The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	1153416	1159220	4700848		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1153416_1155750_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1155764_1156085_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1156081_1156309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1156305_1156857_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1156853_1157120_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1157657_1158395_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1158391_1158637_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1158653_1159220_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	1190875	1273786	4700848	tRNA,portal,tail,integrase,plate,terminase,holin,capsid,head	Cronobacter_phage(51.22%)	83	1198853:1198868	1228230:1228245
WP_000469807.1|1190875_1191643_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1191683_1192031_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1192187_1193408_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|1193400_1193919_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1194358_1195429_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1195438_1196560_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|1196617_1197526_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1197486_1198647_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1198746_1198794_-	hypothetical protein	NA	NA	NA	NA	NA
1198853:1198868	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_024132356.1|1198957_1199950_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|1200016_1200322_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1200419_1200758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1200783_1201116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|1201125_1201695_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000922120.1|1201697_1201916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994501.1|1201954_1204612_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_001264830.1|1204639_1204909_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_000746494.1|1204962_1205982_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_001151938.1|1205978_1207763_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_023375469.1|1207973_1208810_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1208844_1209873_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1209884_1210583_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1210681_1211134_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1211130_1211613_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000606933.1|1211609_1212314_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000220184.1|1212310_1213438_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000166745.1|1213434_1213890_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1213902_1214199_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1214195_1214537_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376378.1|1214536_1214869_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000411500.1|1215015_1215273_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811100.1|1215460_1217428_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1217424_1217754_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136927.1|1217750_1218935_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001001824.1|1218927_1219515_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_063177003.1|1219524_1221537_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1221539_1222070_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1222059_1222785_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1222756_1223302_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|1223301_1225005_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_000777801.1|1226122_1227595_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001156921.1|1227730_1228117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1228274_1228613_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1228230:1228245	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1228884_1229622_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1229753_1230734_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1230730_1231462_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1231591_1234165_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_023243218.1|1240037_1240493_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|1240596_1241898_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264467.1|1241894_1242218_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1242260_1243616_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_023243219.1|1243730_1246391_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183649.1|1246444_1247125_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1247197_1247617_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1247820_1248858_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1248973_1249663_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1249981_1250365_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1250426_1251014_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521114.1|1251116_1252016_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023244485.1|1252033_1253368_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.7e-43
WP_000083347.1|1253497_1254235_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989187.1|1254219_1255842_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1256105_1256270_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1256266_1256842_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1256873_1257524_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812019.1|1257523_1258480_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1258476_1258956_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1259206_1261006_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1261022_1261997_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1262270_1262951_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1262947_1263853_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1263864_1264593_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1264604_1265336_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1265335_1265716_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1265827_1266088_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1266125_1267052_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1267167_1268364_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684035.1|1268385_1269303_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995692.1|1269341_1270190_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048535.1|1270305_1271199_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1271209_1272571_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1272574_1273210_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1273234_1273786_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	1711469	1720640	4700848	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1711469_1712417_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1712400_1713132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1713112_1713220_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1713279_1714011_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1714233_1715919_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1715915_1716635_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1716681_1717149_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1717205_1717736_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1717907_1718366_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1718606_1720640_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	1788732	1795029	4700848		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1788732_1790136_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1790313_1791207_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1791583_1792669_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1792668_1793568_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1793615_1794494_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1794498_1795029_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	1905318	1912567	4700848		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1905318_1905738_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1905740_1907009_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1907463_1907676_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1907686_1907875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1908134_1909328_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1909976_1910288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1910367_1911063_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1911136_1912567_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	2015821	2023584	4700848	integrase	Enterobacteria_phage(28.57%)	12	2018031:2018053	2030154:2030176
WP_000856224.1|2015821_2016052_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2016189_2016564_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2016564_2017440_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2017456_2017810_+	YebY family protein	NA	NA	NA	NA	NA
2018031:2018053	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2018181_2019261_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2019257_2020364_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2020394_2020625_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2020678_2021212_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2021468_2021636_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2021700_2021889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2021943_2022435_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2022987_2023584_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2030154:2030176	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	2629579	2708943	4700848	tRNA,tail,portal,plate,integrase,terminase,protease,holin,capsid,head	Salmonella_phage(56.9%)	103	2650217:2650233	2708462:2708478
WP_023893413.1|2629579_2630098_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2630094_2630202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2630407_2630854_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2630833_2631628_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2631728_2632913_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2633031_2633379_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2633364_2633676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2633744_2633996_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2634191_2634290_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2634428_2634677_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2634990_2635632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2635861_2636044_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2636046_2636409_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2636581_2637220_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2637415_2637961_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2638043_2638199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2638277_2638526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2638780_2639629_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2639697_2640291_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2640435_2641224_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2641331_2641979_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2642175_2642502_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2642695_2643829_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2643910_2644501_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2644494_2645292_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|2645285_2646098_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2646087_2647062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2647061_2648696_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2649377_2649692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2649840_2650371_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2650217:2650233	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2650453_2651497_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2651835_2652303_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2652455_2652728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2652927_2653053_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2653430_2653775_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2654996_2655554_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2656365_2656629_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2656760_2656973_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2657387_2657909_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2658099_2658339_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2658828_2659617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2660612_2661737_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2662184_2662397_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2662650_2663322_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2663314_2664583_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2664585_2665005_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2665341_2665554_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2665678_2666812_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2666849_2667062_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2667051_2667657_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2667626_2668880_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2668866_2669454_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|2669456_2670536_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2670528_2670942_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2670946_2671480_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2671479_2672538_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2672534_2673875_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2673908_2675837_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2675921_2676248_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2676244_2676601_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2676600_2678097_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2678086_2678251_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2678272_2678818_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2678814_2679327_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2679298_2679712_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2679723_2680047_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023232348.1|2680046_2680280_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.6e-10
