2566396_2567500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308561.1|2570611_2571121_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_082826298.1|2571117_2572608_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_156491216.1|2572677_2573226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491217.1|2573421_2573853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082826299.1|2574080_2575934_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_063308564.1|2575924_2576863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308565.1|2576864_2578763_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	21.9	1.6e-12
WP_063308566.1|2578806_2580099_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_063308567.1|2580399_2581146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082826300.1|2581129_2582548_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_063308569.1|2582548_2582962_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_063308570.1|2583453_2584380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491218.1|2584319_2586689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082826301.1|2589296_2589623_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_156491219.1|2589838_2590540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491220.1|2590569_2591058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491221.1|2591561_2591843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156491222.1|2597862_2598006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071890903.1|2599173_2600091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308574.1|2600135_2600642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308575.1|2601102_2601396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308576.1|2601541_2602051_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.1	1.4e-08
WP_063308578.1|2602861_2603977_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	3.2e-114
WP_156491223.1|2604598_2605078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308582.1|2608231_2608645_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	72.6	1.2e-29
WP_063308583.1|2608641_2608992_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_082826302.1|2610747_2610939_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	68.9	1.5e-16
WP_063308586.1|2611299_2611821_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_063308587.1|2611834_2612560_+	molecular chaperone	NA	NA	NA	NA	NA
WP_082826303.1|2612531_2614895_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_063308588.1|2614926_2615895_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	3538958	3600616	4534036	protease,tail,integrase,plate,head,holin,terminase,capsid,portal,lysis	Erwinia_phage(22.5%)	69	3566601:3566617	3600699:3600715
WP_045281237.1|3538958_3540005_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	2.1e-19
WP_014884093.1|3540256_3541018_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	1.8e-07
WP_023337380.1|3541014_3541605_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014884095.1|3541640_3542519_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|3542615_3543236_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_045281236.1|3543232_3544114_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|3544253_3544298_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_045281235.1|3544394_3545957_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_014884098.1|3545956_3547552_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	7.2e-51
WP_014884099.1|3547555_3548914_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.6	3.3e-36
WP_014884100.1|3548924_3550118_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_045281234.1|3550117_3550927_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_023330557.1|3551193_3552450_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014884103.1|3552604_3552817_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	8.4e-24
WP_032629007.1|3553309_3553915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884106.1|3553978_3554638_-	DsbA family protein	NA	NA	NA	NA	NA
WP_014884107.1|3554767_3555247_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014884108.1|3555387_3556209_+	alpha/beta hydrolase	NA	A0A1D8EW21	Mycobacterium_phage	25.3	3.7e-11
WP_045281233.1|3556285_3557053_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045281232.1|3557309_3558329_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045281231.1|3558428_3559208_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_045281230.1|3559445_3559994_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045281229.1|3560171_3561383_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_014884113.1|3561379_3561613_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_155404566.1|3561807_3561978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884115.1|3562124_3562757_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_049010621.1|3563038_3563443_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014884117.1|3563468_3564212_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_014884118.1|3564269_3564809_+	septation protein A	NA	NA	NA	NA	NA
WP_008502796.1|3564913_3565309_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_014884119.1|3565345_3566074_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_045281228.1|3566296_3566593_+	YciI family protein	NA	NA	NA	NA	NA
3566601:3566617	attL	AAGGCTCCCTCAGGAGC	NA	NA	NA	NA
WP_063308664.1|3566739_3567216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308665.1|3567417_3568194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071890866.1|3568302_3568524_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	71.2	2.7e-25
