The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	1191360	1197164	4783492		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1191360_1193694_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1193708_1194029_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1194025_1194253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1194249_1194801_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1194797_1195064_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1195601_1196339_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1196335_1196581_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1196597_1197164_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	1200694	1263846	4783492	integrase,capsid,lysis,head,portal,tRNA,plate,tail,terminase	Salmonella_phage(91.3%)	65	1200531:1200577	1234789:1234835
1200531:1200577	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1200694_1201720_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1201723_1202356_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1202475_1202718_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460858.1|1202750_1203260_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000957775.1|1203267_1203501_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1203448_1203907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963196.1|1204126_1204468_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	1.2e-48
WP_001244234.1|1204535_1204769_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1204768_1204996_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104121.1|1204992_1205850_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	3.5e-129
WP_063314681.1|1205840_1208270_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	92.1	0.0e+00
WP_001154434.1|1208422_1208611_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217566.1|1208621_1208855_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	3.7e-33
WP_058657309.1|1208928_1209189_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	58.1	5.5e-17
WP_058657308.1|1209237_1209849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058657997.1|1210148_1211405_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_058657996.1|1211445_1212489_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.3	6.1e-184
WP_063314683.1|1212488_1214255_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216274.1|1214397_1215231_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	95.3	8.5e-128
WP_000730754.1|1215247_1216315_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1216318_1216969_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1217062_1217527_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1217526_1217730_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1217733_1217949_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_040230503.1|1217929_1218439_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	8.3e-94
WP_063314684.1|1218443_1218821_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.8e-61
WP_162492823.1|1218817_1219246_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	8.6e-68
WP_001039961.1|1219341_1219773_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_063314686.1|1219765_1220212_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.2e-64
WP_063314687.1|1220280_1220859_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	5.7e-107
WP_000177404.1|1220855_1221215_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	95.8	9.8e-57
WP_063314688.1|1221201_1222110_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.7	6.5e-158
WP_001086806.1|1222102_1222708_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	8.3e-117
WP_063314689.1|1222704_1224513_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	82.2	7.3e-209
WP_001287104.1|1224519_1224927_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077906433.1|1224930_1225548_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	3.1e-95
WP_077908780.1|1225517_1226363_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	84.4	1.1e-114
WP_001165558.1|1226332_1226890_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_063314690.1|1226992_1228165_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.2	4.9e-222
WP_001207653.1|1228174_1228690_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1228744_1229047_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1229061_1229181_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_063314691.1|1229173_1231981_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.6	0.0e+00
WP_000980409.1|1231977_1232463_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_063314692.1|1232459_1233560_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.0	1.5e-188
WP_000972388.1|1233626_1233845_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
WP_023232928.1|1234129_1234720_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	76.7	2.3e-47
WP_072101134.1|1235224_1236388_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1234789:1234835	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1236395_1238576_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1238572_1239982_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1240046_1251521_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1252140_1252623_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1252772_1253249_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1253238_1253529_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1253694_1254033_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1254181_1255843_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1255928_1256807_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1256929_1257520_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1257554_1258160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1258280_1259567_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1259586_1260378_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1260543_1261905_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1262218_1262467_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1262485_1263034_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1263078_1263846_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	1754311	1763482	4783492	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1754311_1755259_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1755242_1755974_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1755954_1756062_-	protein YohO	NA	NA	NA	NA	NA
WP_063314699.1|1756121_1756853_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1757075_1758761_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1758757_1759477_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1759523_1759991_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1760047_1760578_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1760749_1761208_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1761448_1763482_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	1831574	1837871	4783492		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1831574_1832978_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1833155_1834049_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1834425_1835511_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1835510_1836410_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1836457_1837336_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1837340_1837871_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	1948161	1955410	4783492		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1948161_1948581_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1948583_1949852_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1950306_1950519_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1950529_1950718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1950977_1952171_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1952819_1953131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1953210_1953906_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1953979_1955410_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	2058664	2066427	4783492	integrase	Enterobacteria_phage(28.57%)	12	2060874:2060896	2072997:2073019
WP_000856224.1|2058664_2058895_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2059032_2059407_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_077950588.1|2059407_2060283_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2060299_2060653_+	YebY family protein	NA	NA	NA	NA	NA
2060874:2060896	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2061024_2062104_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2062100_2063207_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2063237_2063468_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2063521_2064055_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2064311_2064479_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2064543_2064732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2064786_2065278_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2065830_2066427_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2072997:2073019	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	2672250	2751596	4783492	integrase,capsid,head,tRNA,portal,plate,tail,holin,protease,terminase	Salmonella_phage(56.9%)	103	2692888:2692904	2751115:2751131
WP_023893413.1|2672250_2672769_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2672765_2672873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2673078_2673525_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2673504_2674299_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2674399_2675584_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2675702_2676050_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2676035_2676347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2676415_2676667_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2676862_2676961_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2677099_2677348_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2677661_2678303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2678532_2678715_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2678717_2679080_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2679252_2679891_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2680086_2680632_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2680714_2680870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2680948_2681197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2681451_2682300_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2682368_2682962_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2683106_2683895_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2684002_2684650_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2684846_2685173_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2685366_2686500_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2686581_2687172_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2687165_2687963_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|2687956_2688769_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2688758_2689733_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2689732_2691367_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2692048_2692363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2692511_2693042_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2692888:2692904	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2693124_2694168_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2694506_2694974_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2695126_2695399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2695598_2695724_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2696101_2696446_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2697667_2698225_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2699036_2699300_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2699431_2699644_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2700058_2700580_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2700770_2701010_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2701499_2702288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2703283_2704408_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2704855_2705068_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2705321_2705993_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2705985_2707254_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2707256_2707676_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2708012_2708225_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2708349_2709483_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2709520_2709733_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2709722_2710328_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2710297_2711551_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2711537_2712125_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|2712127_2713207_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2713199_2713613_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2713617_2714151_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2714150_2715209_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2715205_2716546_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2716579_2718508_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2718592_2718919_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2718915_2719272_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2719271_2720768_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2720757_2720922_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2720943_2721489_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2721485_2721998_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2721969_2722383_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2722394_2722718_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_047643298.1|2722717_2722933_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.4e-10
