The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1155264	1161068	4945392		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1155264_1157598_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1157612_1157933_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1157929_1158157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1158153_1158705_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1158701_1158968_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1159505_1160243_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1160239_1160485_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1160501_1161068_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1164596	1291349	4945392	plate,tail,portal,transposase,terminase,lysis,holin,integrase,tRNA,head,capsid	Salmonella_phage(52.44%)	125	1158445:1158461	1246693:1246709
1158445:1158461	attL	GGAAACCGGCCAGCCCG	NA	NA	NA	NA
WP_006493480.1|1164596_1165823_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1165829_1166846_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1166847_1167480_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1167599_1167842_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1167874_1168384_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1168470_1168746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1168830_1169025_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1168988_1169330_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1169397_1169625_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1169624_1169852_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1169848_1170706_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1170702_1173096_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1173115_1173343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1173480_1173669_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1173999_1175202_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1175164_1176082_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1176128_1177163_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1177162_1178929_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1179071_1179905_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1179921_1180989_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1180992_1181643_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1181736_1182201_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1182200_1182404_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1182407_1182623_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1182603_1183113_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1183117_1183492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1183488_1183917_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1184012_1184444_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1184436_1184883_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1184951_1185530_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1185526_1185886_+|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1185872_1186781_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1186773_1187379_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_063177108.1|1187375_1189184_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	82.0	1.6e-208
WP_001287104.1|1189190_1189598_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_006501158.1|1189601_1190219_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_077908780.1|1190188_1191034_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	84.4	1.1e-114
WP_006501163.1|1191003_1191561_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1191663_1192836_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1192845_1193361_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1193415_1193718_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1193732_1193852_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1193844_1196652_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1196648_1197134_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1197130_1198231_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1198299_1198518_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1199069_1200233_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023244174.1|1200240_1202421_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1202417_1203827_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1203891_1215366_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1215985_1216468_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1216617_1217094_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1217083_1217374_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1217539_1217878_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1218026_1219688_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1219773_1220652_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1220774_1221365_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1221399_1222005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1222125_1223412_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1223431_1224223_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1224388_1225750_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1226063_1226312_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1226330_1226879_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1226923_1227691_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1227731_1228079_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1228235_1229456_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|1229448_1229967_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1230406_1231477_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1231486_1232608_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|1232665_1233574_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1233534_1234695_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1234794_1234842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000615542.1|1235005_1236025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|1236064_1236370_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1236467_1236806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1236831_1237164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|1237173_1237743_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000922120.1|1237745_1237964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994501.1|1238002_1240660_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000088096.1|1240687_1241011_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000746494.1|1241010_1242030_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_001151938.1|1242026_1243811_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000273112.1|1243868_1244858_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1244892_1245921_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1245932_1246631_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1246729_1247182_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
1246693:1246709	attR	GGAAACCGGCCAGCCCG	NA	NA	NA	NA