WP_063308666.1|3568600_3569770_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.3	2.7e-172
WP_059372334.1|3569766_3570231_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	69.4	6.1e-59
WP_063308667.1|3570243_3572691_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	73.1	2.5e-289
WP_063308668.1|3572680_3572803_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	1.0e-13
WP_045269020.1|3572835_3573144_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	2.4e-27
WP_063308669.1|3573204_3573723_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	6.5e-78
WP_063308670.1|3573735_3574929_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.6	6.8e-187
WP_023333113.1|3575051_3575456_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	45.5	1.7e-25
WP_063308671.1|3575467_3577498_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.5	5.3e-91
WP_063308672.1|3577509_3578040_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	6.9e-91
WP_063308673.1|3578032_3578941_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	83.4	1.4e-136
WP_023338715.1|3578946_3579297_-	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	69.8	1.5e-38
WP_063308674.1|3579293_3579935_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	82.2	5.0e-96
WP_063308675.1|3582944_3583391_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.9	3.8e-42
WP_063308676.1|3583383_3583851_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.3e-61
WP_072163335.1|3583813_3584059_-|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_063145448.1|3583946_3584372_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.1	1.6e-45
WP_063308677.1|3584368_3584878_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.1	7.1e-77
WP_063308678.1|3584861_3585083_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	1.6e-25
WP_063308679.1|3585073_3585277_-|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	77.6	1.6e-24
WP_047361211.1|3585276_3585783_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	1.4e-61
WP_063308680.1|3585882_3586638_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.9	2.4e-73
WP_063308681.1|3586641_3587709_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.1	4.3e-169
WP_063308682.1|3587764_3588619_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	74.6	5.3e-117
WP_063308683.1|3588785_3590555_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.7	3.9e-300
WP_063308684.1|3590556_3591582_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.5	1.2e-168
WP_048987999.1|3591896_3592958_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	25.4	1.2e-17
WP_063308685.1|3592954_3594019_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	47.4	1.4e-55
WP_156491234.1|3594008_3595175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884151.1|3597564_3597828_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_063308687.1|3597850_3598069_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	64.8	4.9e-11
WP_032658818.1|3598801_3599077_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	84.4	1.5e-41
WP_032658822.1|3599212_3599509_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	70.1	9.6e-34
WP_047361185.1|3599605_3600616_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.4	4.7e-149
3600699:3600715	attR	AAGGCTCCCTCAGGAGC	NA	NA	NA	NA
>prophage 5
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	3875586	3924390	4534036	tail,integrase,head,holin,terminase,lysis	Enterobacteria_phage(32.79%)	74	3906364:3906378	3927932:3927946
WP_063308699.1|3875586_3876852_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	2.6e-205
WP_080335852.1|3876853_3877162_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	51.4	3.1e-11
WP_063308700.1|3877274_3877637_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	74.2	7.3e-44
WP_045135348.1|3877633_3878551_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	92.1	8.3e-161
WP_131619240.1|3878600_3880187_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	33.3	1.5e-48
WP_063308701.1|3880405_3882622_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	60.6	7.4e-38
WP_063308702.1|3882679_3885157_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	92.6	0.0e+00
WP_063308703.1|3885143_3885509_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	87.4	5.1e-61
WP_063308704.1|3885522_3885993_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	1.6e-78
WP_063308705.1|3885992_3886490_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	92.1	1.6e-89
WP_045135341.1|3886531_3886759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308706.1|3886769_3889568_-|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	52.9	3.8e-180
WP_063308707.1|3889580_3890252_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.2	1.0e-54
WP_063308708.1|3890309_3891053_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	84.6	2.6e-72
WP_063308709.1|3891116_3891500_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	5.7e-39
WP_063308710.1|3891496_3891961_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	50.3	7.7e-30
WP_016245422.1|3891963_3892320_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	57.3	7.2e-28
WP_057060243.1|3892319_3892493_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	1.6e-12
WP_014883998.1|3892492_3892873_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	3.1e-29
WP_014883999.1|3892875_3893241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884000.1|3893250_3894348_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_014884001.1|3894357_3894792_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	73.6	1.1e-51
