The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	1153185	1158989	4836393		Enterobacteria_phage(100.0%)	8	NA	NA
WP_063328652.1|1153185_1155519_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_000743150.1|1155533_1155854_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1155850_1156078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1156074_1156626_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1156622_1156889_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1157426_1158164_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1158160_1158406_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1158422_1158989_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	1162517	1225612	4836393	capsid,head,plate,tRNA,integrase,lysis,portal,terminase,tail	Salmonella_phage(90.91%)	64	1162356:1162402	1196555:1196601
1162356:1162402	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_006493480.1|1162517_1163744_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1163750_1164767_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1164768_1165401_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1165520_1165763_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1165795_1166305_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1166391_1166667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1166751_1166946_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1166909_1167251_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1167318_1167546_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1167545_1167773_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1167769_1168627_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1168623_1171017_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1171036_1171264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1171401_1171590_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1171920_1173123_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1173085_1174003_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1174049_1175084_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1175083_1176850_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1176992_1177826_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1177842_1178910_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1178913_1179564_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1179657_1180122_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1180121_1180325_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1180328_1180544_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1180524_1181034_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1181038_1181413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1181409_1181838_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1181933_1182365_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1182357_1182804_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1182872_1183451_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1183447_1183807_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1183793_1184702_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1184694_1185300_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_045791118.1|1185296_1186871_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
WP_006501158.1|1186840_1187458_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_001287104.1|1187461_1187869_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077918804.1|1187875_1188955_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_006501163.1|1188924_1189482_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1189584_1190757_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1190766_1191282_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1191336_1191639_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1191653_1191773_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1191765_1194573_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1194569_1195055_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1195051_1196152_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1196220_1196439_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1196990_1198154_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1196555:1196601	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1198161_1200342_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1200338_1201748_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1201812_1213287_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1213906_1214389_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1214538_1215015_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1215004_1215295_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1215460_1215799_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1215947_1217609_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1217694_1218573_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1218695_1219286_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1219320_1219926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1220046_1221333_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1221352_1222144_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1222309_1223671_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1223984_1224233_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1224251_1224800_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1224844_1225612_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	1716063	1725234	4836393	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1716063_1717011_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1716994_1717726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1717706_1717814_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1717873_1718605_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1718827_1720513_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1720509_1721229_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1721275_1721743_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1721799_1722330_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1722501_1722960_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1723200_1725234_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	1793326	1799623	4836393		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1793326_1794730_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1794907_1795801_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1796177_1797263_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1797262_1798162_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1798209_1799088_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1799092_1799623_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	1909913	1917162	4836393		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1909913_1910333_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1910335_1911604_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1912058_1912271_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1912281_1912470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1912729_1913923_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1914571_1914883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1914962_1915658_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1915731_1917162_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	2021482	2075383	4836393	head,plate,lysis,integrase,tail	Salmonella_phage(18.18%)	79	2023692:2023714	2081953:2081975
WP_000856224.1|2021482_2021713_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2021850_2022225_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_078274696.1|2022225_2023101_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2023117_2023471_+	YebY family protein	NA	NA	NA	NA	NA
2023692:2023714	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_046722458.1|2023844_2024924_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.2	1.2e-105
WP_031603794.1|2024904_2025177_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_046722457.1|2025237_2025666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524360.1|2025764_2025944_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_063267783.1|2026491_2026917_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	83.8	5.2e-65