WP_000080871.1|1247178_1247661_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000606933.1|1247657_1248362_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000220184.1|1248358_1249486_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000166745.1|1249482_1249938_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1249950_1250247_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1250243_1250585_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376378.1|1250584_1250917_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000411500.1|1251063_1251321_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811100.1|1251508_1253476_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1253472_1253802_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136927.1|1253798_1254983_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001001824.1|1254975_1255563_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_000084303.1|1255572_1257585_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1257587_1258118_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1258107_1258833_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1258804_1259350_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|1259352_1261053_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_000777801.1|1262170_1263643_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012904651.1|1263919_1264888_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_063177109.1|1264889_1265231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1265388_1265727_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1265998_1266736_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1266867_1267848_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1267844_1268576_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1268705_1271279_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_023243218.1|1277151_1277607_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|1277710_1279012_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264467.1|1279008_1279332_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1279374_1280730_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_023243219.1|1280844_1283505_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183649.1|1283558_1284239_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1284311_1284731_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1284934_1285972_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1286087_1286777_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1287095_1287479_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1287540_1288128_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521114.1|1288230_1289130_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023244485.1|1289147_1290482_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.7e-43
WP_000083347.1|1290611_1291349_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1391705	1437628	4945392	terminase,holin,integrase,tail	Salmonella_phage(67.35%)	53	1373414:1373429	1398209:1398224
1373414:1373429	attL	TGGAGCGCAATGGCGA	NA	NA	NA	NA
WP_023243644.1|1391705_1393172_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
WP_000138293.1|1393241_1394819_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_052904562.1|1395011_1396262_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	90.8	4.9e-220
WP_063177113.1|1396722_1397301_-	adenine methylase	NA	Q858E6	Salmonella_phage	96.4	2.9e-111
WP_057524766.1|1397297_1397489_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	71.2	4.9e-15
WP_065314939.1|1397485_1397644_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	90.4	4.2e-20
WP_045717192.1|1397636_1397936_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
WP_063177114.1|1398045_1398294_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	85.4	3.6e-34
1398209:1398224	attR	TCGCCATTGCGCTCCA	NA	NA	NA	NA
WP_063177115.1|1398343_1399225_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	96.2	3.3e-154
WP_052904556.1|1399221_1400043_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	96.3	2.0e-158
WP_052904554.1|1400039_1400246_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	86.0	1.0e-18
WP_063177116.1|1400242_1400545_-	hypothetical protein	NA	T1SA88	Salmonella_phage	85.0	4.1e-40
WP_063177117.1|1400552_1401545_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	76.4	3.9e-55
WP_053388658.1|1401924_1402521_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	94.9	5.2e-103
WP_003037808.1|1402676_1402910_+	hypothetical protein	NA	Q858D6	Salmonella_phage	100.0	5.4e-40
WP_052904546.1|1403253_1404315_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.0	2.5e-161
WP_052904544.1|1404304_1405120_+	Pyocin large subunit	NA	T1SA92	Salmonella_phage	95.6	1.4e-146
WP_052904543.1|1405240_1405585_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	95.6	2.4e-60
WP_063177119.1|1405646_1406294_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	48.6	2.3e-40
WP_063177120.1|1406290_1406503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891448.1|1406499_1407126_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	64.4	8.3e-27
WP_057526229.1|1407129_1407312_+	hypothetical protein	NA	A0A2H4FQT4	Salmonella_phage	82.8	1.5e-21
WP_057526230.1|1407313_1407508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147639866.1|1407511_1408687_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	55.1	6.9e-51
WP_063177123.1|1408913_1409252_+	hypothetical protein	NA	Q858C6	Salmonella_phage	87.5	1.4e-49
WP_139381697.1|1409274_1409949_+|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	97.3	1.6e-113
WP_063177124.1|1409945_1411421_+	hypothetical protein	NA	Q858H3	Salmonella_phage	96.9	1.4e-290
WP_063177125.1|1411503_1411764_-	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	40.9	1.9e-06
WP_000334867.1|1412619_1412826_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_057515131.1|1412840_1414511_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	97.1	6.3e-308
WP_052904522.1|1414507_1414804_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	79.6	2.4e-37
WP_052904520.1|1414806_1415514_+	peptidase	NA	T1SAP9	Salmonella_phage	82.3	7.8e-66
WP_052904518.1|1415528_1416515_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	89.0	5.6e-171
WP_052904516.1|1416566_1417007_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.1	1.1e-65
WP_052904514.1|1417017_1417398_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	6.1e-25
WP_063177126.1|1417449_1417773_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	71.8	5.0e-36
WP_057515128.1|1417772_1418378_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.0e-110
WP_063177127.1|1418377_1420855_+	hypothetical protein	NA	Q858G3	Salmonella_phage	96.7	0.0e+00
WP_063177128.1|1420854_1421319_+	hypothetical protein	NA	T1SA73	Salmonella_phage	98.1	5.8e-86
WP_045719038.1|1421318_1421861_+	hypothetical protein	NA	T1SA02	Salmonella_phage	99.4	1.2e-71
WP_063177129.1|1421873_1424384_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	83.3	0.0e+00
WP_063177130.1|1424380_1426183_+	hypothetical protein	NA	T1SAQ5	Salmonella_phage	84.8	2.1e-272
WP_063177131.1|1426187_1428662_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	97.1	0.0e+00
WP_052904494.1|1428862_1429123_-	hypothetical protein	NA	T1SA06	Salmonella_phage	98.8	2.2e-42
WP_063177132.1|1429320_1432533_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	71.3	1.1e-98
WP_063177178.1|1432573_1433752_-	O-antigen ligase family protein	NA	Q858F4	Salmonella_phage	93.6	1.1e-189
WP_063177133.1|1433764_1433971_-	hypothetical protein	NA	Q858F3	Salmonella_phage	86.8	5.5e-20
WP_001275998.1|1434132_1434537_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_052904489.1|1434523_1434829_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	1.1e-48
WP_052904486.1|1434821_1435301_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	66.9	5.1e-61
WP_052904484.1|1435297_1435786_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	61.0	4.6e-41
WP_023244201.1|1436420_1436750_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000075924.1|1437436_1437628_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 4
