The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	1156229	1162033	4676958		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1156229_1158563_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1158577_1158898_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1158894_1159122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1159118_1159670_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1159666_1159933_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1160470_1161208_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1161204_1161450_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1161466_1162033_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	1684908	1694079	4676958	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1684908_1685856_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1685839_1686571_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1686551_1686659_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1686718_1687450_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1687672_1689358_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1689354_1690074_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1690120_1690588_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1690644_1691175_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1691346_1691805_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1692045_1694079_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	1764303	1770600	4676958		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1764303_1765707_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1765884_1766778_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1767154_1768240_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1768239_1769139_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1769186_1770065_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1770069_1770600_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	1876754	1888139	4676958	integrase	Stenotrophomonas_phage(25.0%)	12	1862642:1862657	1878179:1878194
1862642:1862657	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|1876754_1878017_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1878662_1878953_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
1878179:1878194	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|1879324_1880122_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|1880602_1880764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1880890_1881310_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1881312_1882581_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1883035_1883248_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1883258_1883447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1883706_1884900_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1885548_1885860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1885939_1886635_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1886708_1888139_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	1992459	2000222	4676958	integrase	Enterobacteria_phage(28.57%)	12	1994669:1994691	2006792:2006814
WP_000856224.1|1992459_1992690_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1992827_1993202_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|1993202_1994078_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1994094_1994448_+	YebY family protein	NA	NA	NA	NA	NA
1994669:1994691	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|1994819_1995899_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|1995895_1997002_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|1997032_1997263_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1997316_1997850_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1998106_1998274_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1998338_1998527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|1998581_1999073_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|1999625_2000222_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2006792:2006814	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	2915459	2924541	4676958	integrase,protease	Ralstonia_phage(16.67%)	8	2913852:2913864	2933038:2933050
2913852:2913864	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2915459_2916701_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2917228_2917606_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2917767_2917965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2918177_2920454_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2920484_2920805_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2921128_2921350_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2921479_2923426_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2923422_2924541_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2933038:2933050	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 7
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	4007613	4016561	4676958	capsid,integrase	Enterobacteria_phage(83.33%)	12	4004837:4004853	4016731:4016747
4004837:4004853	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4007613_4009947_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4009961_4010282_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4010278_4010506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4010502_4011054_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4011050_4011317_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|4011421_4011550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075207146.1|4011791_4012601_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|4012604_4012844_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4012859_4013426_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4013864_4014806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4014814_4015270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4015292_4016561_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4016731:4016747	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	4266227	4309790	4676958	integrase,protease,plate,head,tail,portal,holin,terminase,capsid,tRNA	Shigella_phage(45.28%)	61	4268361:4268376	4271767:4271782
WP_000918353.1|4266227_4267643_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235555.1|4267707_4268691_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4268361:4268376	attL	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000891414.1|4268865_4269108_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_052934728.1|4269275_4270313_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4270401_4271499_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217553.1|4271560_4271809_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
4271767:4271782	attR	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000639149.1|4271952_4272516_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_024144069.1|4272739_4273228_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	81.4	9.8e-68
WP_010835343.1|4273197_4273815_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_022631136.1|4273819_4274353_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_063269512.1|4274355_4275381_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	40.7	6.8e-87
WP_000383548.1|4275384_4275969_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_063269513.1|4275959_4277018_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	3.4e-198
WP_000424732.1|4277004_4277430_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4277429_4277978_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4277977_4279057_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4279053_4280382_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4280472_4280985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022630976.1|4281066_4282899_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	8.8e-303
WP_000661047.1|4283040_4283310_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4283309_4283666_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4283665_4285162_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4285145_4285316_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4285324_4285885_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4285881_4286388_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4286362_4286773_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4286769_4287093_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4287067_4287295_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000257507.1|4287344_4288550_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_022630979.1|4288564_4289224_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	1.8e-117
WP_001514795.1|4289201_4290443_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4290442_4290625_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4290636_4292370_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000929174.1|4292383_4292869_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_023200328.1|4292994_4293345_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	2.9e-61
WP_023259402.1|4293798_4294191_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.0	1.2e-52
WP_023200327.1|4294174_4294651_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	1.4e-87
WP_023200326.1|4294654_4294990_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	2.1e-53
WP_001306866.1|4295127_4295370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200325.1|4295658_4296411_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.1e-137
WP_012513026.1|4296424_4297414_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001061375.1|4297421_4298219_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.3e-149
WP_000767130.1|4298238_4298628_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210148.1|4298624_4298951_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_000066917.1|4298947_4299601_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000104967.1|4299695_4300637_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_001250269.1|4300626_4300806_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_058652097.1|4300981_4301533_-	hypothetical protein	NA	S5FXP0	Shigella_phage	95.6	3.0e-97
WP_000187185.1|4301555_4301804_-	chaperone TorD	NA	NA	NA	NA	NA
WP_000853319.1|4301939_4302626_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000389078.1|4302608_4303499_-	hypothetical protein	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
WP_047624181.1|4303704_4304013_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_001307125.1|4303950_4304292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008249.1|4304647_4305184_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_023200800.1|4305174_4306053_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.5	1.8e-165
WP_023200799.1|4306049_4306523_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	70.1	1.2e-59
WP_000212745.1|4306524_4306812_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_024146004.1|4307826_4308399_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	7.1e-110
WP_001093914.1|4308435_4308708_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_000900143.1|4308741_4309203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535325.1|4309208_4309790_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
>prophage 9
NZ_CP014620	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 isolate SAN082 chromosome, complete genome	4676958	4335620	4353775	4676958	tail,plate	Burkholderia_phage(45.0%)	23	NA	NA
WP_000615248.1|4335620_4335968_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4336543_4336831_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4336833_4337439_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4337451_4337766_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4337925_4338381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4338377_4338575_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4338564_4339992_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4339991_4340516_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4340567_4340885_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4340844_4340973_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4341069_4343424_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4343423_4344377_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4344376_4344586_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4344573_4345617_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4345626_4346349_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4346676_4347039_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4347035_4347965_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4347964_4349512_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4349675_4350035_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4350025_4351141_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4351133_4351766_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4351768_4353250_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4353259_4353775_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