WP_063267784.1|2026920_2027394_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	7.3e-68
WP_063267849.1|2027393_2027780_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	78.4	1.9e-37
WP_063267785.1|2027782_2028097_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.0	1.0e-33
WP_063267786.1|2028132_2028963_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_063267787.1|2028955_2031646_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	71.8	5.2e-118
WP_000799629.1|2031786_2032122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2032197_2032404_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2032408_2032684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2032944_2033124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165607.1|2033567_2033993_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_001033911.1|2034089_2034344_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_063328658.1|2034330_2034825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722453.1|2034872_2035880_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	70.2	3.2e-129
WP_161490015.1|2035791_2036334_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	2.4e-67
WP_052909347.1|2036346_2036742_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.8	1.7e-17
WP_052909348.1|2036738_2037011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2037217_2037370_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000911591.1|2037619_2037868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052909349.1|2037931_2038531_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	1.1e-97
WP_021000145.1|2038527_2038722_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_052909350.1|2038718_2039000_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.3e-35
WP_063328660.1|2038996_2039533_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	1.3e-65
WP_023220365.1|2039740_2039917_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_001270289.1|2039967_2040375_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
WP_063328661.1|2040489_2040696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165599.1|2040686_2041235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909366.1|2041410_2041713_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052909353.1|2041690_2042230_+	lysozyme	NA	S5MQK2	Escherichia_phage	73.6	4.9e-76
WP_052909354.1|2042538_2043009_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	78.6	1.1e-60
WP_046722450.1|2043082_2043286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722449.1|2043365_2043758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140439918.1|2043798_2044149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722447.1|2044477_2044678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722446.1|2044681_2045311_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	1.5e-108
WP_046722445.1|2045313_2046933_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.0	1.3e-260
WP_046722444.1|2046932_2048453_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.9	3.3e-106
WP_001525462.1|2048493_2049183_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	4.5e-58
WP_023220053.1|2049179_2050526_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	4.2e-68
WP_046722443.1|2050527_2051010_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_001031913.1|2051009_2052038_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_046722442.1|2052041_2052389_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	36.3	9.6e-09
WP_000537613.1|2052395_2052851_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	9.6e-17
WP_001525439.1|2052844_2053429_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	7.2e-17
WP_001048640.1|2053425_2053791_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.0e-20
WP_001525438.1|2053775_2054321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525460.1|2054301_2055786_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.4	4.7e-89
WP_000016414.1|2055786_2056233_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2056232_2056637_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|2056678_2056861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722441.1|2056844_2059016_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.1e-49
WP_023219641.1|2059012_2059723_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_001525448.1|2059722_2060025_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_001525442.1|2060021_2060891_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	33.1	4.1e-32
WP_023219640.1|2060871_2061549_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	4.1e-32
WP_001191865.1|2061561_2061918_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_023219639.1|2061914_2063156_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_022742713.1|2063157_2063760_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_046722440.1|2063749_2065210_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	75.8	2.1e-44
WP_046722439.1|2065206_2066031_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	91.2	6.8e-146
WP_001525039.1|2066020_2066590_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.7	1.1e-89
WP_046722438.1|2066740_2067595_+	protein YibB	NA	NA	NA	NA	NA
WP_046722437.1|2067667_2069209_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_020438172.1|2069980_2071060_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2071056_2072163_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2072193_2072424_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2072477_2073011_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2073267_2073435_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2073499_2073688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2073742_2074234_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2074786_2075383_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2081953:2081975	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	2682444	2761790	4836393	holin,protease,plate,head,tRNA,portal,integrase,capsid,terminase,tail	Salmonella_phage(55.93%)	103	2703082:2703098	2761309:2761325
WP_023893413.1|2682444_2682963_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2682959_2683067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2683272_2683719_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2683698_2684493_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2684593_2685778_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2685896_2686244_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2686229_2686541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2686609_2686861_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2687056_2687155_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2687293_2687542_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2687855_2688497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2688726_2688909_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2688911_2689274_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2689446_2690085_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2690280_2690826_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2690908_2691064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2691142_2691391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2691645_2692494_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2692562_2693156_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2693300_2694089_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2694196_2694844_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2695040_2695367_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2695560_2696694_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2696775_2697366_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2697359_2698157_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2698150_2698963_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2698952_2699927_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2699926_2701561_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2702242_2702557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2702705_2703236_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2703082:2703098	