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1790720	1799891	4945392	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1790720_1791668_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1791651_1792383_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1792363_1792471_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1792530_1793262_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1793484_1795170_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1795166_1795886_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1795932_1796400_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1796456_1796987_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1797158_1797617_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1797857_1799891_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1867983	1874280	4945392		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1867983_1869387_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1869564_1870458_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1870834_1871920_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1871919_1872819_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1872866_1873745_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1873749_1874280_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 6
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	1902135	1942039	4945392	protease,plate,tail,portal,terminase,holin,integrase,head,capsid	Salmonella_phage(79.25%)	57	1893533:1893547	1929609:1929623
1893533:1893547	attL	GGGCGGCGATATCCG	NA	NA	NA	NA
WP_001007943.1|1902135_1903317_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	99.5	1.3e-227
WP_001754984.1|1903680_1903920_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_039501142.1|1903925_1904795_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.8	1.3e-158
WP_000187056.1|1904791_1905472_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	3.9e-131
WP_001648679.1|1905468_1906254_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_039501144.1|1906259_1906556_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	9.8e-47
WP_039501146.1|1906646_1906847_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	4.1e-12
WP_000950426.1|1907195_1907858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1907857_1908244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1908236_1909076_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1909134_1909530_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1909629_1909872_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1909831_1910206_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1910297_1911182_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1911178_1911874_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_052323674.1|1911887_1912826_+	DUF550 domain-containing protein	NA	H6WRY2	Salmonella_phage	99.2	2.7e-66
WP_016062831.1|1912977_1913610_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	100.0	3.8e-112
WP_001217669.1|1914098_1914332_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_071841283.1|1914448_1914697_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	97.6	1.0e-41
WP_000929790.1|1914731_1915334_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_039501156.1|1915542_1916154_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.6	6.1e-91
WP_000801757.1|1916150_1916291_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097244.1|1916287_1916977_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_162264800.1|1917177_1917519_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005893.1|1917521_1918136_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.1	5.0e-109
WP_039501158.1|1918132_1918567_+	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	89.6	5.5e-54
WP_024148414.1|1918720_1919209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023231277.1|1919255_1919606_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	3.4e-62
WP_023231279.1|1919730_1920225_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	1.5e-87
WP_039501161.1|1920221_1921955_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|1921966_1922149_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_023231283.1|1922148_1923390_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.5	1.0e-241
WP_024148415.1|1923367_1924018_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	99.5	5.6e-119
WP_023231285.1|1924032_1925238_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	99.8	1.2e-223
WP_000601353.1|1925288_1925489_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1925491_1925815_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_039501164.1|1925811_1926216_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	76.9	1.0e-54
WP_048348920.1|1926187_1926700_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	89.4	1.9e-82
WP_023231767.1|1926696_1927257_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	98.9	8.8e-105
WP_000497739.1|1927260_1927425_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_047590468.1|1927414_1928911_+|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	99.8	6.1e-278
WP_000515952.1|1928910_1929267_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588851.1|1929263_1929590_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	98.1	3.3e-51
WP_031608922.1|1929674_1931603_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
1929609:1929623	attR	GGGCGGCGATATCCG	NA	NA	NA	NA
WP_000863824.1|1931636_1932977_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	2.2e-250
WP_001066633.1|1932973_1934032_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	5.0e-202
WP_001273652.1|1934031_1934565_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	5.5e-96
WP_000605051.1|1934569_1934983_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785582.1|1934975_1936055_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	3.2e-204
WP_001207832.1|1936057_1936645_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_039500225.1|1936631_1938176_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	90.6	1.8e-256
WP_100521874.1|1938145_1938751_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	95.2	5.2e-103
WP_001259328.1|1938989_1940123_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	7.2e-37
WP_000532385.1|1940174_1940549_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	35.0	9.0e-13
WP_001530989.1|1941022_1941457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343069.1|1941565_1941757_+	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_000798891.1|1941772_1942039_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
>prophage 7
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	2020719	2032104	4945392	integrase	Stenotrophomonas_phage(25.0%)	12	2006607:2006622	2022144:2022159
2006607:2006622	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|2020719_2021982_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|2022627_2022918_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
2022144:2022159	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|2023289_2024087_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|2024567_2024729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|2024855_2025275_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|2025277_2026546_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|2027000_2027213_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|2027223_2027412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|2027671_2028865_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|2029513_2029825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|2029904_2030600_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|2030673_2032104_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	2135365	2143128	4945392	integrase	Enterobacteria_phage(28.57%)	12	2137575:2137597	2149698:2149720