WP_023171046.1|2680323_2681541_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|2681550_2682399_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2682412_2683717_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2683716_2685459_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2685412_2685877_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2686009_2686354_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2686488_2686716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2686812_2687190_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2687232_2687772_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_039500578.1|2687768_2688383_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	5.5e-108
WP_000250465.1|2688382_2688664_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2688650_2689037_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2689187_2690111_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2690217_2691048_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2691078_2692068_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2692075_2692936_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2692952_2693342_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2693338_2694232_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2694231_2694714_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2694715_2695675_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2695671_2695896_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|2695892_2697035_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2697031_2697586_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2697614_2697839_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2697936_2698632_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2699446_2699818_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2699875_2700703_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2700839_2701379_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|2702180_2702654_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2703414_2703651_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2703640_2704783_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2704896_2706147_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2706318_2706984_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2706980_2707310_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2707321_2707783_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2707836_2708943_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2708462:2708478	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	2978334	2987416	4700848	integrase,protease	Ralstonia_phage(16.67%)	8	2976727:2976739	2995913:2995925
2976727:2976739	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2978334_2979576_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2980103_2980481_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2980642_2980840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2981052_2983329_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2983359_2983680_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2984003_2984225_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2984354_2986301_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2986297_2987416_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2995913:2995925	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	4069090	4078038	4700848	integrase	Enterobacteria_phage(83.33%)	11	4066314:4066330	4078208:4078224
4066314:4066330	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4069090_4071424_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4071438_4071759_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4071755_4071983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4071979_4072531_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4072527_4072794_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_023244191.1|4073334_4074078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|4074081_4074321_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4074336_4074903_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4075341_4076283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4076291_4076747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4076769_4078038_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4078208:4078224	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP014661	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 chromosome, complete genome	4700848	4330750	4375528	4700848	tRNA,tail,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4330750_4331749_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4331836_4333147_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4333393_4333909_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4334008_4334218_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4334239_4334353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4334349_4335675_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4335853_4336462_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4336570_4336939_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4337109_4339530_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4339628_4340501_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4340514_4341012_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4341192_4342110_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_063177029.1|4342273_4343632_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4343720_4344830_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4345191_4346382_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4346513_4348058_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4348072_4348963_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4349128_4349539_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4349681_4351778_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4351777_4352515_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4352511_4353180_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4353213_4353456_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4353899_4355549_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4355893_4357243_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4357373_4357721_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4358296_4358584_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4358586_4359192_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4359204_4359519_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4359678_4360134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4360130_4360328_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4360317_4361745_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4361744_4362269_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4362320_4362638_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4362597_4362726_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4362822_4365177_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4365176_4366130_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4366129_4366339_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4366326_4367370_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4367379_4368102_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4368429_4368792_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4368788_4369718_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4369717_4371265_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4371428_4371788_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4371778_4372894_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4372886_4373519_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4373521_4375003_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4375012_4375528_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
>prophage 1
NZ_CP014662	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 plasmid pSAN1-2010K-2577, complete sequence	103851	4147	48031	103851	transposase,integrase	Escherichia_phage(21.05%)	50	3587:3601	38400:38414
3587:3601	attL	TCCGGCTGACTGGCT	NA	NA	NA	NA
WP_000896475.1|4147_5797_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|5799_6660_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001324342.1|6761_8285_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|8271_9057_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|9232_9733_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259032.1|9860_10700_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|10693_11041_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|11204_11996_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001355915.1|12097_12571_-	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
WP_000845048.1|12727_13741_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|13943_14294_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|14419_14980_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|14982_17949_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_031610367.1|17957_18374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|18850_19117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|19116_19611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|19666_20269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132019.1|20622_21969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|22247_24128_+	colicin	NA	NA	NA	NA	NA
WP_000762580.1|24145_24493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|24611_24959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|24976_25567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|25563_25824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465034.1|26392_26806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164192.1|26807_27593_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000312331.1|28176_28809_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_000752652.1|28808_29183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217836.1|29421_30396_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
WP_000272884.1|30399_30792_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001348079.1|31472_32375_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086147.1|32759_33443_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001104881.1|33443_33665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274500.1|33678_34113_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001198930.1|35351_35777_+	antirestriction protein	NA	NA	NA	NA	NA
WP_063177032.1|35823_36246_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|36242_36434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001434357.1|36504_36819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276120.1|37202_37730_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_000005985.1|37787_38021_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_063177033.1|38079_40038_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	9.2e-24
38400:38414	attR	TCCGGCTGACTGGCT	NA	NA	NA	NA
WP_001387500.1|40092_40527_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_063177034.1|40523_41243_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000977997.1|41239_41836_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_000117611.1|42297_42798_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_013307863.1|43368_44940_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	7.6e-170
WP_000624622.1|44959_45307_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|45306_45984_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000218863.1|46233_46668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|46761_47028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078704.1|47092_48031_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