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2703318_2704362_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2704700_2705168_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2705320_2705593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2705792_2705918_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2706295_2706640_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2707861_2708419_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2709230_2709494_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2709625_2709838_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2710252_2710774_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2710964_2711204_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2711693_2712482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2713477_2714602_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2715049_2715262_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2715515_2716187_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2716179_2717448_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2717450_2717870_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2718206_2718419_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2718543_2719677_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2719714_2719927_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2719916_2720522_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2720491_2721745_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2721731_2722319_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023171040.1|2722321_2723401_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	98.9	3.6e-203
WP_000605051.1|2723393_2723807_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2723811_2724345_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2724344_2725403_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2725399_2726740_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2726773_2728702_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2728786_2729113_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2729109_2729466_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2729465_2730962_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2730951_2731116_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2731137_2731683_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2731679_2732192_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2732163_2732577_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2732588_2732912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_047643298.1|2732911_2733127_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.4e-10
WP_023171046.1|2733170_2734388_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|2734397_2735246_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2735259_2736564_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2736563_2738306_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2738259_2738724_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2738856_2739201_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2739335_2739563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2739659_2740037_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2740079_2740619_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|2740615_2741230_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|2741229_2741511_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2741497_2741884_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2742034_2742958_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2743064_2743895_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2743925_2744915_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2744922_2745783_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2745799_2746189_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2746185_2747079_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2747078_2747561_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2747562_2748522_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2748518_2748743_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|2748739_2749882_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2749878_2750433_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2750461_2750686_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2750783_2751479_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2752293_2752665_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2752722_2753550_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2753686_2754226_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|2755027_2755501_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2756261_2756498_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2756487_2757630_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2757743_2758994_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2759165_2759831_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2759827_2760157_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2760168_2760630_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2760683_2761790_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2761309:2761325	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	2906602	3004098	4836393	capsid,protease,head,tRNA,lysis,portal,terminase,tail	Salmonella_phage(72.58%)	103	NA	NA
WP_000938188.1|2906602_2907283_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2907938_2908598_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2908684_2909014_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023243627.1|2909010_2909292_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548091.1|2909340_2910120_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2910145_2910694_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2910908_2912120_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2912177_2912495_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2912539_2912953_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2913126_2913789_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2913883_2914342_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_024155604.1|2914377_2916432_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_023243628.1|2916555_2917002_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950869.1|2917020_2919174_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2919160_2919766_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2919982_2920492_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2920848_2921901_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2921972_2922425_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2922610_2924371_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2924439_2924958_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2925057_2925225_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2925480_2926044_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2926040_2927681_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2927685_2928939_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2928953_2930861_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|2930873_2932982_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|2933080_2934190_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2934186_2934729_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2934894_2935905_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|2936112_2938725_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|2939151_2939358_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_023137449.1|2939564_2940695_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	100.0	4.4e-204
WP_001113926.1|2940705_2941665_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.1e-183
WP_001110473.1|2941673_2944394_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|2944393_2944792_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|2944798_2945383_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_023252581.1|2945382_2945976_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