WP_000856224.1|2135365_2135596_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2135733_2136108_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2136108_2136984_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2137000_2137354_+	YebY family protein	NA	NA	NA	NA	NA
2137575:2137597	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2137725_2138805_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2138801_2139908_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2139938_2140169_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2140222_2140756_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2141012_2141180_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2141244_2141433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2141487_2141979_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2142531_2143128_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2149698:2149720	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	2748443	2829939	4945392	plate,protease,tail,portal,transposase,terminase,holin,tRNA,head,capsid	Salmonella_phage(58.33%)	103	NA	NA
WP_023893413.1|2748443_2748962_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2748958_2749066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2749271_2749718_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2749697_2750492_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2750592_2751777_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2751895_2752243_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2752228_2752540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2752608_2752860_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2753055_2753154_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2753292_2753541_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2753854_2754496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2754725_2754908_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2754910_2755273_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2755445_2756084_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2756279_2756825_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2756907_2757063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2757141_2757390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2757644_2758493_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2758561_2759155_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2759299_2760088_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_012904651.1|2760492_2761461_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_001183699.1|2762105_2762432_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2762625_2763759_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2763840_2764431_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2764424_2765222_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2765215_2766028_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2766017_2766992_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2766991_2768626_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2769307_2769622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2769770_2770301_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_021000256.1|2770383_2771427_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2771765_2772233_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2772385_2772658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2772857_2772983_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2773360_2773705_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2774926_2775484_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2776295_2776559_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2776690_2776903_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2777317_2777839_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2778029_2778269_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2778758_2779547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2780542_2781667_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2782114_2782327_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2782580_2783252_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2783244_2784513_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2784515_2784935_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2785271_2785484_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2785608_2786742_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2786779_2786992_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2786981_2787587_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2787556_2788810_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2788796_2789384_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|2789386_2790466_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2790458_2790872_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2790876_2791410_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2791409_2792468_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2792464_2793805_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2793838_2795767_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2795851_2796178_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2796174_2796531_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2796530_2798027_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2798016_2798181_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2798202_2798748_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2798744_2799257_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2799228_2799642_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2799653_2799977_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023232348.1|2799976_2800210_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.6e-10
WP_023171046.1|2800253_2801471_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|2801480_2802329_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2802342_2803647_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2803646_2805389_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2805342_2805807_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2805939_2806284_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2806418_2806646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2806742_2807120_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2807162_2807702_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|2807698_2808313_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|2808312_2808594_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2808580_2808967_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2809117_2810041_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2810147_2810978_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2811008_2811998_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2812005_2812866_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2812882_2813272_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2813268_2814162_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2814161_2814644_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2814645_2815605_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2815601_2815826_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|2815822_2816965_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2816961_2817516_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2817544_2817769_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2817866_2818562_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2819376_2819748_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2819805_2820633_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2820769_2821309_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|2822110_2822584_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2823344_2823581_+	excisionase	NA	NA	NA	NA	NA