WP_014884002.1|3894795_3896184_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.3	1.0e-149
WP_063308711.1|3896253_3896733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308712.1|3896778_3897780_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	5.4e-113
WP_063308713.1|3897706_3899176_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	9.9e-148
WP_063308714.1|3899188_3900487_-|terminase	terminase	terminase	Q5G8Y7	Enterobacteria_phage	96.5	3.1e-246
WP_063308715.1|3900470_3900938_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	67.8	2.1e-51
WP_063308716.1|3900969_3901608_-	hypothetical protein	NA	I6S676	Salmonella_phage	91.5	1.0e-112
WP_063308717.1|3901611_3901818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150211.1|3901928_3902378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032665710.1|3902842_3903361_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	98.3	7.9e-92
WP_156491238.1|3903551_3903983_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	67.1	4.6e-45
WP_063308719.1|3904018_3904459_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	78.5	5.2e-60
WP_122008274.1|3904445_3904751_-|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_063308720.1|3905273_3905771_-	antiterminator	NA	G8C7V7	Escherichia_phage	98.2	5.3e-93
WP_156491235.1|3905770_3905887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308721.1|3905883_3906246_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	7.3e-52
WP_063308722.1|3906242_3906533_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	5.3e-45
3906364:3906378	attL	CAGCTGCTGCATGCG	NA	NA	NA	NA
WP_063308723.1|3906525_3906696_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	94.3	1.5e-20
WP_063308724.1|3906695_3907151_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	5.8e-54
WP_141192643.1|3907397_3907640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063308726.1|3907636_3908215_-	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	83.6	1.1e-70
WP_063308727.1|3908211_3908409_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	96.9	2.2e-26
WP_047345151.1|3908405_3908750_-	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	95.6	4.6e-56
WP_063308728.1|3908921_3909794_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	69.1	1.5e-95
WP_063308729.1|3909778_3910648_-	replication protein	NA	K7PGT1	Enterobacteria_phage	50.8	2.3e-67
WP_063308730.1|3910733_3911279_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	97.8	1.1e-94
WP_025913385.1|3911308_3911536_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
WP_047345900.1|3911647_3912352_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.1	2.7e-103
WP_063308731.1|3912388_3912874_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_063308732.1|3913537_3914206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308733.1|3914367_3914619_+	hypothetical protein	NA	Q9MC84	Pseudomonas_phage	41.8	2.5e-06
WP_001752704.1|3914770_3914977_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_063308735.1|3915053_3916025_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	95.3	7.4e-83
WP_022651075.1|3916032_3916317_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.0e-48
WP_032647505.1|3916335_3917082_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_032647504.1|3917078_3917696_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.3	3.6e-59
WP_063308736.1|3917692_3918121_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	94.4	1.7e-71
WP_063308737.1|3918117_3918270_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	9.6e-06
WP_047028423.1|3918266_3918749_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.6	2.7e-70
WP_063308738.1|3918745_3919405_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	92.7	6.1e-121
WP_063308739.1|3919401_3919608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308740.1|3919604_3920216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650956.1|3920212_3920404_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	4.1e-14
WP_063308741.1|3920400_3920721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308742.1|3920812_3921238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063308743.1|3921239_3921458_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	2.1e-17
WP_065422745.1|3921457_3921850_+	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	34.1	4.4e-10
WP_063308744.1|3921827_3922067_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	3.7e-28
WP_063308745.1|3922076_3922403_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	80.0	5.6e-43
WP_063308746.1|3922594_3922795_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	98.5	2.1e-32
WP_063308747.1|3922803_3923049_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	66.7	1.2e-26
WP_063308748.1|3923094_3924390_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.2	1.5e-179
3927932:3927946	attR	CGCATGCAGCAGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP015227	Enterobacter sp. ODB01 chromosome, complete genome	4534036	4015548	4022976	4534036		Enterobacteria_phage(50.0%)	7	NA	NA
WP_045281012.1|4015548_4016553_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.7	1.0e-34
WP_045134937.1|4016604_4017771_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.0	3.5e-111
WP_014884476.1|4018025_4019432_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_023330866.1|4019567_4020116_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	4.1e-54
WP_063308755.1|4020126_4021023_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_014884479.1|4021029_4021896_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	4.1e-109
WP_014884480.1|4021911_4022976_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	1.1e-100