WP_023171046.1|2722976_2724194_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|2724203_2725052_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2725065_2726370_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2726369_2728112_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2728065_2728530_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2728662_2729007_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2729141_2729369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2729465_2729843_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2729885_2730425_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|2730421_2731036_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|2731035_2731317_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2731303_2731690_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2731840_2732764_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2732870_2733701_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2733731_2734721_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2734728_2735589_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2735605_2735995_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2735991_2736885_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2736884_2737367_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2737368_2738328_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2738324_2738549_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|2738545_2739688_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2739684_2740239_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2740267_2740492_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2740589_2741285_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2742099_2742471_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2742528_2743356_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2743492_2744032_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|2744833_2745307_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2746067_2746304_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2746293_2747436_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2747549_2748800_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2748971_2749637_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2749633_2749963_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2749974_2750436_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2750489_2751596_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2751115:2751131	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	2896407	2940278	4783492	integrase,capsid,lysis,plate,tail,protease	Salmonella_phage(58.33%)	60	2923739:2923752	2942971:2942984
WP_000938188.1|2896407_2897088_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000503667.1|2897836_2898484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2898526_2898724_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2898906_2899152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2899349_2899742_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2899851_2900460_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2900522_2900708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2900956_2901475_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2901489_2903022_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2903021_2903702_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_063314707.1|2903698_2904898_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.5	4.0e-211
WP_001270641.1|2904898_2905252_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2905251_2906004_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2906122_2906578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2906661_2906994_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|2906990_2908058_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|2908060_2908363_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|2908362_2908938_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|2908937_2910947_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|2911124_2911577_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|2911580_2912024_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|2912036_2913182_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|2913185_2913749_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|2913723_2914113_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|2914099_2914654_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|2914650_2915058_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|2915023_2915413_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|2915454_2916396_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|2916407_2916905_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|2916909_2918142_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|2918145_2918892_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|2918776_2920246_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|2920245_2921868_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|2921870_2922500_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|2923000_2923456_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
2923739:2923752	attL	GTCATTTTTTGGTG	NA	NA	NA	NA
WP_000951228.1|2923773_2924313_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|2924290_2924593_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2924795_2924984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2925376_2925955_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2925951_2926245_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2926241_2926838_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2926906_2927098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2927281_2927620_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|2927619_2927790_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2927786_2928389_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2928381_2928630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2928633_2929314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2929351_2930740_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2930736_2931717_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2931719_2931944_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2931966_2932413_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_023972394.1|2932818_2933274_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_000387662.1|2933958_2934282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2934289_2934535_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_023223248.1|2934564_2936838_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.9	3.6e-104
WP_000205292.1|2936834_2937389_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2937391_2937574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2937786_2938011_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2938011_2939031_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2939618_2940278_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2942971:2942984	attR	GTCATTTTTTGGTG	NA	NA	NA	NA
>prophage 9
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	3062863	3071945	4783492	protease,integrase	Ralstonia_phage(16.67%)	8	3061256:3061268	3080442:3080454
3061256:3061268	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3062863_3064105_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3064632_3065010_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3065171_3065369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3065581_3067858_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3067888_3068209_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3068532_3068754_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3068883_3070830_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3070826_3071945_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3080442:3080454	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 10
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	4153950	4162898	4783492	integrase	Enterobacteria_phage(83.33%)	11	4151174:4151190	4163068:4163084
4151174:4151190	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4153950_4156284_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4156298_4156619_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4156615_4156843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4156839_4157391_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4157387_4157654_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_023244191.1|4158194_4158938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|4158941_4159181_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4159196_4159763_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4160201_4161143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4161151_4161607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4161629_4162898_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4163068:4163084	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 11
NZ_CP014664	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 chromosome, complete genome	4783492	4415612	4460390	4783492	plate,tail,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4415612_4416611_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4416698_4418009_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4418255_4418771_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4418870_4419080_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4419101_4419215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4419211_4420537_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4420715_4421324_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4421432_4421801_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4421971_4424392_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4424490_4425363_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4425376_4425874_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4426054_4426972_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4427135_4428494_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4428582_4429692_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4430053_4431244_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4431375_4432920_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4432934_4433825_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4433990_4434401_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4434543_4436640_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4436639_4437377_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4437373_4438042_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4438075_4438318_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4438761_4440411_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4440755_4442105_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4442235_4442583_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4443158_4443446_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4443448_4444054_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4444066_4444381_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4444540_4444996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4444992_4445190_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4445179_4446607_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4446606_4447131_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4447182_4447500_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4447459_4447588_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4447684_4450039_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4450038_4450992_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4450991_4451201_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4451188_4452232_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4452241_4452964_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4453291_4453654_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4453650_4454580_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4454579_4456127_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4456290_4456650_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4456640_4457756_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4457748_4458381_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4458383_4459865_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4459874_4460390_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