WP_012904651.1|2823902_2824871_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_000444509.1|2825892_2827143_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2827314_2827980_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2827976_2828306_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2828317_2828779_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2828832_2829939_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	2974750	3074561	4945392	protease,tail,portal,terminase,lysis,integrase,tRNA,head,capsid	Salmonella_phage(86.36%)	104	2998879:2998898	3071634:3071653
WP_000938188.1|2974750_2975431_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2976086_2976746_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2976832_2977162_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023243627.1|2977158_2977440_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548091.1|2977488_2978268_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2978293_2978842_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2979056_2980268_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2980325_2980643_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2980687_2981101_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2981274_2981937_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2982031_2982490_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_024155604.1|2982525_2984580_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_023243628.1|2984703_2985150_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950869.1|2985168_2987322_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2987308_2987914_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2988130_2988640_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_063177180.1|2988996_2990049_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2990120_2990573_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2990758_2992519_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2992587_2993106_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2993205_2993373_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2993628_2994192_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2994188_2995829_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2995833_2997087_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2997101_2999009_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2998879:2998898	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086481.1|2999021_3001130_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|3001228_3002338_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3002334_3002877_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3003042_3004053_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|3004260_3006873_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|3007299_3007506_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_072156355.1|3007633_3007990_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.3	3.3e-49
WP_000776343.1|3008198_3009401_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	100.0	6.3e-209
WP_001805559.1|3009615_3009774_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	100.0	5.8e-22
WP_023137449.1|3009842_3010973_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	100.0	4.4e-204
WP_001113925.1|3010983_3011943_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001110473.1|3011951_3014672_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|3014671_3015070_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|3015076_3015661_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_000729325.1|3015660_3016254_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
WP_088730722.1|3016416_3016638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552342.1|3016605_3016962_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	1.1e-57
WP_023231014.1|3017007_3020322_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	100.0	0.0e+00
WP_000404385.1|3020368_3020704_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
WP_024134502.1|3020760_3021039_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_000835790.1|3021062_3021431_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	100.0	2.0e-65
WP_023231015.1|3021441_3021885_-|tail	prophage major tail protein	tail	S4TNM8	Salmonella_phage	100.0	1.9e-78
WP_023231016.1|3021940_3022288_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	100.0	1.7e-58
WP_023231017.1|3022284_3022734_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	100.0	1.5e-75
WP_023231018.1|3022730_3023081_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	100.0	1.7e-58
WP_023231019.1|3023089_3023416_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	100.0	2.2e-55
WP_001005702.1|3023412_3024456_-	hypothetical protein	NA	S4TNN1	Salmonella_phage	100.0	2.0e-134
WP_000267319.1|3024452_3025808_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	100.0	2.8e-261
WP_023231020.1|3026012_3027947_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	100.0	0.0e+00
WP_024148403.1|3028005_3029667_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	100.0	0.0e+00
WP_000954404.1|3029663_3030158_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_023231022.1|3030264_3030633_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	100.0	3.1e-66
WP_024148404.1|3030625_3031219_-	hypothetical protein	NA	S4TR53	Salmonella_phage	100.0	5.3e-116
WP_077946586.1|3031199_3031490_-	hypothetical protein	NA	K7PJS8	Enterobacterial_phage	64.9	5.0e-27
WP_023231024.1|3031762_3033220_-	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	100.0	1.2e-291
WP_023231025.1|3033229_3034003_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	100.0	7.8e-128
WP_000509527.1|3034123_3034459_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	100.0	8.0e-61
WP_001034848.1|3034535_3035081_+	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
WP_023231026.1|3035225_3035483_-	hypothetical protein	NA	S4TNE7	Salmonella_phage	100.0	6.6e-39
WP_000644477.1|3035479_3035977_-	DNA-binding protein	NA	S4TSR0	Salmonella_phage	100.0	8.1e-94
WP_023231027.1|3036185_3036653_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	100.0	1.5e-78
WP_000255147.1|3037050_3037593_-	lysozyme	NA	H6WRZ4	Salmonella_phage	100.0	1.6e-103
WP_001189445.1|3037595_3037910_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	100.0	2.4e-51
WP_000764540.1|3038303_3039101_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	100.0	5.2e-151
WP_001648706.1|3039090_3039237_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
WP_023231029.1|3039233_3039875_-	NinG-like phage protein	NA	S4TSR3	Salmonella_phage	100.0	3.3e-116
WP_001540681.1|3040083_3040686_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	100.0	2.6e-110
WP_001217670.1|3041019_3041259_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000208070.1|3041778_3042588_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_000151011.1|3042584_3043037_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	100.0	3.8e-74
WP_000065341.1|3043033_3043435_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000113621.1|3043431_3043779_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000800012.1|3043789_3044539_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001669125.1|3044541_3045525_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_001538023.1|3045609_3045984_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_000869364.1|3045949_3046186_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|3046315_3046720_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000917564.1|3047118_3047277_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001669126.1|3047298_3047649_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_000017138.1|3047775_3050703_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	100.0	0.0e+00