WP_088730722.1|2946138_2946360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052921015.1|2946327_2946684_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	99.2	3.3e-57
WP_063328667.1|2946729_2950020_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	77.3	0.0e+00
WP_000433598.1|2950062_2950251_-	hypothetical protein	NA	K7PH36	Enterobacterial_phage	98.4	8.8e-25
WP_058800910.1|2950308_2950599_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	97.9	1.4e-45
WP_000835791.1|2950610_2950979_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.9	7.7e-57
WP_058800909.1|2950989_2951433_-	hypothetical protein	NA	S4TNM8	Salmonella_phage	93.9	2.0e-72
WP_058800908.1|2951488_2951836_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	93.9	8.8e-55
WP_058800907.1|2951832_2952282_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	98.7	4.5e-75
WP_058800911.1|2952278_2952629_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	88.8	4.9e-53
WP_049017487.1|2952636_2952963_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	4.4e-48
WP_058800906.1|2952959_2954003_-	hypothetical protein	NA	S4TNN1	Salmonella_phage	97.1	4.3e-129
WP_058803862.1|2953999_2955355_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	99.1	1.5e-259
WP_058800042.1|2955558_2957493_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	98.3	0.0e+00
WP_024152330.1|2957551_2959213_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	99.8	0.0e+00
WP_000954404.1|2959209_2959704_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_023231022.1|2959810_2960179_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	100.0	3.1e-66
WP_024148404.1|2960171_2960765_-	hypothetical protein	NA	S4TR53	Salmonella_phage	100.0	5.3e-116
WP_077946586.1|2960745_2961036_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	64.9	5.0e-27
WP_058800043.1|2961308_2962766_-	hypothetical protein	NA	S4TSQ9	Salmonella_phage	93.8	1.1e-276
WP_001223372.1|2962783_2963011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072209321.1|2963021_2963669_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	74.8	9.0e-61
WP_000509527.1|2964036_2964372_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	100.0	8.0e-61
WP_001034848.1|2964448_2964994_+	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
WP_001283924.1|2965138_2965396_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_058800046.1|2966099_2966567_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	99.4	1.5e-78
WP_000255147.1|2966964_2967507_-	lysozyme	NA	H6WRZ4	Salmonella_phage	100.0	1.6e-103
WP_001189445.1|2967509_2967824_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	100.0	2.4e-51
WP_000764540.1|2968217_2969015_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	100.0	5.2e-151
WP_001648706.1|2969004_2969151_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
WP_023231029.1|2969147_2969789_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	100.0	3.3e-116
WP_052920990.1|2969997_2970597_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	98.5	2.7e-107
WP_001217669.1|2971002_2971236_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_058803857.1|2972574_2973048_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.8e-67
WP_058803855.1|2973047_2973524_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	64.9	4.9e-56
WP_058803853.1|2973520_2973868_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	76.5	4.9e-45
WP_058803851.1|2973854_2974586_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_058803850.1|2974602_2975355_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	82.4	3.3e-115
WP_058803847.1|2975351_2976335_-	replication protein	NA	H6WRX7	Salmonella_phage	78.0	6.5e-127
WP_057060580.1|2976434_2976977_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	54.4	5.3e-46
WP_047736767.1|2976979_2977210_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	40.8	4.0e-11
WP_052951377.1|2977312_2977735_+	transcriptional regulator	NA	A0A0H5BBV1	Pseudomonas_phage	51.2	7.1e-06
WP_000648615.1|2978002_2978203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136566.1|2978202_2978400_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000335970.1|2978410_2978683_+	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	8.0e-27
WP_023137792.1|2978766_2979063_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	98.0	3.4e-47
WP_001652508.1|2979068_2979854_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.9	8.2e-149
WP_058799601.1|2979850_2980531_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.2	5.1e-131
WP_063328668.1|2980527_2981397_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	96.2	2.3e-160
WP_052938283.1|2981402_2981642_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	97.5	7.4e-37
WP_000065276.1|2981682_2981931_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2981975_2983268_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191404.1|2983462_2984665_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_063328669.1|2984745_2986179_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023243871.1|2986424_2987639_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2987956_2988418_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023243869.1|2988618_2990019_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.6	1.3e-80
WP_000977709.1|2990625_2991717_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2991901_2993092_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2993153_2993801_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2993828_2994377_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925888.1|2994636_2996484_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|2996828_3001295_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3001294_3001999_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3001979_3003302_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|3003294_3004098_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	3075654	3084736	4836393	protease,integrase	Ralstonia_phage(16.67%)	8	3074047:3074059	3093233:3093245
3074047:3074059	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3075654_3076896_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3077423_3077801_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3077962_3078160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3078372_3080649_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3080679_3081000_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3081323_3081545_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3081674_3083621_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3083617_3084736_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3093233:3093245	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 10
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	3445127	3481121	4836393	holin,protease,lysis,integrase,portal,terminase,tail,coat	Salmonella_phage(64.15%)	53	3442271:3442317	3481135:3481181
3442271:3442317	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_077950598.1|3445127_3447245_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	98.4	0.0e+00
WP_057518441.1|3447400_3449371_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.5	0.0e+00
WP_165850586.1|3449370_3450726_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	98.0	5.8e-243
WP_023206221.1|3450735_3451425_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_015995284.1|3451427_3451883_-	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	100.0	2.3e-87
WP_057518443.1|3451882_3452584_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	99.6	5.2e-78
WP_063328671.1|3452587_3454006_-	packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	97.2	9.0e-271
WP_057518445.1|3453965_3454466_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	2.5e-87
WP_057518446.1|3454449_3454659_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	89.9	2.5e-28
WP_057518447.1|3454697_3455990_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	98.8	2.0e-240
WP_000433856.1|3455989_3456901_-	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_057518448.1|3456914_3459092_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