WP_001539618.1|3050665_3051823_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3051865_3052105_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3052145_3052394_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|3052438_3053731_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191404.1|3053925_3055128_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023243872.1|3055208_3056642_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023243871.1|3056887_3058102_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3058419_3058881_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023243869.1|3059081_3060482_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.6	1.3e-80
WP_153274566.1|3060646_3060805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977709.1|3061088_3062180_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|3062364_3063555_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3063616_3064264_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3064291_3064840_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925888.1|3065099_3066947_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|3067291_3071758_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3071634:3071653	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3071757_3072462_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3072442_3073765_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|3073757_3074561_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	3146117	3155199	4945392	protease,integrase	Ralstonia_phage(16.67%)	8	3144510:3144522	3163696:3163708
3144510:3144522	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3146117_3147359_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3147886_3148264_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3148425_3148623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3148835_3151112_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3151142_3151463_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3151786_3152008_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3152137_3154084_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3154080_3155199_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3163696:3163708	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 12
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	3755218	3822448	4945392	plate,transposase	Enterobacteria_phage(20.0%)	59	NA	NA
WP_095470817.1|3755218_3756380_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	3.6e-52
WP_023242996.1|3756377_3756653_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.4e-23
WP_023242995.1|3757007_3758258_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3758269_3759373_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3759655_3760708_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
WP_000174693.1|3760758_3761160_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189588.1|3761217_3762462_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001292018.1|3762550_3763009_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023244343.1|3763257_3764715_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023242992.1|3764869_3765484_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_023242991.1|3765480_3766620_-	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.3	1.5e-29
WP_001226206.1|3766838_3767894_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001225658.1|3768143_3768884_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333387.1|3768854_3769622_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284051.1|3769834_3770413_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000973041.1|3770652_3773097_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000015789.1|3773205_3773973_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|3774343_3774751_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_023243480.1|3775081_3775801_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_001575654.1|3775804_3776020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063177165.1|3776136_3777084_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000119389.1|3777900_3778722_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023243481.1|3779129_3779600_-	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_023244344.1|3779621_3782132_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_023243482.1|3782155_3782896_-	pili assembly chaperone PapD	NA	NA	NA	NA	NA
WP_023244345.1|3782970_3783468_-	Saf-pilin pilus formation protein SafA	NA	NA	NA	NA	NA
WP_023228257.1|3783600_3784095_-	Saf-pilin pilus formation protein SafA	NA	NA	NA	NA	NA
WP_012904651.1|3784709_3785678_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_072101091.1|3786673_3786988_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_012543321.1|3787054_3787333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023244346.1|3787648_3788116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125462689.1|3788988_3789222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243487.1|3789555_3789813_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_023216761.1|3789871_3790180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243488.1|3790965_3791487_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_023244348.1|3791500_3795634_-	Rhs family protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.3	5.5e-26
WP_023243490.1|3795652_3796099_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_023244349.1|3796122_3798309_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000968384.1|3798705_3799227_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_000759645.1|3799250_3799667_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_023197901.1|3800450_3804320_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_023166851.1|3804353_3804785_-	putative Shiga-like toxin A subunit	NA	NA	NA	NA	NA
WP_023197900.1|3804986_3805760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243493.1|3805764_3807069_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_023244351.1|3807065_3808409_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007104.1|3808412_3808949_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_023243494.1|3809015_3809501_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3809643_3810027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|3810011_3810497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312800.1|3810800_3811286_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077909447.1|3811539_3811872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3812171_3813680_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996815.1|3813703_3814246_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023243495.1|3814345_3816985_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.2	3.1e-75
WP_000806682.1|3817352_3818255_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_023244353.1|3818241_3819066_+	SciE protein	NA	NA	NA	NA	NA
WP_001749064.1|3819062_3819557_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|3819572_3821456_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023244354.1|3821452_3822448_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 13
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	4238268	4247216	4945392	capsid,integrase	Enterobacteria_phage(83.33%)	12	4235492:4235508	4247386:4247402
4235492:4235508	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4238268_4240602_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4240616_4240937_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4240933_4241161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4241157_4241709_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4241705_4241972_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|4242076_4242205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075207146.1|4242446_4243256_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|4243259_4243499_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4243514_4244081_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4244519_4245461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4245469_4245925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4245947_4247216_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4247386:4247402	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 14
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	4496880	4541128	4945392	plate,protease,tail,portal,terminase,holin,integrase,tRNA,head,capsid	Shigella_phage(45.28%)	61	4499014:4499029	4502420:4502435
WP_000918353.1|4496880_4498296_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235555.1|4498360_4499344_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4499014:4499029	attL	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000891414.1|4499518_4499761_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_052934728.1|4499928_4500966_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4501054_4502152_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217553.1|4502213_4502462_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
4502420:4502435	attR	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000639149.1|4502605_4503169_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4503494_4504223_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_063177172.1|4504224_4504632_+|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	85.2	5.1e-62
WP_077950487.1|4504635_4505253_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	88.7	4.2e-100
WP_052934727.1|4505222_4506755_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4506758_4507343_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4507333_4508392_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4508378_4508804_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4508803_4509352_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4509351_4510431_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4510427_4511756_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4511846_4512359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052896704.1|4512440_4514273_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	5.1e-303
WP_000661047.1|4514414_4514684_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4514683_4515040_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_052909137.1|4515039_4516533_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.6	5.9e-273
WP_065312204.1|4516519_4516687_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
WP_000779292.1|4516695_4517256_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|4517252_4517759_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_052909138.1|4517733_4518144_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	1.8e-70
WP_000927719.1|4518140_4518464_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4518438_4518666_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_052909139.1|4518715_4519921_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	7.0e-224
WP_001193631.1|4519935_4520586_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001524100.1|4520563_4521805_-|portal	phage portal protein	portal	U5P411	Shigella_phage	100.0	6.9e-243
WP_000605606.1|4521804_4521987_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088159.1|4521998_4523732_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
WP_000929174.1|4523745_4524231_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_048348925.1|4524356_4524707_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	93.1	2.4e-60
WP_023259402.1|4525160_4525553_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.0	1.2e-52
WP_023200327.1|4525536_4526013_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	1.4e-87
WP_023200326.1|4526016_4526352_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	2.1e-53
WP_001306866.1|4526489_4526732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200325.1|4527020_4527773_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.1e-137
WP_012513026.1|4527786_4528776_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001061375.1|4528783_4529581_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.3e-149
WP_000767130.1|4529600_4529990_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210148.1|4529986_4530313_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_000066917.1|4530309_4530963_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001603279.1|4531057_4531969_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	79.2	6.4e-137
WP_001250269.1|4531958_4532138_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001607205.1|4532313_4532871_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	5.7e-96
WP_000187185.1|4532893_4533142_-	chaperone TorD	NA	NA	NA	NA	NA
WP_000853319.1|4533277_4533964_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_048349017.1|4533946_4534837_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	31.9	9.0e-35
WP_047624181.1|4535042_4535351_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_001307125.1|4535288_4535630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008249.1|4535985_4536522_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_023200800.1|4536512_4537391_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.5	1.8e-165
WP_023200799.1|4537387_4537861_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	70.1	1.2e-59
WP_000212745.1|4537862_4538150_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_024146004.1|4539164_4539737_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	7.1e-110
WP_001093914.1|4539773_4540046_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_000900143.1|4540079_4540541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535325.1|4540546_4541128_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
>prophage 15
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	4566958	4585113	4945392	plate,tail	Burkholderia_phage(45.0%)	23	NA	NA
WP_000615248.1|4566958_4567306_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4567881_4568169_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4568171_4568777_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4568789_4569104_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4569263_4569719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4569715_4569913_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_063177174.1|4569902_4571330_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907495.1|4571329_4571854_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4571905_4572223_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4572182_4572311_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4572407_4574762_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4574761_4575715_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4575714_4575924_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4575911_4576955_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4576964_4577687_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4578014_4578377_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4578373_4579303_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4579302_4580850_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4581013_4581373_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_063177175.1|4581363_4582479_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	1.2e-100