WP_000417866.1|3459091_3460591_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|3460568_3461057_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|3461060_3461465_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|3461467_3461710_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|3462033_3462555_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_057518449.1|3462767_3463235_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	93.5	4.8e-72
WP_063328672.1|3463231_3463708_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	1.7e-88
WP_023253614.1|3463691_3464018_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	96.3	2.8e-50
WP_020838507.1|3464447_3465212_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	98.0	4.7e-141
WP_057518450.1|3465208_3465388_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	1.7e-22
WP_001659073.1|3465368_3465572_-	Phage NinH	NA	A0A075B8J4	Enterobacteria_phage	94.0	8.8e-31
WP_063328673.1|3466150_3466330_-	NinF family protein	NA	I6R994	Salmonella_phage	96.6	2.3e-27
WP_043856233.1|3466326_3466503_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
WP_001640862.1|3466499_3466946_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	97.3	7.8e-80
WP_001552357.1|3466902_3467232_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
WP_000654041.1|3467462_3467735_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	98.9	1.0e-42
WP_001650246.1|3467809_3469246_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	99.4	2.4e-271
WP_023230819.1|3469235_3470135_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	99.3	1.4e-155
WP_001125981.1|3470127_3470274_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424166.1|3470308_3470587_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_000276884.1|3470693_3470879_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3470959_3471610_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_023200932.1|3471963_3472296_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.1e-51
WP_000246166.1|3472374_3472569_+	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_063328674.1|3472652_3473609_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	83.3	1.6e-74
WP_001670815.1|3473803_3473977_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_000156731.1|3473957_3474146_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3474135_3474279_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_020898894.1|3474275_3474983_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	1.9e-136
WP_057515781.1|3474983_3475490_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	91.1	7.3e-82
WP_001016182.1|3475498_3476047_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_010835872.1|3476063_3476357_+	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_071889686.1|3476367_3476532_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	92.6	6.7e-21
WP_057518456.1|3476552_3476882_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	96.2	6.0e-53
WP_001673392.1|3476878_3477112_+	hypothetical protein	NA	E9NIE8	Enterobacter_phage	41.0	5.1e-06
WP_063328675.1|3477108_3477468_+	Eaf protein	NA	T1SA95	Salmonella_phage	92.4	2.5e-60
WP_063328676.1|3477464_3478433_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	67.1	1.9e-102
WP_033572412.1|3478434_3478653_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_063328690.1|3479277_3479520_+	DUF551 domain-containing protein	NA	A0A2L1IV16	Escherichia_phage	84.6	2.9e-36
WP_158510309.1|3479587_3479728_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	2.7e-15
WP_063328677.1|3479957_3481121_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.4	2.0e-220
3481135:3481181	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 11
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	4206671	4215619	4836393	integrase	Enterobacteria_phage(83.33%)	11	4203895:4203911	4215789:4215805
4203895:4203911	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4206671_4209005_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4209019_4209340_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4209336_4209564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4209560_4210112_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4210108_4210375_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_023244191.1|4210915_4211659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|4211662_4211902_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4211917_4212484_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4212922_4213864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4213872_4214328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4214350_4215619_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4215789:4215805	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 12
NZ_CP014663	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 chromosome, complete genome	4836393	4468333	4513111	4836393	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4468333_4469332_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4469419_4470730_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4470976_4471492_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4471591_4471801_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4471822_4471936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4471932_4473258_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4473436_4474045_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4474153_4474522_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4474692_4477113_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4477211_4478084_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4478097_4478595_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4478775_4479693_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4479856_4481215_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4481303_4482413_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4482774_4483965_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4484096_4485641_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4485655_4486546_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4486711_4487122_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4487264_4489361_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4489360_4490098_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4490094_4490763_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4490796_4491039_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4491482_4493132_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4493476_4494826_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4494956_4495304_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4495879_4496167_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4496169_4496775_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4496787_4497102_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4497261_4497717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4497713_4497911_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4497900_4499328_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4499327_4499852_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4499903_4500221_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4500180_4500309_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4500405_4502760_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4502759_4503713_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4503712_4503922_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4503909_4504953_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4504962_4505685_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4506012_4506375_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4506371_4507301_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4507300_4508848_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4509011_4509371_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4509361_4510477_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4510469_4511102_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4511104_4512586_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4512595_4513111_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