WP_001749149.1|4582471_4583104_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4583106_4584588_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4584597_4585113_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
>prophage 16
NZ_CP014659	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome	4945392	4657141	4738606	4945392	plate,protease,tail,portal,terminase,holin,integrase,tRNA,head,capsid	Enterobacteria_phage(74.51%)	88	4727400:4727415	4740904:4740919
WP_000186981.1|4657141_4658242_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000813838.1|4658288_4658648_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000971958.1|4658663_4659299_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120791.1|4659497_4660898_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025919.1|4660880_4661798_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_023244222.1|4662082_4663459_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_086776771.1|4663576_4664353_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935336.1|4664360_4665365_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_000800208.1|4665453_4666605_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005548.1|4666973_4669625_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_001192085.1|4669835_4671569_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274595.1|4671729_4672566_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000424866.1|4672820_4673483_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
WP_000374031.1|4673494_4674598_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_023243531.1|4674856_4675480_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000108115.1|4675537_4677718_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007508.1|4677882_4678773_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_023244221.1|4678967_4680524_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023243532.1|4680659_4681784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243533.1|4682018_4683017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398249.1|4683019_4683877_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_000110825.1|4683992_4686425_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000197213.1|4686427_4687588_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852811.1|4687852_4688170_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000899644.1|4688625_4690416_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_000792803.1|4690616_4691279_+	TIGR02117 family protein	NA	NA	NA	NA	NA
WP_000715284.1|4691324_4691537_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_023243534.1|4691740_4693939_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000841337.1|4694093_4695119_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068811.1|4695212_4696187_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208240.1|4696278_4696809_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4696818_4698150_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|4698216_4699146_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4699238_4699724_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000215756.1|4699857_4700664_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|4700608_4700806_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|4700998_4701295_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|4701430_4701571_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|4701761_4702022_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132818.1|4702064_4703165_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.2e-206
WP_052909162.1|4703322_4704507_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	1.4e-224
WP_000290450.1|4704506_4705019_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_001756478.1|4705073_4705439_+|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	2.2e-56
WP_000763327.1|4705474_4705603_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_052870280.1|4705589_4708397_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.2	0.0e+00
WP_000979945.1|4708409_4708898_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_052909161.1|4708935_4709526_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	1.5e-86
WP_063177176.1|4709553_4710837_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	99.0	3.9e-241
WP_006678265.1|4710806_4711424_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4711427_4711835_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_077950488.1|4711836_4713951_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	90.0	2.3e-230
WP_000071724.1|4713947_4714556_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111951.1|4714548_4715445_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000213447.1|4715448_4715799_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_050901164.1|4715795_4716377_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	4.7e-101
WP_000356344.1|4716373_4717009_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_044860451.1|4717001_4717469_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	5.5e-84
WP_052909143.1|4717606_4718014_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000072327.1|4718010_4718403_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|4718399_4718723_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|4718725_4718926_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|4718925_4719420_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632321.1|4719521_4720322_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	9.3e-132
WP_052909144.1|4720367_4721420_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.4	7.8e-187
WP_052909145.1|4721443_4722280_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	8.7e-149
WP_000613772.1|4722434_4724186_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087795.1|4724185_4725232_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
WP_052909146.1|4725723_4726263_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	66.7	6.2e-23
WP_050901162.1|4726259_4726859_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	63.6	9.0e-31
WP_052870241.1|4726922_4727234_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.9e-48
WP_000686519.1|4727238_4728198_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	2.0e-181
4727400:4727415	attL	CCAGCGCGCGGATCAC	NA	NA	NA	NA
WP_052909147.1|4728274_4731100_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.1	0.0e+00
WP_000564227.1|4731096_4731486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001701923.1|4731482_4732103_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.0	1.0e-08
WP_023140813.1|4732156_4732987_-	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_001036813.1|4732983_4733187_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000991530.1|4733198_4733498_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.5e-39
WP_000153674.1|4733494_4733740_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|4733736_4733940_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021656.1|4734026_4734140_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000357028.1|4734136_4734379_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000159456.1|4734390_4734669_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_052909148.1|4734679_4735021_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.5e-54
WP_001001394.1|4735039_4735366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|4735461_4735764_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001440068.1|4735797_4736820_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	2.7e-99
WP_000051370.1|4737122_4737362_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4737760_4738606_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
4740904:4740919	attR	GTGATCCGCGCGCTGG	NA	NA	NA	NA
